![Rapid Reversion from Monomer to Dimer](http://s1.studyres.com/store/data/017014418_1-2d84bc02454b5f4f8decb205210e1744-300x300.png)
Rapid Reversion from Monomer to Dimer
... degradation by the proteasome, on the amount of UVR8 following UV-B exposure. Since several previous studies employed quite long preincubations with MG132 to see inhibition of the proteasome (Jang et al., 2005; Yang et al., 2005; Dong et al., 2006), plants were transferred to liquid medium containin ...
... degradation by the proteasome, on the amount of UVR8 following UV-B exposure. Since several previous studies employed quite long preincubations with MG132 to see inhibition of the proteasome (Jang et al., 2005; Yang et al., 2005; Dong et al., 2006), plants were transferred to liquid medium containin ...
The Plant Cell - Semantic Scholar
... show any phenotype similar to that of var mutants. To study this possibility, we obtained transgenic lines in which T-DNA was inserted into FtsH1, FtsH6, or FtsH8 (the mutants were designated ftsh1, ftsh6, and ftsh8, respectively). The precise positions of the T-DNA insertion were determined by PCR ...
... show any phenotype similar to that of var mutants. To study this possibility, we obtained transgenic lines in which T-DNA was inserted into FtsH1, FtsH6, or FtsH8 (the mutants were designated ftsh1, ftsh6, and ftsh8, respectively). The precise positions of the T-DNA insertion were determined by PCR ...
Functional characterization of polypeptide release factor 1b in the
... characteristics of eRF1a/eRF1b from the classic hypothesis of ‘anticodon-mimicry’ proposed by Muramatsu et al. [Muramatsu, Heckmann, Kitanaka and Kuchino (2001) FEBS Lett. 488, 105–109]. Mutagenesis experiments indicated that the absolutely conserved amino acid motif ‘G31 T32 ’ (numbered as for huma ...
... characteristics of eRF1a/eRF1b from the classic hypothesis of ‘anticodon-mimicry’ proposed by Muramatsu et al. [Muramatsu, Heckmann, Kitanaka and Kuchino (2001) FEBS Lett. 488, 105–109]. Mutagenesis experiments indicated that the absolutely conserved amino acid motif ‘G31 T32 ’ (numbered as for huma ...
A Role for A-to-I RNA Editing in Temperature Adaptation
... fact, heat-tolerant enzymes produced by directed evolution have lost multiple glycines (8, 46). Furthermore, a multi-gene comparison between a thermophilic deep-sea vent worm and a mesophilic relative revealed that glycines were lost in the thermophile (26). The same study showed a preference for ly ...
... fact, heat-tolerant enzymes produced by directed evolution have lost multiple glycines (8, 46). Furthermore, a multi-gene comparison between a thermophilic deep-sea vent worm and a mesophilic relative revealed that glycines were lost in the thermophile (26). The same study showed a preference for ly ...
Salmonella pathogenicity island 1 (SPI-1) type III
... has been an area of controversy for many years. There is still no consensus sequence that describes a universal type III secretion (T3S) signal. An N-terminal secretion signal (NSS) may involve either a signal peptide or, as seen in Yersinia spp., an mRNA signal sequence (Anderson et al., 1999; Ande ...
... has been an area of controversy for many years. There is still no consensus sequence that describes a universal type III secretion (T3S) signal. An N-terminal secretion signal (NSS) may involve either a signal peptide or, as seen in Yersinia spp., an mRNA signal sequence (Anderson et al., 1999; Ande ...
Functional Characterisation of Plant
... chromatophores (plastids) in the plant kingdom” [4]. Bacterial origin of mitochondria Over the course of evolution, endosymbionts have transformed into highly specialised compartments of eukaryotic cells. Mitochondria are often referred to as semi-autonomous organelles due to the fact that even thou ...
... chromatophores (plastids) in the plant kingdom” [4]. Bacterial origin of mitochondria Over the course of evolution, endosymbionts have transformed into highly specialised compartments of eukaryotic cells. Mitochondria are often referred to as semi-autonomous organelles due to the fact that even thou ...
An immunoassay for atrazine using tunable immunosorbent Jae-Young Kim, Ashok Mulchandani,
... [7,8], and traces have been found in water supplies, fruits, vegetables, meat, and dairy products. Because of its toxicity, the US EPA has set the maximum contaminant level at 3 parts per billion (ppb). Sensitive, selective, rapid, and reliable detection and determination of atrazine is necessary fo ...
... [7,8], and traces have been found in water supplies, fruits, vegetables, meat, and dairy products. Because of its toxicity, the US EPA has set the maximum contaminant level at 3 parts per billion (ppb). Sensitive, selective, rapid, and reliable detection and determination of atrazine is necessary fo ...
A Molecular Switch for Targeting between Endoplasmic Reticulum
... DAKAP1 (also known as AKAP1, S-AKAP84, and AKAP121) is one of the few dual specificity AKAPs that were identified through interaction with RI␣ for binding to both RI and RII (9). A unique feature of this protein is that it can bind both PKA-I and PKA-II. In addition to binding to PKA, DAKAP1 binds P ...
... DAKAP1 (also known as AKAP1, S-AKAP84, and AKAP121) is one of the few dual specificity AKAPs that were identified through interaction with RI␣ for binding to both RI and RII (9). A unique feature of this protein is that it can bind both PKA-I and PKA-II. In addition to binding to PKA, DAKAP1 binds P ...
Etude in vitro de la stéatose hépatique induite par la - HAL
... characterizing the viral genome and proteins, using heterologous expression systems. In sharp contrast, little is known about the life cycle of HCV because, until recently, no system supporting HCV replication and particle formation in vitro was available. Viruses are obligate intracellular parasite ...
... characterizing the viral genome and proteins, using heterologous expression systems. In sharp contrast, little is known about the life cycle of HCV because, until recently, no system supporting HCV replication and particle formation in vitro was available. Viruses are obligate intracellular parasite ...
Structural studies on lysosomal proteins
... which is beneficial for the hydrolytic processes. In addition, since transport of molecules to lysosomes is highly controlled, cells can regulate what is hydrolysed and when the hydrolysis takes place. Thus, degradation can be used both for recycling and regulation purposes. The lysosomal lumen is n ...
... which is beneficial for the hydrolytic processes. In addition, since transport of molecules to lysosomes is highly controlled, cells can regulate what is hydrolysed and when the hydrolysis takes place. Thus, degradation can be used both for recycling and regulation purposes. The lysosomal lumen is n ...
An important role for glutathione and y
... eirher by mutation or by BSO (not shown), the increase was only 40% of the initial value at time zero of starvation (Fig. 4). This last observation points to a major role for GSH in the supply of growth requirements during nitrogen starvation. DISCUSSION ...
... eirher by mutation or by BSO (not shown), the increase was only 40% of the initial value at time zero of starvation (Fig. 4). This last observation points to a major role for GSH in the supply of growth requirements during nitrogen starvation. DISCUSSION ...
12 Insights into the mechanisms underlying CFTR channel activity
... The role of the R domain in channel gating In addition to the structural features shared with other ABC proteins, CFTR also contains a unique 241‑residue R domain in the linker region that joins the two halves of the protein [35] and is essential for its activity [36]. The highly charged R domain po ...
... The role of the R domain in channel gating In addition to the structural features shared with other ABC proteins, CFTR also contains a unique 241‑residue R domain in the linker region that joins the two halves of the protein [35] and is essential for its activity [36]. The highly charged R domain po ...
Bitis gabonica rhinoceros
... Glycosylation detection and deglycosylation- Twenty micrograms of purified protein were subjected to (i) 10% reducing SDS-PAGE followed by transfer to a PVDF membrane and (ii) glycosylation detection using the ECL glycoprotein detection module according to the manufacturer’s protocol. Deglycosylatio ...
... Glycosylation detection and deglycosylation- Twenty micrograms of purified protein were subjected to (i) 10% reducing SDS-PAGE followed by transfer to a PVDF membrane and (ii) glycosylation detection using the ECL glycoprotein detection module according to the manufacturer’s protocol. Deglycosylatio ...
Determination of Binding Sites of Cadherin Peptides on the EC1
... higher binding affinity to the EC1 domain than ADTC9 peptide. For cHAVc3, it binds selectively to at the D103 residue on EC1. AutoDock Vina studies confirm some of the binding sites found by NMR studies. In the future, a more detail study will be conducted to evaluate the effect of peptide binding o ...
... higher binding affinity to the EC1 domain than ADTC9 peptide. For cHAVc3, it binds selectively to at the D103 residue on EC1. AutoDock Vina studies confirm some of the binding sites found by NMR studies. In the future, a more detail study will be conducted to evaluate the effect of peptide binding o ...
Brown, V, Small, K, Lakkis, L, Feng, Y, Gunter, C, Wilkinson, KD and Warren, ST: Purified recombinant Fmrp exhibits selective RNA-binding as an intrinsic property of the fragile X mental retardation protein. Journal of Biological Chemistry 273:15521-15527 (1998).
... Fmrp Constructs—The baculoviral constructs used in wild type Fmrp production were constructed by inserting the sequence GACTACAAGGACGACGATGACAAG encoding the FLAG epitope into full-length fmr1 cDNA between the second and third amino acids. The fmr1 Mc2.17 cDNA (18) includes 123 bases upstream of the ...
... Fmrp Constructs—The baculoviral constructs used in wild type Fmrp production were constructed by inserting the sequence GACTACAAGGACGACGATGACAAG encoding the FLAG epitope into full-length fmr1 cDNA between the second and third amino acids. The fmr1 Mc2.17 cDNA (18) includes 123 bases upstream of the ...
Role of Protein Carbonylation in Skeletal Muscle Mass Loss
... Oxidants derive from two parent molecules: O2− and NO within the myofibers. Although ROS are Oxidants derive from two parent molecules: O2 ´ and NO within the myofibers. Although ROS needed for normal cell adaptation to environmental stimuli [71–74] they may also overwhelm tissue are needed for norm ...
... Oxidants derive from two parent molecules: O2− and NO within the myofibers. Although ROS are Oxidants derive from two parent molecules: O2 ´ and NO within the myofibers. Although ROS needed for normal cell adaptation to environmental stimuli [71–74] they may also overwhelm tissue are needed for norm ...
BVGH - Who We Are
... Recombinant and purified protein vaccines benefit from extensive resources from the biochemistry community for the production and purification of proteins including: • Multiple heterologous recombinant protein expression systems (e.g., bacteria, yeast, mammalian cells, cell free extracts) • Multiple ...
... Recombinant and purified protein vaccines benefit from extensive resources from the biochemistry community for the production and purification of proteins including: • Multiple heterologous recombinant protein expression systems (e.g., bacteria, yeast, mammalian cells, cell free extracts) • Multiple ...
The Role of Cyclin B in Meiosis I
... of the mitotic cell cycles (Masui and Clarke, 1979). However, in contrast to somatic ceils, most embryonic cells have abbreviated cell cycles consisting of rapid, alternating periods of DNA synthesis (interphase) and mitosis (M phase). The G1 and G2 periods are absent or very short in these "cleavag ...
... of the mitotic cell cycles (Masui and Clarke, 1979). However, in contrast to somatic ceils, most embryonic cells have abbreviated cell cycles consisting of rapid, alternating periods of DNA synthesis (interphase) and mitosis (M phase). The G1 and G2 periods are absent or very short in these "cleavag ...
Selective kinase inhibitors as tools for neuroscience research
... a known substrate of the target kinase, as use of the compound at concentrations significantly higher than this is much more likely to result in an off target activity. It is important to consider however that more than one kinase can act upon the same substrate site at once e for instance the transc ...
... a known substrate of the target kinase, as use of the compound at concentrations significantly higher than this is much more likely to result in an off target activity. It is important to consider however that more than one kinase can act upon the same substrate site at once e for instance the transc ...
enterocolitica Yersinia Type III Secretion System of Properties of the
... YscC is the integral outer membrane component of the type III protein secretion machinery of Yersinia enterocolitica and belongs to the family of secretins. This group of proteins forms stable ring-like oligomers in the outer membrane, which are thought to function as transport channels for macromol ...
... YscC is the integral outer membrane component of the type III protein secretion machinery of Yersinia enterocolitica and belongs to the family of secretins. This group of proteins forms stable ring-like oligomers in the outer membrane, which are thought to function as transport channels for macromol ...
Protein (nutrient)
Proteins are essential nutrients for the human body. They are one of the building blocks of body tissue, and can also serve as a fuel source. As a fuel, proteins contain 4 kcal per gram, just like carbohydrates and unlike lipids, which contain 9 kcal per gram. The most important aspect and defining characteristic of protein from a nutritional standpoint is its amino acid composition.Proteins are polymer chains made of amino acids linked together by peptide bonds. During human digestion, proteins are broken down in the stomach to smaller polypeptide chains via hydrochloric acid and protease actions. This is crucial for the synthesis of the essential amino acids that cannot be biosynthesized by the body.There are nine essential amino acids which humans must obtain from their diet in order to prevent protein-energy malnutrition. They are phenylalanine, valine, threonine, tryptophan, methionine, leucine, isoleucine, lysine, and histidine. There are five dispensable amino acids which humans are able to synthesize in the body. These five are alanine, aspartic acid, asparagine, glutamic acid and serine. There are six conditionally essential amino acids whose synthesis can be limited under special pathophysiological conditions, such as prematurity in the infant or individuals in severe catabolic distress. These six are arginine, cysteine, glycine, glutamine, proline and tyrosine.Humans need the essential amino acids in certain ratios. Some protein sources contain amino acids in a more or less 'complete' sense. This has given rise to various ranking systems for protein sources, as described in the article.Animal sources of protein include meats, dairy products, fish and eggs. Vegan sources of protein include whole grains, pulses, legumes, soy, and nuts. Vegetarians and vegans can get enough essential amino acids by eating a variety of plant proteins. It is commonly believed that athletes should consume a higher-than-normal protein intake to maintain optimal physical performance.