• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
The evolution of large DNA viruses: combining genomic information
The evolution of large DNA viruses: combining genomic information

... capture event by a poxviral ancestor before primate and rodent orders diverged, although a larger sample of taxa are required to confirm this [20]. Finally, a recent case of host gene capture was observed in a mammalian 2b-1,6-Nacetylglucosaminyltransferase-mucin type protein and its only known vira ...
Kernels for gene regulatory regions
Kernels for gene regulatory regions

... sequences. While various motif-based sequence kernels have been described in the literature (e.g., [3, 4, 5]), these kernels typically operate on sequences from a single species, ignoring relevant information from orthologous sequences. In contrast, our hierarchy of motif-based kernels accounts for ...
Xiong, N., C.H. Kang, and D.H. Raulet. 2002. Redundant and unique roles of two enhancer elements in the TCR gamma locus in gene regulation and gamma delta T cell development. Immunity 16:453-463. 
Xiong, N., C.H. Kang, and D.H. Raulet. 2002. Redundant and unique roles of two enhancer elements in the TCR gamma locus in gene regulation and gamma delta T cell development. Immunity 16:453-463. 

... in which 3⬘EC␥1 was deleted (E⫺/⫺ mice). A 2.0 kb Asp718HindIII fragment containing 3⬘EC␥1 was replaced by a neo cassette flanked by loxP sites in J1 ES cells (Figures 1E and 1F). Chimeric mice were generated and crossed to a CD1 strain that expresses a CMV-Cre transgene that directs Cre synthesis i ...
DNA Chips: Genes to Disease
DNA Chips: Genes to Disease

... could use microarray analysis. As the first step in this process, a gene chip would be created. DNA chip, microarray, gene chip, and genome chip are all terms that describe a solid matrix, such as a glass slide, that is imprinted with a precisely arranged pattern of spots, each made up of many copie ...
Bio 100 Placement Study Guidelines
Bio 100 Placement Study Guidelines

... 1.! Identify the components of double-stranded DNA. 2.! Explain how hydrogen bonds contribute to the structure of DNA. 3.! Use a template strand of nucleotides to create a complementary strand. 4.! Explain the roles of DNA, RNA, and protein in gene function. 5.! Describe the events in transcription ...
Supplementary Methods Tables
Supplementary Methods Tables

... TCGA data at the DCC is organized by platform, data type and data level. Each platform may produce several types of data. For example, SNP-based platforms yield three data types: SNP, Copy Number Results, and Loss of Heterozygosity (LOH). The TCGA concept of data level segregates raw data from deriv ...
GATA factor function in heart development
GATA factor function in heart development

... 457 bp of DNA from immediately upstream of the gene (Winick et al., 1993), were generated in this study. Six showed a reproducible pattern of lacZ gene expression in the dorsal mesoderm and amnioserosa of transformant embryos. The E2-3-9 enhancer trap line has been described in Hartenstein and Jan ( ...
Chapter 12 Translation and the Genetic Code
Chapter 12 Translation and the Genetic Code

... bond & a second electronegative atom Ionic bondselectrostatic interaction two oppositely charged ions van der Waals interactionsinteractions between dipoles (requires close proximity and specific orientation) ...
BOX 39.2 MOLECULAR MECHANISMS OF CIRCADIAN
BOX 39.2 MOLECULAR MECHANISMS OF CIRCADIAN

... Virtually nothing was known about the genetic and molecularmechanisms controlling circadian rhythms until the late 1960s, when Seymour Benzer and his graduate student, Ron Konopka, identified the first mutations affecting circadian behavior. Most scientists at the timewere skeptical that individual ...
pdf
pdf

... Sea, as well as with sequences from surface waters in many other locations, including the North Pacific, North Atlantic, and South China Sea. Although several clones (32 from each depth) of the PCR products obtained with the nested nifH primers from the euphotic zone at Station 2 and the chlorophyll ...
pdf, 1.3 MB - DNA and Natural Algorithms Group
pdf, 1.3 MB - DNA and Natural Algorithms Group

... the superduplexes contain one parental strand and one daughter strand. All that remains to be done in this step is to remove the motor apparatus and separate the two superduplexes to allow another round of replication. This is achieved with the addition of the four motor removal strands Y, Y¢, Z, an ...
DNA Testing - Who Murdered Robert Wone
DNA Testing - Who Murdered Robert Wone

... significant problem. The ability of small amounts of DNA to produce false and misleading results is well-known and well-documented within the research community, where the technology originated. Anyone who has caught a cold from an unknown source, or who has a pollen allergy should have some sense o ...
Supplementary Information (doc 1628K)
Supplementary Information (doc 1628K)

... ATG9B autophagy related 9B homolog ...
Molecular analysis of the structure and expression of the RH... individuals with D--, Dc-, and DCw- gene complexes
Molecular analysis of the structure and expression of the RH... individuals with D--, Dc-, and DCw- gene complexes

... Among the different cDNAs sequenced, some were found to contain a 44-bp insertion (GGGCTGGGAAGTCTGCATGCTGTCTATAAATCCAGAACCAGAAG) between nucleotides 148and149. This position corresponds to the boundary junction of exons 1 and 2.'7As hybridization experiments indicated that this 44-bp sequence was lo ...
Magnusiomyces capitatus (de Hoog et al.) de Hoog et Smith
Magnusiomyces capitatus (de Hoog et al.) de Hoog et Smith

... 1.  Fungal genomic DNA is provided in a dried form. Store at +2°C to 8°C upon receipt. Store at ­20°C if stored for more than 6 months). Note:  Do not store in freezers with a defrost cycle.  This will expose the product to increased temperatures. 2.  Concentration by PicoGreen® measurement was foun ...
Presentation
Presentation

... all their offspring are of the same variety. • Hybridization: Mating, or crossing, of two varieties. • Inbreeding: The crossing of two individuals that have ...
Real-time Quantification of HER2/neu Gene Amplification by
Real-time Quantification of HER2/neu Gene Amplification by

... PCR approaches published so far have used reference genes which are not localized on chromosome 17. Therefore it is not possible to distinguish whether a small region of the chromosome or the whole chromosome is amplified. But chromosome aneuploidy, including loss and gain of chromosome 17, is seen ...
Identification of Differentially Expressed Genes in Blood Cells of
Identification of Differentially Expressed Genes in Blood Cells of

... blood collection. HLA typing for the HLA-DRB1 and DQB1 loci was performed for all the subjects at the NPO HLA Laboratory (Kyoto, Japan). All 32 narcoleptic patients and 7 of the 32 control subjects (4 of the 12 subjects used for initial screening and 3 of the 20 subjects used in the validation study ...
network - bioinf leipzig
network - bioinf leipzig

... Regulatory interactions can also be inferred directly from data = reverse engineering of biological pathways/networks from data. In the example above time-series expression data61is used to infer a directed and signed graph based on delayed correlations. ...
Biology Ch. 13
Biology Ch. 13

... DNA Tools  An organism’s genome is the total DNA in the nucleus of each cell.  DNA tools can be used to manipulate DNA and to isolate genes from the rest of the genome. ...
pdf
pdf

... transposition affords an opportunity to seal chromosome breaks. Other possible benefits have not been excluded. Thus the relationship between transposable elements and their hosts may be as much symbiotic as parasitic. Resolving these issues is an interesting challenge for future research. Discovery ...
The Caenorhabditis elegans NK-2 class
The Caenorhabditis elegans NK-2 class

... hlh-1, expressed specifically in body wall muscles and their clonal precursors (Krause et al., 1990). No hlh-1 expression is seen in pharyngeal muscle or the minor muscles, suggesting that differentiation of these muscle types may be analogous to that of vertebrate cardiac or smooth muscle. We have ...
Recombinant DNA Technology
Recombinant DNA Technology

... • Non-protein coding pieces of DNA (introns) are cloned in addition to exons; majority of genomic DNA is introns in eukaryotes so majority of the library will contain non-coding pieces of DNA • Many organisms have very large genome, so searching for gene of interest is difficult at best Copyright © ...
Mutation, repair, and recombination
Mutation, repair, and recombination

... Lysine and arginine are two amino acids with similar sized “R” (side-) groups and similar biochemical behavior (for example, both are basic residues). A mutation results in substitution of lysine for arginine and has no detectable effect on the function of that protein. Which statement best applies ...
Molecular Mechanisms of Plant and Microbe Coexistence
Molecular Mechanisms of Plant and Microbe Coexistence

... of operons active in the synthesis of ribosomal RNA, Marschner and Crowley (1996) demonstrated that rDNA genes were highly expressed and thus growth of P. fluorescens was higher in the rhizosphere of pepper than in the bulk soil. Ramos et al. (2000), using a ribosomal promoter driven inserted with a ...
< 1 ... 45 46 47 48 49 50 51 52 53 ... 498 >

Primary transcript



A primary transcript is the single-stranded ribonucleic acid (RNA) product synthesized by transcription of DNA, and processed to yield various mature RNA products such as mRNAs, tRNAs, and rRNAs. The primary transcripts designated to be mRNAs are modified in preparation for translation. For example, a precursor messenger RNA (pre-mRNA) is a type of primary transcript that becomes a messenger RNA (mRNA) after processing.There are several steps contributing to the production of primary transcripts. All these steps involve a series of interactions to initiate and complete the transcription of DNA in the nucleus of eukaryotes. Certain factors play key roles in the activation and inhibition of transcription, where they regulate primary transcript production. Transcription produces primary transcripts that are further modified by several processes. These processes include the 5' cap, 3'-polyadenylation, and alternative splicing. In particular, alternative splicing directly contributes to the diversity of mRNA found in cells. The modifications of primary transcripts have been further studied in research seeking greater knowledge of the role and significance of these transcripts. Experimental studies based on molecular changes to primary transcripts the processes before and after transcription have led to greater understanding of diseases involving primary transcripts.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report