• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Determining the Transcription Factor Genes Populating a Fruit Fly
Determining the Transcription Factor Genes Populating a Fruit Fly

... transcription factor genes that encode proteins that bind to DNA in a sequence specific manner, and differentiation genes that encode proteins responsible for making a cell or tissue phenotype (Davidson, 2006). The expression patterns for network genes are controlled by a cis-regulatory element (CRE ...
DETERMINATION  AND  POLARITY
DETERMINATION AND POLARITY

a method for detecting and typing of salmonella by multiplex pcr
a method for detecting and typing of salmonella by multiplex pcr

... GCCCACCAGTTGTGAAAGGC ...
Genetics fill in review
Genetics fill in review

... 41. Portions of genes that actually get translated into proteins are called ____________________. 42. Genes may be made more accessible to RNA polymerase by a sequence of nucleotides called ____________________. 43. As an organism grows from a zygote, certain genes in each cell are allowed to be exp ...
Rfam Documentation
Rfam Documentation

... Seed alignments and secondary structure annotation Our seed alignments are small, curated sets of representative sequences for each family, as opposed to an alignment of all known members. The seed alignment also has as a secondary structure annotation, which represents the conserved secondary struc ...
The Homothorax homeoprotein activates the nuclear localization of
The Homothorax homeoprotein activates the nuclear localization of

... have P-tagged mutants with the posterior eye pigmentation phenotype (Pradip Sinha, pers. comm.) Complementation tests showed that tss and hth are different loci (data not shown). Mutant hth and tss embryos have similar head defects. Two tss mutants (tss47 and tss470) were also defective for hth. The ...
Effete, a Drosophila chromatin-associated ubiquitin
Effete, a Drosophila chromatin-associated ubiquitin

... TPE suppressors has been a difficult task due the widespread presence of TAS deficiencies among Drosophila stocks and the allele specific differences among the mutations that suppress TPE (Boivin et al. 2003; Mason et al. 2004; Doheny et al. 2008). So far, only a few bona fide TPE suppressors have b ...
The growth hormone auxin
The growth hormone auxin

... The AUX/IAA genes • Transcription is rapidly induced by auxin • Independent of protein synthesis - primary response • Induced by cycloheximide • Unstable nuclear proteins • Large gene family (29 in Arabidopsis) AUX/IAA proteins probably serve as negative regulators ...
Product description P018-G1 SHOX-v03 - MRC
Product description P018-G1 SHOX-v03 - MRC

... - Complete or partial duplications found within SHOX or its surrounding regulatory regions have been found in LWD and ISS patients (Benito-Sanz et al. 2011b). - Deletion of the SHOX intron 6 probes, which are located downstream of the stop codon, may not affect SHOX gene function. - Please note that ...
Standard PDF - Wiley Online Library
Standard PDF - Wiley Online Library

... P. carinii genes is proposed in which each gene would be designated by an italic three-letter lower case symbol. The first allele (i.e. sequence) that is found would have a superscript 1, such as xyz11 . Any subsequent alleles would be designated as xyz12 , etc. A protein would have the same symbol ...
Diffuse Aggressive B-cell Lymphomas
Diffuse Aggressive B-cell Lymphomas

... – Shares aspects with other lymphomas, probably due to common pathogenic pathways (Burkitt-like, Hodgkin-like, Grey zone lymphomas) – Don’t look like DLBCL (T-cell/Histiocyte rich lymphomas or presence of RS cells especially EBV+ cases) ...
Engrailed cooperates with extradenticle and homothorax to repress
Engrailed cooperates with extradenticle and homothorax to repress

... Fig. 1F-H, complete removal of both maternal and zygotic exd function caused a dramatic drop in En repression activity on the slp gene. However, as with hth, there appeared to be residual activity even in the absence of exd function. Thus, although En retains a residual repression activity in vivo w ...
Huntingtin function during zebrafish (Danio rerio) development
Huntingtin function during zebrafish (Danio rerio) development

18. The Reference Sequence (RefSeq) Project
18. The Reference Sequence (RefSeq) Project

... a suite of precomputed BLAST results, literature review, review of available database and Web resources (both in-house and external), and collaboration to curate the nucleotide and protein sequence data and to apply additional annotation and descriptive information to both the RefSeq sequence record ...
Drosophila WntD is a target and an inhibitor of the Dorsal/Twist/Snail
Drosophila WntD is a target and an inhibitor of the Dorsal/Twist/Snail

... zygotic genes that are expressed in the ventral region with different lateral limits. These target genes may promote the ventral (mesodermal) cell fate or the lateral (neuroectodermal) cell fate. Snail specifically represses those genes that are not compatible with mesoderm formation. Consistent wit ...
Visceral endoderm-restricted translation of Otx1
Visceral endoderm-restricted translation of Otx1

... patterns, Otx2 is required for proper gastrulation and specification of an early neural plate when Otx1 expression is still off, and, at a later stage, Otx1 is required primarily in the dorsal telencephalon where Otx2 is not transcribed. Therefore, these findings support two hypotheses: (i) Otx1 and ...
Gene Section MLL (myeloid/lymphoid or mixed lineage leukemia) Atlas of Genetics and Cytogenetics
Gene Section MLL (myeloid/lymphoid or mixed lineage leukemia) Atlas of Genetics and Cytogenetics

... bind acetylated histones), and 1 plant homeodomain; these domains may be involved in protein-protein interaction; a FYRN and a FRYC domain; a transactivation domain which binds CBP; may acetylates H3 and H4 in the HOX area; a SET domain: methyltransferase; methyltates H3, including histones in the H ...
Novel pathogen-specific primers for the detection of Agrobacterium
Novel pathogen-specific primers for the detection of Agrobacterium

... limits the efficiency of PCR. For example, the virC-specific primers amplify the corresponding sequences from A. tumefaciens (SAWADA et al. 1995), but not from A. vitis (SZEGEDI and BOTTKA, 2002). Although an improved virCspecific primer pair detected some A. vitis strains (KAWAGUCHI et al. 2005), comp ...
NO sensing by FNR: regulation of the Escherichia coli NO
NO sensing by FNR: regulation of the Escherichia coli NO

... the ¯avohaemoglobin-encoding gene of E.coli, hmp, is upregulated by NO and RNS; this appears not to involve SoxRS (Poole et al., 1996). We have reported (MembrilloHernaÂndez et al., 1998) a mechanism of hmp gene regulation that involves interaction between S-nitrosothiols and Hcy. Intracellular Hcy ...
An AT-hook gene is required for palea formation and floral organ
An AT-hook gene is required for palea formation and floral organ

... other grasses, class A genes in rice remain difficult to determine. Similar to rice, the maize outer whorl organ identity remains elusive that molecular dissection of regulatory pathways has just started (Thompson et al., 2009; Whipple et al., 2010). In order to understand the molecular regulation of ...
univERsity oF copEnhAGEn
univERsity oF copEnhAGEn

... Phenotypic variation between individuals of a species is often under quantitative genetic control. Genomic analysis of gene expression polymorphisms between individuals is rapidly gaining popularity as a way to query the underlying mechanistic causes of variation between individuals. However, there ...
hhmi resource for new ap bio curriculum
hhmi resource for new ap bio curriculum

... The new AP® Biology course curriculum released by the College Board is balancing the overwhelming expansion of the field of Biology (the breadth) with the depth of understanding of fundamental topics required of the students. The new course shifts from focusing on content coverage to a focus on endu ...
The presence of an RHD pseudogene containing a
The presence of an RHD pseudogene containing a

Selecting Degenerate Multiplex PCR Primers
Selecting Degenerate Multiplex PCR Primers

... thousands of SNPs, they must be scalable, automated, robust, and inexpensive [9]. One technique involves the use of multiplex PCR (MP-PCR) to amplify the regions around the SNP. Multiplex PCR is a variation of PCR where multiple DNA fragments are replicated simultaneously. MP-PCR, like all PCR varia ...
SALSA MLPA probemix P222-A2 LCA mix-2 - MRC
SALSA MLPA probemix P222-A2 LCA mix-2 - MRC

... elements of vision and also serve as essential modulators of cellular differentiation and proliferation in diverse cell types. RDH12 belongs to a family of dual-specificity retinol dehydrogenases that metabolize both all-trans- and cis-retinols (Haeseleer et al., J Biol Chem, 2002). The RDH12 gene ( ...
1 2 3 4 5 ... 498 >

Primary transcript



A primary transcript is the single-stranded ribonucleic acid (RNA) product synthesized by transcription of DNA, and processed to yield various mature RNA products such as mRNAs, tRNAs, and rRNAs. The primary transcripts designated to be mRNAs are modified in preparation for translation. For example, a precursor messenger RNA (pre-mRNA) is a type of primary transcript that becomes a messenger RNA (mRNA) after processing.There are several steps contributing to the production of primary transcripts. All these steps involve a series of interactions to initiate and complete the transcription of DNA in the nucleus of eukaryotes. Certain factors play key roles in the activation and inhibition of transcription, where they regulate primary transcript production. Transcription produces primary transcripts that are further modified by several processes. These processes include the 5' cap, 3'-polyadenylation, and alternative splicing. In particular, alternative splicing directly contributes to the diversity of mRNA found in cells. The modifications of primary transcripts have been further studied in research seeking greater knowledge of the role and significance of these transcripts. Experimental studies based on molecular changes to primary transcripts the processes before and after transcription have led to greater understanding of diseases involving primary transcripts.
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report