Growth and killing of a Salmonella enterica serovar
... Hildreth was obtained from the Developmental Studies Hybridoma Bank, developed under the auspices of the NICHD and maintained by the Department of Biological Sciences, University of Iowa (Iowa City, IA, USA), and was used at a dilution of 1 : 2000 for LAMP-1 staining in HeLa cells. AntiLAMP-1 rabbit ...
... Hildreth was obtained from the Developmental Studies Hybridoma Bank, developed under the auspices of the NICHD and maintained by the Department of Biological Sciences, University of Iowa (Iowa City, IA, USA), and was used at a dilution of 1 : 2000 for LAMP-1 staining in HeLa cells. AntiLAMP-1 rabbit ...
Isoflavone and Pterocarpan Malonylglucosides and ß -l,3
... pan malonylglucosides of chickpea has not been proven clearly until yet. Apart from the accumulation of phytoalexins the synthesis of pathogenesis-related proteins is an especially prominent reaction of plants after microbial infection or elicitation [18]. Recent in vestigations have identified dif ...
... pan malonylglucosides of chickpea has not been proven clearly until yet. Apart from the accumulation of phytoalexins the synthesis of pathogenesis-related proteins is an especially prominent reaction of plants after microbial infection or elicitation [18]. Recent in vestigations have identified dif ...
Giant nuclei is essential in the cell cycle transition from meiosis to
... restored fertility to homozygous gnu females such that they produced fertile adult progeny. The premature stop codon and SpeI site were introduced by site-directed mutagenesis using the QuikChange (Stratagene) strategy with the primers CTGAGGCAGGAGGAATACTAGTTGAAAAGTGCGCG and CGCGCACTTTTCAACTAGTATTC ...
... restored fertility to homozygous gnu females such that they produced fertile adult progeny. The premature stop codon and SpeI site were introduced by site-directed mutagenesis using the QuikChange (Stratagene) strategy with the primers CTGAGGCAGGAGGAATACTAGTTGAAAAGTGCGCG and CGCGCACTTTTCAACTAGTATTC ...
Electron Tomographic Analysis of Somatic Cell Plate Formation in
... Histograms of the size distribution of cell plate–forming vesicles during different stages of cell plate formation. The individual bars indicate the number of vesicles per 5-nm diameter interval. Closed bars, small-dark vesicles; shaded bars, large-light vesicles. ...
... Histograms of the size distribution of cell plate–forming vesicles during different stages of cell plate formation. The individual bars indicate the number of vesicles per 5-nm diameter interval. Closed bars, small-dark vesicles; shaded bars, large-light vesicles. ...
Full Text
... nucleosomes are the major targets for SWI/SNF action. Several other strategic changes to chromatin occur in multicellular organisms, including the appearance of histone H1, which may also create chromatin structures that require BAF complexes for conversion to more accessible DNA. With the evolution ...
... nucleosomes are the major targets for SWI/SNF action. Several other strategic changes to chromatin occur in multicellular organisms, including the appearance of histone H1, which may also create chromatin structures that require BAF complexes for conversion to more accessible DNA. With the evolution ...
nimO is required for the G1/S transition
... Initiation of DNA replication occurs first by formation of the pre-RC which renders the origin replication-competent, and second by activation of the pre-RC so that origin sequences can be unwound and replication forks established (Diffley et al., 1994). The mechanism for origin activation apparentl ...
... Initiation of DNA replication occurs first by formation of the pre-RC which renders the origin replication-competent, and second by activation of the pre-RC so that origin sequences can be unwound and replication forks established (Diffley et al., 1994). The mechanism for origin activation apparentl ...
UNIT 1 – FORCE AND MOTION (SEPUP Force and
... B-2.2 Summarize the structures and functions of organelles found in a eukaryotic cell (including the nucleus, mitochondria, chloroplasts, lysosomes, vacuoles, ribosomes, endoplasmic reticulum (ER), Golgi apparatus, cilia, flagella, cell membrane, nuclear membrane, cell wall, and cytoplasm). B-2.3 Co ...
... B-2.2 Summarize the structures and functions of organelles found in a eukaryotic cell (including the nucleus, mitochondria, chloroplasts, lysosomes, vacuoles, ribosomes, endoplasmic reticulum (ER), Golgi apparatus, cilia, flagella, cell membrane, nuclear membrane, cell wall, and cytoplasm). B-2.3 Co ...
Integrin cytoplasmic domain-binding proteins
... phosphorylation, which could account for myosin recruitment. Binding of skelemin, a cytoskeletal M-band protein, to β1 and β3 but not β2 tails was also reported recently (Reddy et al., 1998). Skelemin has an unique N-terminal region followed by Ig superfamily C2 and fibronectin (FN) type II motifs. ...
... phosphorylation, which could account for myosin recruitment. Binding of skelemin, a cytoskeletal M-band protein, to β1 and β3 but not β2 tails was also reported recently (Reddy et al., 1998). Skelemin has an unique N-terminal region followed by Ig superfamily C2 and fibronectin (FN) type II motifs. ...
Transcription Factor Positive Regulatory Domain 4 (PRDM4) recruits Protein Arginine
... been identified in the human genome (22). All PRDM family members are characterized by the presence of a PR (positive regulatory) domain and multiple zinc finger (ZnFg) domains. The PR domains are similar to, but distinct from, the SET domains found in many histone lysine methyltransferases (MTases) ...
... been identified in the human genome (22). All PRDM family members are characterized by the presence of a PR (positive regulatory) domain and multiple zinc finger (ZnFg) domains. The PR domains are similar to, but distinct from, the SET domains found in many histone lysine methyltransferases (MTases) ...
Bacterial Growth and Cell Division: a Mycobacterial Perspective
... factor), sulfolipids specific to M. tuberculosis, and the phosphatidylinositol mannosides. In slow-growing, pathogenic mycobacteria, such as M. tuberculosis and M. leprae, the LAMs are capped at the terminal -Ara residue with mannose residues and are referred to as ManLAMs (68, 69, 301, 324), where ...
... factor), sulfolipids specific to M. tuberculosis, and the phosphatidylinositol mannosides. In slow-growing, pathogenic mycobacteria, such as M. tuberculosis and M. leprae, the LAMs are capped at the terminal -Ara residue with mannose residues and are referred to as ManLAMs (68, 69, 301, 324), where ...
Comparison of fermentation rates of a wild-type and
... Based on these findings, it is believed that the wild-type strain of S. cerevisiae will produce a greater amount of ethanol than the YRL044C strain. Examining the role of PDC1 in ethanol production is important because, due to its wide variety of commercial and industrial applications, the amount o ...
... Based on these findings, it is believed that the wild-type strain of S. cerevisiae will produce a greater amount of ethanol than the YRL044C strain. Examining the role of PDC1 in ethanol production is important because, due to its wide variety of commercial and industrial applications, the amount o ...
Budding Yeast for Budding Geneticists: A Primer on the
... between bacteria and human cells in size. They form colonies on agar plates in the laboratory in a few days with no special incubators required. Yeast stocks are maintained by freezing at 280° in glycerol or can be freeze-dried and stored at room temperature for years. In nature, yeasts are found in ...
... between bacteria and human cells in size. They form colonies on agar plates in the laboratory in a few days with no special incubators required. Yeast stocks are maintained by freezing at 280° in glycerol or can be freeze-dried and stored at room temperature for years. In nature, yeasts are found in ...
Inhibition of Transdifferentiation into Tracheary Elements by Polar
... (20 µM)-treated cells at the initiation of culture. However, such lower concentrations of NAA did not restore TE differentiation. Next, additional NAA at various concentrations was applied to cell cultures containing 20 µM NPA and 0.54 µM NAA at the initiation of culture. As a result, high concentra ...
... (20 µM)-treated cells at the initiation of culture. However, such lower concentrations of NAA did not restore TE differentiation. Next, additional NAA at various concentrations was applied to cell cultures containing 20 µM NPA and 0.54 µM NAA at the initiation of culture. As a result, high concentra ...
Monomeric alpha-catenin links cadherin to the actin cytoskeleton
... The linkage of adherens junctions to the actin cytoskeleton is essential for cell adhesion. The contribution of the cadherin–catenin complex to the interaction between actin and the adherens junction remains an intensely investigated subject that centres on the function of α-catenin, which binds to ...
... The linkage of adherens junctions to the actin cytoskeleton is essential for cell adhesion. The contribution of the cadherin–catenin complex to the interaction between actin and the adherens junction remains an intensely investigated subject that centres on the function of α-catenin, which binds to ...
Early Morphogenesis of the Caenorhabditis elegans Pharynx
... JAM-1::GFP expression, located at the tip of the wedge and their basolateral compartment extending over the remaining surfaces (Figs. 3A, 3C, and 3E). The cells’ apicobasal polarity is aligned along the rostrocaudal axis of the embryo with the apical surface facing posterior and the basal surface fl ...
... JAM-1::GFP expression, located at the tip of the wedge and their basolateral compartment extending over the remaining surfaces (Figs. 3A, 3C, and 3E). The cells’ apicobasal polarity is aligned along the rostrocaudal axis of the embryo with the apical surface facing posterior and the basal surface fl ...
The cell biology of bone metabolism
... Considerable progress has been made in identifying morphogens, signalling pathways and transcriptional regulators mediating differentiation of mesenchymal stem cells into osteoprogenitors (fig 3). During skeletal development osteoblast differentiation and deposition of bone matrix occurs, and involv ...
... Considerable progress has been made in identifying morphogens, signalling pathways and transcriptional regulators mediating differentiation of mesenchymal stem cells into osteoprogenitors (fig 3). During skeletal development osteoblast differentiation and deposition of bone matrix occurs, and involv ...
In vivo assays to study histone ubiquitylation
... similar in many parameters to nucleosomes containing unmodified histones [36]. Because ubiquitin is a bulky moiety, it has been postulated that its attachment to histones could disrupt chromatin folding [35,37]. This argument tends to be supported by the observation that metazoan histones are globall ...
... similar in many parameters to nucleosomes containing unmodified histones [36]. Because ubiquitin is a bulky moiety, it has been postulated that its attachment to histones could disrupt chromatin folding [35,37]. This argument tends to be supported by the observation that metazoan histones are globall ...
Determination of the Structure and Composition of the ` Sulphur
... content; because of limitation of material, only one sample of each was used. In general, the extraction procedures of Park & Hancock (1960)were used to determine the cellular contents and to prepare the organisms for cell-wall analyses. After the extraction procedure of Park & Hancock (1960) the or ...
... content; because of limitation of material, only one sample of each was used. In general, the extraction procedures of Park & Hancock (1960)were used to determine the cellular contents and to prepare the organisms for cell-wall analyses. After the extraction procedure of Park & Hancock (1960) the or ...
arc6, an extreme chloroplast division mutant of Arabidopsis also
... cell, and these profiles are highly variable in size with an average twofold increase in area compared to wild type (Table 1). Although the arc6 proplastids are larger and more irregular in shape, their internal structure is similar to wild type and a small amount of internal membrane is present. Be ...
... cell, and these profiles are highly variable in size with an average twofold increase in area compared to wild type (Table 1). Although the arc6 proplastids are larger and more irregular in shape, their internal structure is similar to wild type and a small amount of internal membrane is present. Be ...
form 1 april, 2012 holiday assignment questions
... N/B: 1. The questions outlined herein summarise the concepts to be learnt in the topic of Cell Physiology. It is therefore mandatory that all students read, understand and make short notes about the aforementioned topic during the holiday before attempting the questions. Revision of this assignment ...
... N/B: 1. The questions outlined herein summarise the concepts to be learnt in the topic of Cell Physiology. It is therefore mandatory that all students read, understand and make short notes about the aforementioned topic during the holiday before attempting the questions. Revision of this assignment ...
Actin Cytoskeleton in Plants: From Transport Networks to Signaling
... impacts on expression of the eukaryotic genome (Ingber, 1993; Ingber et al., 1994; Chicurel et al., 1998). The hunt for IFs in plants is, after the first promising results (Dawson et al., 1985; Miller et al., 1985; McNulty and Saunders, 1992), still an open race (Menzel, 1993) and it seems that, as ...
... impacts on expression of the eukaryotic genome (Ingber, 1993; Ingber et al., 1994; Chicurel et al., 1998). The hunt for IFs in plants is, after the first promising results (Dawson et al., 1985; Miller et al., 1985; McNulty and Saunders, 1992), still an open race (Menzel, 1993) and it seems that, as ...
Protection of Drosophila chromosome ends with minimal telomere
... complex includes the fast evolving, non conserved proteins HP1/ORC-associated protein (HOAP), HipHop, Verrocchio (Ver) and Modigliani (Moi), which are called Terminin proteins, and the conserved Heterochromatin Protein 1a (HP1a) (Raffa et al. 2011; 2013). Whereas HP1a localizes not only at telomeres ...
... complex includes the fast evolving, non conserved proteins HP1/ORC-associated protein (HOAP), HipHop, Verrocchio (Ver) and Modigliani (Moi), which are called Terminin proteins, and the conserved Heterochromatin Protein 1a (HP1a) (Raffa et al. 2011; 2013). Whereas HP1a localizes not only at telomeres ...
Regulatory Mechanisms for Specification and Patterning of Plant
... underlying mechanisms of cell specification and patterning of plant vascular tissues and their proliferation. The formation of the plant vascular system is a complex process that integrates signaling and gene regulation at transcriptional and posttranscriptional levels. Recently, a wealth of molecula ...
... underlying mechanisms of cell specification and patterning of plant vascular tissues and their proliferation. The formation of the plant vascular system is a complex process that integrates signaling and gene regulation at transcriptional and posttranscriptional levels. Recently, a wealth of molecula ...
Cell cycle
The cell cycle or cell-division cycle is the series of events that take place in a cell leading to its division and duplication (replication) that produces two daughter cells. In prokaryotes which lack a cell nucleus, the cell cycle occurs via a process termed binary fission. In cells with a nucleus, as in eukaryotes, the cell cycle can be divided into three periods: interphase, the mitotic (M) phase, and cytokinesis. During interphase, the cell grows, accumulating nutrients needed for mitosis, preparing it for cell division and duplicating its DNA. During the mitotic phase, the cell splits itself into two distinct daughter cells. During the final stage, cytokinesis, the new cell is completely divided. To ensure the proper division of the cell, there are control mechanisms known as cell cycle checkpoints.The cell-division cycle is a vital process by which a single-celled fertilized egg develops into a mature organism, as well as the process by which hair, skin, blood cells, and some internal organs are renewed. After cell division, each of the daughter cells begin the interphase of a new cycle. Although the various stages of interphase are not usually morphologically distinguishable, each phase of the cell cycle has a distinct set of specialized biochemical processes that prepare the cell for initiation of cell division.