Download Early Morphogenesis of the Caenorhabditis elegans Pharynx

Developmental Biology 233, 482– 494 (2001)
doi:10.1006/dbio.2001.0235, available online at http://www.idealibrary.com on
Early Morphogenesis of the Caenorhabditis
elegans Pharynx
Michael F. Portereiko and Susan E. Mango 1
Department of Oncological Sciences and Huntsman Cancer Institute Center for Children,
University of Utah, 2000 Circle of Hope, Salt Lake City, Utah 84112
We investigated the cellular behaviors that accompany the early stages of pharyngeal morphogenesis in Caenorhabditis
elegans. The embryonic pharynx develops from a ball of cells into a linear tube connected anteriorly to the buccal cavity
and posteriorly to the midgut. By using GFP reporters localized to discrete subcellular regions, we show that pharyngeal
morphogenesis can be divided into three stages: (1) lengthening of the nascent pharyngeal lumen by reorientation of
apicobasal polarity of anterior pharyngeal cells (“Reorientation”), (2) formation of an epithelium by the buccal cavity cells,
which mechanically couples the buccal cavity to the pharynx and anterior epidermis (“Epithelialization”), and (3) a
concomitant movement of the pharynx anteriorly and the epidermis of the mouth posteriorly to bring the pharynx, buccal
cavity, and mouth into close apposition (“Contraction”). Several models can account for these cellular behaviors, and we
distinguish between them by physically or genetically ablating cells within the digestive tract. These studies provide the
first description of how the pharynx primordium develops into an epithelial tube, and reveal that pharyngeal morphogenesis
resembles aspects of mammalian kidney tubulogenesis. © 2001 Academic Press
Key Words: morphogenesis; tubulogenesis; embryogenesis; foregut; pharyngeal extension; epithelia.
INTRODUCTION
The precise regulation of cell movement and shape plays
a key role in generating the three-dimensional architecture
of tissues and organs. Tubes, which are used to transport
fluids, food, or air throughout the body, are a common
component of many organs. Studies with a diverse array of
organs and animals have shown that tubes arise either from
sculpting preexisting epithelia into tubular structures (e.g.,
lung, trachea; Metzger and Krasnow, 1999) or from coalescing mesenchymal cells to generate tubular epithelia de
novo (e.g., kidney; Kuure et al., 2000). These events are
under control of a complex network of signaling pathways,
transcription factors, and adhesion molecules (Hogan, 1999;
Metzger and Krasnow, 1999; Kuure et al., 2000).
Caenorhabditis elegans provides a powerful system to
study morphogenetic events including tube formation (this
study, and Leung et al., 1999), cell migration (Chen and
Stern, 1998; Montell, 1999), and epidermal epiboly (Priess
and Hirsh, 1986; Williams-Masson et al., 1997; George et
al., 1998; Williams-Masson et al., 1998; Raich et al., 1999;
1
To whom correspondence should be addressed. E-mail:
[email protected].
482
Roy et al., 2000; reviewed in Chin-Sang and Chisholm,
2000; Simske and Hardin, 2001). Cellular behavior can be
followed at the resolution of single cells and in living
animals; the molecular components that guide these behaviors can be identified by forward and reverse genetics. Here,
we investigate pharynx morphogenesis as an example of
tube formation in C. elegans. While numerous studies have
contributed to our understanding of cell fate specification of
pharyngeal cells (Schnabel and Priess, 1997; Labouesse and
Mango, 1999), the mechanisms that drive pharyngeal morphogenesis have not been examined.
The pharynx represents the foregut of the nematode
digestive tract. The mature digestive tract is organized as a
linear epithelial tube that is regionalized both spatially and
functionally (White, 1988; Avery and Thomas, 1997). Food
(bacteria) is pumped in through the buccal cavity by the
action of the muscular pharynx, “chewed” by specialized
cuticle lining the pharynx, and passed on to the midgut for
the bulk of digestion; wastes are expelled through the
rectum and anus (or nematode hindgut). The digestive tract
provides a simple example of a linear gut since it has few
cells (127) and no organ outpocketings. Much of the digestive tract is organized as a series of rings composed of two or
three cells arranged with bi- or trilateral symmetry. The
0012-1606/01 $35.00
Copyright © 2001 by Academic Press
All rights of reproduction in any form reserved.
483
Early Morphogenesis of the C. elegans Pharynx
pharynx is more complex, with eight sets of cells joined end
to end by adherens junctions. Most of these sets are composed of six cells (six to nine nuclei) arranged with threefold
rotational symmetry around a Y-shaped lumen (Albertson
and Thomson, 1976).
The pharynx undergoes dramatic shape changes during
development, from a ball to a tube. By midembryogenesis,
gastrulation is complete and the pharyngeal primordium is
visible as a ball of cells bordering the nascent midgut in the
interior of the embryo (Sulston et al., 1983). The pharyngeal
cells are attached to each other and to the midgut by
adherens junctions (Leung et al., 1999), but are not yet
connected to the buccal cavity. Over the next 60 min, the
pharyngeal cells shift their position and organization to
form a linear tube that links the digestive tract to the
exterior. We call this process “pharyngeal extension.” During later embryogenesis, this tube develops a lumen and
undergoes a complicated program of differentiation and
morphogenesis to produce the characteristic bilobed structure of the mature pharynx. Because cell division is largely
complete at this stage, pharyngeal extension is driven by
forces other than cell proliferation (Sulston et al., 1983).
We have used a combination of Nomarski differential
interference contrast (DIC) and fluorescence imaging to
study pharyngeal extension. By targeting green fluorescent
protein (GFP) to different subcellular locations, we have
been able to follow the shape and position of individual
pharyngeal and buccal cavity cells in living embryos. Our
data reveal that cell movements such as cell migration or
cell intercalation, which are frequently involved in other
morphogenetic processes, do not appear to play a significant
role here. Rather, pharyngeal extension depends on the
coordinate formation of new epithelia to link cells of the
pharynx with those of the buccal cavity and epidermis.
Once these cells become attached to one another, we
propose that a local contraction provides the force that pulls
these cells together and constricts their apical surfaces.
These behaviors produce the characteristic teardrop morphology of the nascent pharynx at midembryogenesis.
MATERIALS AND METHODS
Nematode Strains and Culture
The JAM-1::GFP strain jcIs1 expresses GFP in adherens junctions and is a marker of epithelialization (Mohler et al., 1998). C.
elegans strains were cultured as described previously (Brenner,
1974). JJ1057 (pop-1(zu189) dpy-5(e61)/hT1 I; him-5(e1490)/hT1 V;
Lin et al., 1995) was used for pop-1 mutant analyses.
Plasmids
For GFP-N, GFP from pPD 103.87 (http://www.ciwemb.edu; Fire
et al., 1990) was fused in-frame with the histone H2B homolog
his-11 to produce pJH4.52 (G. Seydoux, personal communication).
This gene was placed under control of the pha-4 promoter, nucleotides 31–10,967 of cosmid F38A6 (M. Horner and S.E.M., unpublished; Horner et al., 1998). GFP-PM carries GFP from pPD 95.85
(http://www.ciwemb.edu; Fire et al., 1990) with the isoprenylation
sequence of mig-2 (Zipkin et al., 1997) added to the carboxyl
terminus: TCAAGCCACAAAAGAAGAAGAAGTCTTGCAACATCATGTAG (which encodes KPQKKKKSCNIMstop). GFP-PM is
also under control of the pha-4 promoter (M. Horner and S. E. M.,
unpublished; Horner et al., 1998). Both of these constructs were
microinjected into C. elegans (Mello and Fire, 1995) by using the
following injection mix: 20 ng/␮l GFP construct, 100 ng/␮l sheared
herring sperm genomic DNA, 30 ng/␮l 1-kb ladder (Gibco BRL),
and 100 ng/␮l pRF4, which permits identification of transgenic
animals because they roll (Mello et al., 1991). Both constructs were
stably integrated into the genome by using standard protocols
(Mello and Fire, 1995) to generate pxIs6 and pxIs7 for GFP-N and
GFP-PM, respectively.
Microscopy and Laser Ablations
Embryos were collected from gravid adult hermaphrodites into
M9 (Brenner, 1974) and transferred to 4% agar pads on standard
microscope slides. For time-lapse microscopy, we used a Zeiss
Axioskop microscope equipped with Nomarski DIC optics. For
laser ablation, blastomeres were irradiated with the 440-nm laser
beam as described previously (Avery and Horvitz, 1987; Horner et
al., 1998). Blastomeres were treated with laser light for 15–30 s at
2–5 pulses per second until the nuclei could be seen bubbling.
Time-Lapse Microscopy
Time-lapse microscopy was used for lineage analysis of pharyngeal and buccal cavity cells and for following cell movements and
shape changes during pharyngeal morphogenesis. A cooled Princeton Instruments digital camera was used to capture images with
OpenLab software (Improvision). Ten optical sections were taken
per time point; each section was approximately 2 microns offset
from the previous section. Time points for differential interference
microscopy were taken every 30 s and for GFP, every 10 –15 min at
1% power (100 W Attoarc).
Immunostaining
Immunostaining was performed similar to previous reports (Albertson, 1984; Mango et al., 1994). Gravid hermaphrodites were
allowed to lay embryos overnight on 10-cm plates. The mothers
and hatched larvae were then removed by rinsing the plates with
M9. Embryos were harvested by gently scrubbing the plates and
suctioned by using a 1-ml pipette. Embryos were transferred to a
watch glass and allowed to settle. Debris was removed from the
watch glass with a 1-ml pipette without disturbing the embryos.
Embryos were then placed on poly L-lysine coated slides. Coverslips were placed on top of the embryos and excess M9 was wicked
away until the eggshells were cracked open. The slides were placed
on dry ice for 10 min, the coverslips removed rapidly, and the slides
immersed in methanol on dry ice for 5 min. The slides were
transferred to a coplin jar containing acetone on dry ice for an
additional 5 min, and then passed through a rehydration series for
30 s each in 90, 60, 30, and 10% acetone in water. The slides were
rinsed and stored in TNB solution (Mango et al., 1994) for 30 min.
Mouse anti-JAM-1 antibodies (MH27; Francis and Waterston, 1991)
and rabbit anti-GFP antibodies (Clontech) diluted in TNB were
then incubated with the embryos for 2– 4 h at room temperature.
The slides were washed in TBS (20 mM Tris-HCl, pH 8.0, 150 mM
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
484
Portereiko and Mango
FIG. 1. Pharyngeal extension. Embryos before (A, C, E) and after (B, D, F) pharyngeal extension. (A, B) Embryos immunostained with
␣PHA-4 antibodies, to highlight the pharynx (arrowheads; Horner et al., 1998). (C, D) Images of similarly staged embryos by differential
interference contrast (DIC) microscopy. Red arrowheads mark the basement membrane surrounding the pharynx primordium. (E, F)
Embryos immunostained with antibodies directed against the basement membrane collagen LET-2 (red; AT-68; Sibley et al., 1994; Graham
et al., 1997) and an adherens junction protein JAM-1 (green; MH27; Francis and Waterston, 1991). LET-2 is synthesized in body wall muscle
cells (*) and deposited on neighboring basement membranes (arrow points to the LET-2 stain, arrow head points to a gap in staining at the
anterior edge of the primordium, see text for details; Graham et al., 1997). Note that the pharynx, midgut, and rectum all express the
adherens junction marker. Each embryo is ⬃50 ␮m long.
NaCl) (Albertson, 1984) for 15 min before incubation with FITC or
Cy3-conjugated secondary antibodies (Jackson Immunologicals).
Slides were incubated for an additional 2– 4 h at room temperature,
washed in TBS for 15 min, and mounted with 15 ␮l of mounting
medium (1 mg/ml p-phenylenediamine, 50% glycerol, 1.5 mg/ml
sodium citrate, and 6.0 mg/ml sodium phosphate). The edges of the
coverslips were sealed with nail polish and analyzed under the
microscope.
RESULTS
Pharyngeal morphogenesis initiates approximately 330
min after the first embryonic cell division, when 78 of the
80 pharyngeal cells have been born and the embryo has
begun to elongate. At this time, the pharyngeal precursors
form a compact primordium deep within the embryo.
Pharyngeal extension occurs over the next 60 min, when
the pharyngeal precursors alter their morphology and position to form a linear tube linked to the buccal cavity at the
anterior (Figs. 1B, 1D, and 1F).
We used three reporter constructs to follow the behavior
of the pharyngeal precursors during extension (Fig. 2; see
Materials and Methods). The first, GFP-PM, targets GFP to
the plasma membrane using the isoprenylation sequence of
mig-2 (Zipkin et al., 1997). This construct enabled us to
observe the shape of cells during extension. The second,
GFP-N, localizes GFP to the nucleus with a fusion to
his-11, a histone 2B homologue (Seydoux, personal communication; J. Waddle, personal communication). This construct facilitated lineage analysis and cell identification (see
Materials and Methods). Both of these genes are under
control of the pha-4 promoter, which is selectively ex-
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
485
Early Morphogenesis of the C. elegans Pharynx
since these cells appear to play a critical role during
pharyngeal extension (described below). Although these
cells do not differentiate until hours after extension, we
refer to them according to the cell type they eventually
become (e.g., epithelial cell “e1D,” which derives from the
ABaraaaapap blastomere; Sulston et al., 1983).
The Pharyngeal Primordium
FIG. 2. GFP markers. Green fluorescent protein constructs used
in this study: GFP-PM, which is targeted to the plasma membrane
of cells in the digestive tract, is shown here in the pharynx of a
twofold stage embryo (A). Overlay of DIC and fluorescence images
of an early embryo (⬃100 cell stage) expressing the nuclear GFP-N
construct (B) and fluorescence micrograph showing JAM-1::GFP
localized to adherens junctions within the digestive tract (C;
Mohler et al., 1998). Bar ⫽ 5 ␮m; a full-sized embryo is ⬃50 ␮m
long.
pressed in the digestive tract, including all pharyngeal and
buccal cavity cells (Horner et al., 1998). The third construct, JAM-1::GFP (Mohler et al., 1998), targets GFP to
adherens junctions (Francis and Waterston, 1991; Hall, Pers.
Comm.) and was used to locate the apical surface of cells.
These constructs provided a means to follow the different
steps of pharyngeal extension in living, unfixed embryos.
Here, we focus on the behavior of the cells that ultimately form the anterior pharynx and the buccal cavity
Prior to pharyngeal extension, the pharyngeal cells appear
wedge-shaped with their apical surfaces, as defined by
JAM-1::GFP expression, located at the tip of the wedge and
their basolateral compartment extending over the remaining surfaces (Figs. 3A, 3C, and 3E). The cells’ apicobasal
polarity is aligned along the rostrocaudal axis of the embryo
with the apical surface facing posterior and the basal surface
flanking the basement membrane at the anterior. Celllineage analysis with GFP-N demonstrated that these
wedge-shaped cells include the e1 and e2 subclasses of
pharyngeal epithelial cells (for stages and cell names, see
Sulston et al., 1983). Cells located posterior to the pharyngeal epithelial cells are organized with their apicobasal
polarity oriented along the dorsoventral axis of the embryo
and their apical surfaces facing the midline of the pharyngeal primordium (Figs. 3C and 3D); the midline will ultimately become the pharyngeal lumen. This arrangement
implies that the pharyngeal epithelial cells effectively
“cap” the nascent pharyngeal lumen, thereby blocking the
pharyngeal tube from extending to the exterior.
The pharyngeal primordium is surrounded by a basement
membrane that separates the pharyngeal cells from the rest
of the embryo. The basement membrane can be detected by
light microscopy as a gap between the pharyngeal cells and
other cells of the head (Fig. 1C). By antibody staining, the
anterior section of basement membrane differs from the
remainder since it fails to stain for ␣-collagen IV (Fig. 1E).
This may reflect an absence of a basement membrane at the
anterior (or of collagen) or, alternatively, a different organization that masks the antigenic epitopes.
The pharyngeal epithelial cells are located approximately
three cell diameters from the anterior of the embryo
(⬃11.1 ⫾ 0.5 ␮m, n ⫽ 5). This area is filled with cells that
ultimately contribute to the buccal cavity and epidermis
(Figs. 3A and 3B; Figs. 4A and 4B). Anterior to the pharyngeal epithelial cells lie nine arcade cells that become
organized into two rings called the anterior and posterior
arcades. These cells make up the anterior two-thirds of the
buccal cavity; the remainder of the buccal cavity is comprised of pharyngeal epithelial cells (Albertson and Thomson, 1976; Wright and Thomson, 1981). To simplify the
nomenclature, we use the term “buccal cavity” to refer to
the structure made by the arcade cells alone. Anterior to the
arcade cells lie epidermal cells that link the digestive tract
to the epidermis surrounding the embryo.
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
486
Portereiko and Mango
mis of the mouth posteriorly (“Contraction”). These cellular behaviors produce an epithelial tube that links the
digestive tract to the exterior of the animal.
Pharyngeal extension begins when pharyngeal epithelial
cells located in the anterior of the pharyngeal primordium
adjust the apicobasal polarity of their membranes to lie
parallel to the dorsoventral axis of the embryo (Fig. 3). Prior
to the first stage, the apicobasal axes of these cells are
generally aligned with the rostrocaudal axis of the embryo
(Figs. 3A, 3C, and 3E). During reorientation, the epithelial
cells shift their apical surfaces 30 –90° to align their apicobasal axes with the dorsoventral axis (Figs. 3B, 3D, and 3F).
We observed this reorientation using several markers of
apical polarity including JAM-1::GFP, endogenous JAM-1,
and the atypical protein kinase C homologue PKC-3 (Wu et
al., 1998). Thus, polarity of the entire cell is affected during
reorientation rather than relocalization of a single marker.
One interesting possibility is that the whole cell rotates
toward the anterior of the embryo (i.e., clockwise for dorsal
cells and counterclockwise for ventral cells). Alternatively,
cells may reorganize polarity by repositioning their apical
junctions within a stationary membrane. We have not
distinguished between these possibilities and do not favor
one over the other.
We quantified reorientation by comparing the distances
traveled by the apical and basal surfaces of the pharyngeal
epithelial cell e1D. Whereas the apical surface of e1D
moved ⬃2.5 ␮m closer to the future mouth of the embryo,
the basal surface did not change position (Table 1). These
FIG. 3. Stage I reorientation of the pharyngeal epithelial cells. (A,
B) DIC images of the pharyngeal epithelial cells before (A) and after
(B) reorientation. The basement membrane that surrounds the
pharynx primordium is outlined in red. (C, D) The equivalent
region of an embryo expressing GFP-PM to highlight the cells’
plasma membranes. (E, F) Embryos stained for the basement
collagen protein LET-2 (red; Sibley et al., 1994; Graham et al., 1997)
and adherens junction marker JAM-1 (green; Francis and Waterston, 1991). At the beginning of pharyngeal extension (A, C, E), the
pharyngeal epithelial cells are wedge-shaped with their tiny apical
surfaces facing the posterior of the embryo (yellow arrowheads) and
their basolateral surfaces covering the bulk of the cell surface (red
arrowheads). Over the next 15 min (B, D, F), the cellular junctions
appear to rotate so that the apical surfaces are located more
anteriorly and the nascent pharyngeal lumen abuts the basement
membrane. Bar ⫽ 5 ␮m.
Three Stages of Pharyngeal Extension
Pharyngeal extension can be loosely divided into three
stages: (1) reorganization of cellular polarity within the
pharyngeal epithelial cells, (“Reorientation”), (2) formation
of an epithelium by the arcade cells (“Epithelialization”),
and (3) movement of the pharynx anteriorly and the epider-
FIG. 4. Stage II epithelialization of the arcade cells. The arcade
cells (arrows) before (A) and after (B) formation of adherens junctions. Embryos stained for adherens junctions in green (MH27;
Francis and Waterston, 1991) and nuclei in red (DAPI).
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
487
Early Morphogenesis of the C. elegans Pharynx
TABLE 1
Movement of Pharyngeal Epithelial Cell e1D during
Pharyngeal Extension
Distance from
embryo anterior to:
Prerotation
(t ⫽ 0)
Stage I
(t ⫽ 10 min)
Stage III
(t ⫽ 50 min)
e1D Apical Surface a
e1D Basal Surface b
12.7 ⫾ 0.7 ␮m
10.9 ⫾ 0.5 ␮m
10.3 ⫾ 0.1 ␮m
10.9 ⫾ 0.3 ␮m
6.4 ⫾ 0.5 ␮m
8.6 ⫾ 0.4 ␮m
that eventually stretches 4.5 ␮m inward (Figs. 5A–5D). The
intervening arcade cells become progressively more wedgeshaped during contraction, as their apical surfaces shrink
dramatically (Figs. 5G–5J). Ultimately, the anterior tips of
the pharyngeal epithelial cells intercalate between the
arcade cells, thereby bringing the pharyngeal primordium
further forward. These movements are largely complete
within 1 h.
a
The distance from the apical surface of the cell (as determined
by JAM-1::GFP) to the anterior edge of the embryo.
b
The distance from the center of the basal surface of the cell (as
determined by DIC optics) to the anterior edge of the embryo. Note
that after the 50-min time point, the pharyngeal cells continued to
extend anteriorly; however, embryonic movements interfered with
making accurate measurements.
events occur rapidly, within a 10-min time frame beginning
approximately 330 min after the first embryonic cleavage.
Similar movements were observed for neighboring pharyngeal epithelial cells (Fig. 3). The net result of reorientation is
that the apical surface of the pharyngeal primordium, and
essentially the future lumen of the pharynx, is positioned
more anteriorly and abuts the arcade cells. Importantly,
these data demonstrate that this change depends on reorganization of cell polarity and not displacement of cells
toward the anterior.
During the second phase of pharyngeal extension, a
continuous epithelium is formed between the pharyngeal
cells, the arcade cells, and the anterior epidermis (Fig. 4).
Prior to this stage, only the pharynx and epidermis contain
adherens junctions, as assayed by staining for JAM-1 or
JAM-1::GFP. During a 10-min interval, faint puncta of
JAM-1::GFP appear within the arcade cells (data not
shown). The puncta are rapidly converted into a continuous
belt of JAM-1::GFP, which likely reflects polarization of the
arcade cells and adhesion between these cells and the
neighboring pharyngeal and epidermal cells (Fig. 4). The
atypical protein kinase C homologue PKC-3 (Wu et al.,
1998) is localized to the apical surface with similar timing
as JAM-1::GFP (data not shown). We suggest that formation
of a continuous epithelium provides mechanical coupling
between the pharynx, the buccal cavity, and the epidermis.
During the third stage of pharyngeal extension, the pharynx shifts anteriorly and the epidermis moves posteriorly
(Figs. 5A–5D). For example, e1D shifts 2– 4 ␮m towards the
anterior during the first 30 min of Stage III: its apical surface
moves 3.9 ␮m (n ⫽ 8) while its basal surface moves
approximately 2.1 ␮m (n ⫽ 8) (Table 1). These data illustrate that the entire cell moves anteriorly, and also that the
cell elongates along its anteroposterior axis. Pharyngeal
cells neighboring e1D behave similarly, which generates a
row of elongated cell bodies within the anterior pharynx. At
the same time that the pharyngeal cells move forward, the
epidermal cells shift posteriorly. This behavior is most
easily observed as an indentation at the tip of the embryo
A Model for Pharyngeal Extension
We considered two mechanisms to explain the forces that
drive pharyngeal extension. First, the anterior pharyngeal
cells might “pull” the pharynx primordium anteriorly. This
model, which is based on the cellular movements described
above, proposes that, once a continuous epithelium is
generated between cells of the anterior pharynx, buccal
cavity, and epidermis, a local contraction brings the apical
surfaces of these cells close together and pulls the rest of the
pharynx forward. An alternate explanation is that cells
located in the posterior of the pharynx primordium “push”
the anterior pharynx forward to reach the buccal cavity.
This model is based on changes in the shape of the posterior
pharynx primordium during extension. The posterior pharynx elongates 2.3 ⫾ 0.3 ␮m (n ⫽ 5) along its anteroposterior
axis and shrinks 1.7 ⫾ 0.6 ␮m (n ⫽ 6) along its dorsoventral
axis (Table 2; Figs. 1 and 4; data not shown).
To distinguish between the pulling and pushing models,
we blocked posterior pharynx development and followed
the behavior of the anterior pharyngeal cells. Since most of
the posterior pharynx derives from the MS blastomere at
the eight-cell stage (Sulston et al., 1983), we used genetic or
physical approaches to destroy the MS blastomere or its
granddaughters, MSaa and MSpa.
Two lines of evidence demonstrate that MS-derived pharyngeal cells are not required for pharyngeal extension.
First, we used laser ablation to destroy MSaa and MSpa. In
successfully ablated embryos, no posterior pharynx was
seen by light microscopy or with GFP-PM, and only one
subsequent round of cell division occurred in the treated
cells. Despite the loss of the MS-derived pharyngeal cells,
pharyngeal extension occurred normally (Fig. 6B). We observed reorientation of polarity, epithelialization, and contraction, similar to unablated embryos (n ⫽ 4). These
embryos arrested at the twofold stage with pharynges that
resembled the anterior of a normal twofold embryo. As a
second approach, we analyzed pharyngeal extension in
pop-1(zu189) embryos. The HMG protein POP-1 is required
to specify anterior fates, including that of the MS blastomere (Lin et al., 1995, 1998). In mutant pop-1 embryos,
the MS blastomere develops like its posterior sister, the E
blastomere, and produces excess midgut cells instead of
pharyngeal cells (Lin et al., 1995). Nevertheless, the pharyngeal primordium underwent normal extension in these
mutants, ultimately producing the elongated shape of a
normal pharyngeal tube (Fig. 6E). These data demonstrate
that MS-derived pharyngeal cells are not required for pha-
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
488
Portereiko and Mango
TABLE 2
Dimensions of the Posterior Pharynx during
Pharyngeal Extension
Length of A/P axis
Length of D/V axis
Prerotation (t ⫽ 0)
Stage III (t ⫽ 50 min)
11.5 ⫾ 1.6 ␮m
17.3 ⫾ 1.0 ␮m
13.7 ⫾ 1.8 ␮m
15.6 ⫾ 0.9 ␮m
Note. The length of the posterior pharynx was measured along
the anteroposterior axis from the tip of the pm3 pharyngeal muscle
precursors to the posterior tip of the pm8 pharyngeal muscle
precursor. The width of the posterior pharynx was measured along
the dorsoventral axis of the embryo at the position of the pm4 and
pm5 pharyngeal muscle precursors. For the names of individual
pharyngeal cells, see Albertson and Thomson (1976).
ryngeal extension and favor the pulling hypothesis of pharyngeal extension.
The pulling hypothesis predicts that tension between the
pharynx, buccal cavity, and epidermis is used to pull the
entire pharynx forward. To test this idea, we destroyed the
arcade cells by laser ablation and examined the behavior of
the neighboring pharyngeal cells (Fig. 7). As expected, the
arcade cells failed to epithelialize after treatment, indicating that the ablation was successful. We observed reorientation of the pharyngeal epithelial cells, but no movement
of the pharynx primordium toward the mouth (n ⫽ 3).
Moreover, we observed a decrease in the posterior movement of the epidermis and consequently a smaller indentation in treated embryos. These data are consistent with the
idea that epithelial connections between the pharynx, buccal cavity, and epidermis are required to generate the force
that pulls the pharynx forward and the buccal cavity backward.
DISCUSSION
FIG. 5. Stage III contraction of the buccal cavity and the pharyngeal
epithelial cells. (A–D) DIC images showing the pharyngeal epithelial
cells (yellow arrows) and epidermal cells (red arrow) during Stage III
contraction. Note that the epidermal cells move posteriorly while the
pharyngeal epithelial cells shift anteriorly and become elongated. (E,
F) Pharyngeal epithelial cell e1D in a GFP-PM-expressing embryo
before (E) and after (F) Stage III contraction. The apical surface is
marked with yellow arrowheads and the basolateral surfaces are red.
(G–I) Before (G, I) and after (H, J) Stage III contraction. The length of
the apical surfaces of the arcade cells is reduced during contraction
(brackets in G and H), as measured by MH27 staining (green; Francis
et al., 1991). Individual arcade cells are highlighted by arrows in I and
J. Concomitant with these events, the sister of e1D, ABaraaaapaa, dies
and its corpse slips between the arcade cells and disappears (Sulston et
al., 1983; M. P. and S. E. M., unpublished observations). The pharyngeal epithelial cells appear to follow the corpse between the arcade
cells (data not shown). Bar ⫽ 5 ␮m.
We have described the cellular behaviors that accompany
the early stages of pharyngeal morphogenesis. Our studies
demonstrate that conversion of the pharynx from a ball to a
tube depends on generating an epithelium that links anterior pharyngeal cells to the buccal cavity and surrounding
epidermis. Formation of an epithelium during Stages I and II
probably provides the mechanical strength to pull the
pharynx forward during Stage III. We hypothesize that the
force to pull the pharynx forward is produced by a local
contraction between the pharyngeal epithelial cells, the
buccal cavity, and the epidermis (see model, Fig. 8). These
behaviors are strikingly different from those involved in
other morphogenetic processes such as cell migration or
convergent extension during vertebrate gastrulation and
neurulation. Rather, the behaviors we observe resemble
aspects of kidney tubulogenesis, suggesting that an understanding of pharyngeal extension may help us understand
morphogenesis of other, more complex, organs.
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
489
Early Morphogenesis of the C. elegans Pharynx
FIG. 6. MS-derived pharyngeal cells are not required for pharyngeal extension. (A–C) The pharynx primordium before (A) and after (B, C)
pharyngeal extension in an embryo in which the MSaa and MSpa blastomeres were destroyed by laser ablation. The outline of the pharynx is
highlighted by red arrowheads. A band of the adherens junction marker MH27 suggests that the epidermis, buccal cavity, and pharynx form a
continuous epithelium despite the absence of the posterior pharynx (C). The same embryo is shown in A and B. A black arrow denotes the ablated
blastomeres in A. (D–F) A pop-1 embryo before (D) and after (E, F) pharyngeal extension. Pharyngeal extension appears to occur despite the absence
of the posterior pharynx. (F) MH27 staining (Francis and Waterston, 1991) indicates the presence of a continuous epithelium.
Pharyngeal Extension in C. elegans
Stage I: Reorientation. During the first stage of pharyngeal extension, pharyngeal epithelial cells reorient their
apicobasal polarity from rostrocaudal to dorsoventral relative to the embryonic axes. This rearrangement alters the
morphology of the pharynx from a cyst, with the apical
surfaces located internally, to a short tube that extends
from the midgut to the anterior edge of the pharyngeal
primordium. Importantly, this movement aligns the pharyngeal epithelial cells with the arcade cells, enabling a
continuous epithelium to form during Stage II. At present,
two models can explain how reorientation might occur.
First, reorientation might reflect rotation of the entire cell.
For example, the basement membrane could provide a
substratum that would promote cell turning in a clockwise
or counterclockwise direction. In the second model, junctions within a stationary cell might be relocated to the
anterior. That is, disassembly/reassembly or sliding of junctional components could physically move the apical compartment forward. Evidence for both kinds of events exist in
other organisms. For example, dissociated sea urchin cells
form cysts in vitro with their apical membranes located
internally. They achieve this configuration by rotating
individual cells within an aggregate of randomly oriented
cells (Nelson and McClay, 1988). On the other hand,
Madin–Darby canine kidney (MDCK) cells depolarize their
membranes during tubulogenesis in vitro and gradually
FIG. 7. Pharyngeal extension depends on the arcade cells. Pharyngeal epithelial cells before (A, B) and after (C, D) pharyngeal extension.
The arcade cells were destroyed by laser ablation, as monitored by the
appearance of debris (orange arrows in A) and the absence of adherens
junctions (B, D). The apical surface of the pharyngeal epithelial cell
e1D rotated anteriorly (yellow arrowheads in A and C), but no cell
elongation or forward movement were observed. Red arrowheads
depict the basolateral surface of e1D in A and C.
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
490
Portereiko and Mango
FIG. 8. Summary of pharyngeal extension. Prior to pharyngeal
extension, the pharyngeal primordium forms an epithelialized cyst
deep within the embryo (A). The pharyngeal primordium and arcade
cells appear to be separated by a basement membrane at this time
(dotted line). During Stage I “Reorientation” (A to B), anterior pharyngeal cells reorient their apicobasal polarity to “uncap” the cyst and
form a tube. During stage II “Epithelialization” (B to C), the arcade
cells epithelialize and produce a continuous epithelium that is linked
to the epidermis anteriorly (not shown) and the pharynx posteriorly.
Finally, during stage III “Contraction” (D), the apical surfaces of the
arcade and anterior pharyngeal cells constrict as these cells are
brought in close apposition to each other. This constriction apparently pulls the pharynx toward the anterior of the animal.
rebuild their junctions within stationary cells to generate
tubes with appropriate polarity (Pollack et al., 1998). Similarly, adherens junctions in C. elegans epidermal cells are
regulated dynamically during cell migration and fusion
(Podbilewicz and White, 1994; Williams-Masson et al.,
1998; Chin-Sang and Chisholm, 2000).
In addition to the polarity changes observed during Stage
I, cells located at the anterior tip of the pharyngeal primordium presumably lose cell contacts with some of their
neighbors. This alteration is required to remove the physical barrier that these cells impose between the nascent
pharyngeal lumen and the developing buccal cavity. The
mechanisms that underlie this behavior are currently unknown, but could involve differential adhesiveness between cells. For example, both pharyngeal cells and arcade
cells express members of the cadherin family of adhesion
molecules, suggesting these proteins could play a role in
adhesion-mediated rotation (Pettitt et al., 1996; Costa et al.,
1998; M.P. and S.E.M., unpublished observations). In C.
elegans epidermal cells, a cadherin/catenin system maintains the association of actin filaments with adherens
junctions, which is important for proper body morphogenesis (Costa et al., 1998; Raich et al., 1999). Surprisingly,
however, embryos mutant for components of the cadherin/
catenin system appear virtually unaffected in cell adhesion,
apicobasal polarity, adherens junction formation, or pharyngeal extension (Pettitt et al., 1996; Costa et al., 1998;
M. P. and S. E. M., unpublished observations). One possibility is that overlapping expression of different cadherin/
catenin family members compensates for the loss of a single
protein. The cadherin family is large in C. elegans, with 4
catenin homologues and 15 genes containing cadherin-type
repeats.
Stage II: Epithelialization. During the second stage of
pharyngeal extension, the buccal cavity forms adherens
junctions that connect the buccal cavity to the pharynx and
epidermis. As a consequence, the epidermis and digestive
tract form a continuous epithelium that topologically resembles a cored apple, with the epidermis defining the
surface of the apple and the digestive tract making up the
core. This structure is under tension, such that disruption
of the epithelium in one area releases tension throughout
the embryo, including regions of the embryo that are
distant from the initial lesion (M.P. and S.E.M., unpublished observations). This behavior may explain why mutants that disrupt embryonic elongation also affect pharyngeal morphogenesis (S.E.M., unpublished observations).
What factors are required to build the digestive tract
epithelium? Surprisingly, many proteins implicated in the
formation or maintenance of epithelia in other animals are
apparently not required in the C. elegans digestive tract. For
example, homologues of Crumbs, cadherins, discs-large,
zo-1, ␣ or ␤ integrins do not give rise to obvious pharyngeal
defects after being inactivated (Williams and Waterston,
1994; Pettitt et al., 1996; Baum and Garriga, 1997; Costa et
al., 1998; M.P. and S.E.M., unpublished observations; G.
Herman and J. R. Priess, personal communication.; see
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
491
Early Morphogenesis of the C. elegans Pharynx
Drubin and Nelson, 1996 and Yeaman et al., 1999 for
reviews on epithelial polarity). There are three potential
caveats associated with these inactivation experiments:
genetic redundancy, maternal rescue, and incomplete lossof-function. Nevertheless, the list of genes is surprisingly
long and suggests that novel protein families may play a
role in pharyngeal extension.
A few loci that regulate epithelial cell fate or function
have been tentatively identified by screening chromosomal
deficiencies for those that affect the embryonic epidermis
(Chanal and Labouesse, 1997; Labouesse, 1997; Terns et al.,
1997). This approach led to the recent discovery of let-413,
which is deleted by sDf35 and is critical for proper adherens
junction formation or positioning. LET-413, which contains
a PDZ motif and leucine-rich repeats similar to Drosophila
scribble, is localized to basolateral membranes of all epithelial cell types, including the pharynx, where it plays a role
in organizing cell polarity (Legouis et al., 2000). Other
molecules required to specify pharyngeal epithelial cells or
build their epithelial junctions have not yet been found.
Stage III: Contraction. During the third stage of pharyngeal extension, cells of the pharynx, buccal cavity, and
epidermis appear to undergo a local contraction that pulls
them tightly together. The remainder of the pharynx is
presumably dragged forward by virtue of its attachment to
the anterior pharynx. This hypothesis is based on the
observation that the pharynx, buccal cavity, and epidermis
form a continuous epithelium that appears to be under
tension during pharyngeal extension. During Stage III,
movement of the pharynx forward is matched by movement of the epidermis backward. These behaviors depend
on the arcade cells since ablation of the arcade cells disrupts
movement in either direction. Interestingly, when we ablate the midgut or posterior pharynx, the pharynx shifts
even more anteriorly, the pharyngeal epithelial cell bodies
fail to elongate extensively, and posterior movement of the
epidermis is aborted (Fig. 6). These behaviors can be explained if, normally, cells of the pharynx, buccal cavity, and
mouth undergo a contraction that is resisted by tension
from the entire digestive– epidermal epithelium.
The Stage III contraction may occur by a “purse-string”
mechanism, similar to what has been proposed for other
morphogenetic events. The purse-string model has been
implicated in sealing epithelial sheets during wound healing, dorsal closure in Drosophila, and ventral closure in C.
elegans (Knust, 1997; Nodder and Martin, 1997; WilliamsMasson et al., 1997). This model proposes that cells at the
leading edge of a gap in an epithelium are linked to one
another by a circumferential ring of actin and myosin. The
actin/myosin cable is tethered to adherens junctions by
cadherin/catenin complexes, which maintain the actin/
myosin cables in register from cell to cell (Gumbiner, 1996).
As the cable contracts, the cells are pulled together until
the gap is sealed. By analogy, the epithelial connections
between the C. elegans pharynx, buccal cavity, and epidermis may enable these cells to form an apically localized
actin/myosin bundle that pulls these cells close together.
Consistent with this idea, stains with fluorescently labeled
phalloidin have shown that the apical surfaces of the
pharynx, buccal cavity, and epidermis are highly enriched
with actin (M. P. and S.E.M., unpublished observations). We
note, however, that the behavior of the cells during pharyngeal extension differs from a traditional purse-string in that
the contraction appears to be localized to a small region of
the entire epithelium and does not encompass a hole in the
epithelium. In addition, movement proceeds more slowly
than do other characterized purse-string closures. Whereas
ventral closure in C. elegans occurs at a rate of ⬃1.0
␮m/min (Williams-Masson et al., 1997), pharyngeal cells
move at a rate of ⬃0.3 ␮m/min (M. P. and S.E.M., unpublished observations).
Is Signaling Involved in Pharyngeal Extension?
In other organisms, changes in cell polarity can be induced by extrinsic sources such as cell–substratum attachment and cell– cell adhesion or signaling (Hogan, 1999;
Yeaman et al., 1999). The behavior of the arcade and
pharyngeal epithelial cells raises the interesting possibility
that signaling might coordinate the morphogenetic events
of pharyngeal extension. For example, the arcade cells
might induce reorientation of pharyngeal epithelial cells or
pharyngeal epithelial cells might induce epithelialization of
arcade cells. The timing of these events is consistent with
communication between these groups of cells. For example,
epithelialization of the arcade cells initiates immediately
after reorientation of the pharyngeal epithelial cells. Our
laser ablation studies do not support this hypothesis, however, since we have not seen the predicted phenotypes after
treatment (Fig. 7, and data not shown). For example, laser
ablation of the pharyngeal epithelial cell precursor
ABaraaaa at the 4E stage of embryogenesis does not block
epithelialization of the arcade cells (M.P. and S.E.M., unpublished observations). These experiments are not definitive, however, as it is difficult to be certain that all arcade
cells or all pharyngeal epithelial cells have been destroyed,
given their small size and internal location in the embryo.
If a single cell remained after laser ablation, it might be
sufficient to send a signal.
Many molecules have been identified that play a role in
signaling during organogenesis and tubulogenesis. For example, ligands of the wnt (Kuure et al., 2000) and IL-6
(Barasch et al., 1999) family probably mediate ureteric bud
signaling to the mesenchyme. Interestingly, wnt signaling
has also been implicated in early and late stages of pharyngeal development (Bowerman, 1998; A. Paulson and S.E.M.,
unpublished observations). FGF has also been implicated in
organ morphogenesis including Drosophila trachea and the
mammalian lung (Metzger and Krasnow, 1999). In C. elegans, a member of the FGF family, egl-17(Burdine et al.,
1997), is expressed in anterior epidermal cells at the onset of
pharyngeal extension (M.P. and S.E.M., unpublished observations). However, we have not observed defects in pharyngeal extension after inactivation of egl-17 alone or in
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
492
Portereiko and Mango
combination with let-756 (Roubin et al., 1999); the only
other known FGF homologue in C. elegans (M.P. and
S.E.M., unpublished observations). Further genetic studies
are needed to address the potential role of signaling during
pharyngeal extension.
Pharyngeal Extension Resembles Kidney
Morphogenesis
The cellular behaviors described here resemble aspects of
tubulogenesis in other organisms, notably the metanephric
kidney. Development of the kidney depends on a series of
reciprocal interactions between the ureteric bud and the
surrounding mesenchyme (Saxen and Sariola, 1987; Kuure
et al., 2000). Organogenesis is initiated by signals in the
mesenchyme that induce formation of the ureteric bud, an
epithelial outgrowth from the Wolffian duct. In response,
the ureteric bud branches into the ureter tree and induces
the mesenchyme to condense, epithelialize, and develop
nephrons. Ultimately, the ureteric and mesenchymal epithelia fuse to form the collecting tubules of the kidney.
Pharyngeal extension in C. elegans resembles kidney
organogenesis in three ways. First, cells epithelialize in
both organs to form tubes de novo. In worms, the arcade
cells generate an epithelium that eventually gives rise to
the buccal cavity, whereas metanephric mesenchyme in the
kidney epithelializes to form nephrons. This process contrasts with other mechanisms for generating tubes such as
budding or invagination, both of which build new structures from preexisting epithelia. For example, during
branching morphogenesis in Drosophila trachea and mammalian lungs, cells bud from an epithelial sheet or tube, and
migrate to new locations that establish the branches of the
pulmonary tree (Metzger and Krasnow, 1999).
The second similarity between pharyngeal extension and
kidney morphogenesis is that the tubes are composed of
newly formed as well as preexisting epithelia that fuse into
a continuous structure. In nematodes, the anterior digestive
tract is produced from the pharyngeal primordium, which
forms an epithelium before the onset of morphogenesis, and
the newly formed buccal cavity epithelium. In the kidney,
the ureteric bud epithelium fuses with mesenchymally
produced S-shaped bodies to form the collecting tubules.
These behaviors require that new and preformed epithelia
align with one another, with their apicobasal polarity in
register. How this occurs during pharyngeal extension is
presently unknown, but could involve cell signaling, by
analogy with other systems. For example, during kidney
development in mammals or gonad formation in C. elegans,
reciprocal signaling between cells allows them to coordinate the formation of extended epithelia (Newman and
Sternberg, 1996; Chang et al., 1999; Kuure et al., 2000).
The third similarity between pharyngeal extension and
kidney morphogenesis is that both organs apparently rearrange apicobasal polarity within epithelial cells as they
establish new tubular structures. In C. elegans, the pharyngeal epithelial cells relocalize their apical surfaces to extend
the nascent pharyngeal lumen towards the anterior, where
they connect to the arcade cells. The cellular events associated with kidney morphogenesis, which have been studied in tissue culture models but not yet in vivo, suggest that
apicobasal polarity is lost transiently during tubulogenesis.
When MDCK cells are induced to form kidney tubules in
vitro, apicobasal polarity is initially disrupted during budding of the nascent tube and only becomes reestablished
during the final stages of tube formation (Pollack et al.,
1998). One important difference between the two processes,
however, is that the pharyngeal epithelia apparently maintain polarity even while they change the location of their
apical surfaces, whereas apical membrane polarity is lost
transiently in MDCK cells (Pollack et al., 1998).
In summary, we have shown that formation of the
anterior digestive tract depends on forming epithelia de
novo, which links the pharyngeal and arcade cells. A more
detailed knowledge of pharyngeal extension will depend on
identifying the molecules involved and understanding how
they function.
ACKNOWLEDGMENTS
We thank G. Hermann, J. Priess, and J. White for unpublished
information; A. Fire, J. Hardin, G. Seydoux, and J. Waddle for
reagents; M. Horner for the GFP constructs; B. Bamber, M. Beckerle, J. Priess, and members of the Mango lab for comments on the
manuscript. Funding to M.F.P. was provided by the National
Institutes of Health Genetics Training Grant (T32-GM07464) and
to S.E.M. by the National Institutes of Health (1-01-GM56264-01).
S.E.M. is an assistant investigator of the Huntsman Cancer Institute Center for Children.
REFERENCES
Albertson, D. G. (1984). Formation of the first cleavage spindle in
nematode embryos. Dev. Biol. 101, 61–72.
Albertson, D. G., and Thomson, J. N. (1976). The pharynx of
Caenorhabditis elegans. Philos. Trans. R. Soc. London B Biol.
Sci. 275, 299 –325.
Avery, L., and Horvitz, H. R. (1987). A cell that dies during
wild-type C. elegans development can function as a neuron in a
ced-3 mutant. Cell 51, 1071–1078.
Avery, L., and Thomas, J. H. (1997). Feeding and defecation. In “C.
elegans II” (D. L. Riddle, T. Blumenthal, B. J. Meyer, and J. R.
Priess, Eds.), pp. 679 –716. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, NY.
Barasch, J., Yang, J., Ware, C. B., Taga, T., Yoshida, K., ErdjumentBromage, H., Tempst, P., Parravicini, E., Malach, S., Aranoff, T.,
and Oliver, J. A. (1999). Mesenchymal to epithelial conversion in
rat metanephros is induced by LIF. Cell 99, 377–386.
Baum, P. D., and Garriga, G. (1997). Neuronal migrations and axon
fasciculation are disrupted in ina-1 integrin mutants. Neuron 19,
51– 62.
Bowerman, B. A. (1998). Maternal control of pattern formation in
early Caenorhabditis elegans embryos. Curr. Top. Dev. Biol. 39,
73–117.
Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71–94.
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
493
Early Morphogenesis of the C. elegans Pharynx
Burdine, R. D., Chen, E. B., Kwok, S. F., and Stern, M. J. (1997).
egl-17 encodes an invertebrate fibroblast growth factor family
member required specifically for sex myoblast migration in
Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 94, 2433–
2437.
Chanal, P., and Labouesse, M. (1997). A screen for genetic loci
required for hypodermal cell and glial-like cell development
during Caenorhabditis elegans embryogenesis. Genetics 146,
207–226.
Chang, C., Newman, A. P., and Sternberg, P. W. (1999). Reciprocal
EGF signaling back to the uterus from the induced C. elegans
vulva coordinates morphogenesis of epithelia. Curr. Biol. 9,
237–246.
Chen, E. B., and Stern, M. J. (1998). Understanding cell migration
guidance: Lessons from sex myoblast migration in C. elegans.
Trends Genet. 14, 322–327.
Chin-Sang, I. D., and Chisholm, A. D. (2000). Form of the worm:
Genetics of epidermal morphogenesis in C. elegans. Trends
Genet. 16, 544 –551.
Costa, M., Raich, W., Agbunag, C., Leung, B., Hardin, J., and Priess,
J. R. (1998). A putative catenin-cadherin system mediates morphogenesis of the Caenorhabditis elegans embryo. J. Cell Biol.
141, 297–308.
Fire, A., Harrison, S. W., and Dixon, D. (1990). A modular set of
lac-Z fusion vectors for studying gene expression in C. elegans.
Gene 93, 189 –198.
Francis, R., and Waterston, R. H. (1991). Muscle cell attachment in
Caenorhabditis elegans. J. Cell Biol. 114, 465– 479.
George, S. E., Simokat, K., Hardin, J., and Chisholm, A. D. (1998).
The VAB-1 Eph receptor tyrosine kinase functions in neural and
epithelial morphogenesis in C. elegans. Cell 92, 633– 643.
Graham, P. L., Johnson, J. J., Wang, S., Sibley, M. H., Gupta, M. C.,
and Kramer, J. M. (1997). Type IV collagen is detectable in most,
but not all, basement membranes of Caenorhabditis elegans and
assembles on tissues that do not express it. J. Cell Biol. 137,
1171–1183.
Gumbiner, B. M. (1996). Cell adhesion: The molecular basis of
tissue architecture and morphogenesis. Cell 84, 345–357.
Hogan, B. L. (1999). Morphogenesis. Cell 96, 225–233.
Horner, M. A., Quintin, S., Domeier, M. E., Kimble, J., Labouesse,
M., and Mango, S. E. (1998). pha-4, an HNF-3 homologue,
specifies pharyngeal organ identity in Caenorhabditis elegans.
Genes Dev. 12, 1947–1952.
Knust, E. (1997). Drosophila morphogenesis: Movements behind
the edge. Curr. Biol. 7, R558 —R561.
Kuure, S., Vuolteenaho, R., and Vainio, S. (2000). Kidney morphogenesis: Cellular and molecular regulation. Mech. Dev. 92,
31– 45.
Labouesse, M. (1997). Deficiency screen based on the monoclonal
antibody MH27 to identify genetic loci required for morphogenesis of the Caenorhabditis elegans embryo. Dev. Dyn. 210,
19 –32.
Labouesse, M., and Mango, S. E. (1999). Patterning the C. elegans
embryo: Moving beyond the cell lineage. Trends Genet. 15,
307–313.
Legouis, R., Gansmuller, A., Sookhareea, S., Bosher, J. M., Baillie,
D. L., and Labouesse, M. (2000). LET-413 is a basolateral protein
required for the assembly of adherens junctions in Caenorhabditis elegans. Nat. Cell Biol. 2, 415– 422.
Leung, B., Hermann, G. J., and Priess, J. R. (1999). Organogenesis of
the Caenorhabditis elegans intestine. Dev. Biol. 216, 114 –134.
Lin, R., Hill, R. J., and Priess, J. R. (1998). POP-1 and anteriorposterior fate decisions in C. elegans embryos. Cell 92, 229 –239.
Lin, R., Thompson, S., and Priess, J. R. (1995). pop-1 encodes an
HMG box protein required for the specification of a mesoderm
precursor in early C. elegans embryos. Cell 83, 599 – 609.
Mango, S. E., Lambie, E. J., and Kimble, J. (1994). The pha-4 gene is
required to generate the pharyngeal primordium of Caenorhabditis elegans. Development 120, 3019 –3031.
Mello, C. C., Kramer, J. M., Stinchcomb, D., and Ambros, V. (1991).
Efficient gene transfer in C. elegans: Extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10,
3959 –3970.
Mello, C. C., and Fire, A. (1995). DNA transformation. In “Caenorhabditis elegans: Modern biological analysis of an organism”
(H. F. Epstein and D. C. Shakes, Eds.), pp. 452– 482. Academic
Press, San Diego.
Metzger, R. J., and Krasnow, M. A. (1999). Genetic control of
branching morphogenesis. Science 284, 1635–1639.
Mohler, W. A., Simske, J. S., Williams-Masson, E. M., Hardin, J. D.,
and White, J. G. (1998). Dynamics and ultrastructure of developmental cell fusions in the Caenorhabditis elegans hypodermis.
Curr. Biol. 8, 1087–1090.
Nelson, S. H., and McClay, D. R. (1988). Cell polarity in sea urchin
embryos: Reorientation of cells occurs quickly in aggregates.
Dev. Biol. 127, 235–247.
Newman, A. P., and Sternberg, P. W. (1996). Coordinated morphogenesis of epithelia during development of the Caenorhabditis
elegans uterine-vulval connection. Proc. Natl. Acad. Sci. USA
93, 9329 –9333.
Nodder, S., and Martin, P. (1997). Wound healing in embryos: A
review. Anat. Embryol. 195, 215–228.
Pettitt, J., Wood, W. B., and Plasterk, R. H. (1996). cdh-3, a gene
encoding a member of the cadherin superfamily, functions in
epithelial cell morphogenesis in Caenorhabditis elegans. Development 122, 4149 – 4157.
Podbilewicz, B., and White, J. G. (1994). Cell fusions in the
developing epithelia of C. elegans. Dev. Biol. 161, 408 – 424.
Pollack, A. L., Runyan, R. B., and Mostov, K. E. (1998). Morphogenetic mechanisms of epithelial tubulogenesis: MDCK cell polarity is transiently rearranged without loss of cell– cell contact
during scatter factor/hepatocyte growth factor-induced tubulogenesis. Dev. Biol. 204, 64 –79.
Priess, J. R., and Hirsh, D. I. (1986). Caenorhabditis elegans
morphogenesis: The role of the cytoskeleton in elongation of the
embryo. Dev. Biol. 117, 156 –173.
Raich, W. B., Agbunag, C., and Hardin, J. (1999). Rapid epithelialsheet sealing in the Caenorhabditis elegans embryo requires
cadherin-dependent filopodial priming. Curr. Biol. 9, 1139 –1146.
Roubin, R., Naert, K., Popovici, C., Vatcher, G., Coulier, F.,
Thierry-Mieg, J., Pontarotti, P., Birnbaum, D., Baillie, D., and
Thierry-Mieg, D. (1999). let-756, a C. elegans fgf essential for
worm development. Oncogene 18, 6741– 6747.
Roy, P. J., Zheng, H., Warren, C. E., and Culotti, J. G. (2000).
mab-20 encodes Semaphorin-2a and is required to prevent ectopic cell contacts during epidermal morphogenesis in Caenorhabditis elegans. Development 127, 755–767.
Saxen, L., and Sariola, H. (1987). Early organogenesis of the kidney.
Pediatr. Nephrol. 1, 385–392.
Schnabel, R., and Priess, J. (1997). Specification of cell fates in the
early embryo. In “C. elegans II” (D. L. Riddle, T. Blumenthal, B. J.
Meyer, and J. R. Priess, Eds.), pp. 361–382. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
494
Portereiko and Mango
Sibley, M. H., Graham, P. L., von Mende, N., and Kramer, J. M.
(1994). Mutations in the ␣2(IV) basement membrane collagen
gene of Caenorhabditis elegans produce phenotypes of differing
severities. EMBO J. 13, 3278 –3285.
Simske, J. S., and Hardin, J. (2001). Getting into shape: Epidermal
morphogenesis in Caenorhabditis elegans embryos. BioEssays.
23, 12–23.
Sulston, J. E., Schierenberg, E., White, J. G., and Thomson, J. N.
(1983). The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev. Biol. 100, 64 –119.
Terns, R. M., Kroll-Conner, P., Zhu, J., Chung, S., and Rothman,
J. H. (1997). A deficiency screen for zygotic loci required for
establishment and patterning of the epidermis in Caenorhabditis
elegans. Genetics 146, 185–206.
White, J. (1988). The anatomy. In “The Nematode Caenorhabditis
elegans ” (W. B. Wood, Ed.), pp. 81–122. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
Williams, B. D., and Waterston, R. H. (1994). Genes critical for
muscle development and function in Caenorhabditis elegans
identified through lethal mutations. J. Cell Biol. 124, 475– 490.
Williams-Masson, E. M., Heid, P. J., Lavin, C. A., and Hardin, J.
(1998). The cellular mechanism of epithelial rearrangement
during morphogenesis of the Caenorhabditis elegans dorsal hypodermis. Dev. Biol. 204, 263–276.
Williams-Masson, E. M., Malik, A. N., and Hardin, J. (1997). An
actin-mediated two-step mechanism is required for ventral enclosure of the C. elegans hypodermis. Development 124, 2889 –
2901.
Wright, K. A., and Thomson, J. N. (1981). The buccal capsule of
Caenorhabditis elegans (Nematoda: Rhabditoidea): An ultrastructural study. Can. J. Zool. 59, 1952–1961.
Wu, S. L., Staudinger, J., Olson, E. N., and Rubin, C. S. (1998).
Structure, expression, and properties of an atypical protein kinase C (PKC3) from Caenorhabditis elegans. PKC3 is required
for the normal progression of embryogenesis and viability of the
organism. J. Biol. Chem. 273, 1130 –1143.
Yeaman, C., Grindstaff, K. K., and Nelson, W. J. (1999). New
perspectives on mechanisms involved in generating epithelial
cell polarity. Physiol. Rev. 79, 73–98.
Zipkin, I. D., Kindt, R. M., and Kenyon, C. J. (1997). Role of a new
Rho family member in cell migration and axon guidance in C.
elegans. Cell 90, 883– 894.
Submitted for publication January 3,
Revised February 15,
Accepted February 16,
Published online April 16,
Copyright © 2001 by Academic Press. All rights of reproduction in any form reserved.
2001
2001
2001
2001