• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Experimental Analysis of the Rice Mitochondrial
Experimental Analysis of the Rice Mitochondrial

... mitochondria isolated by Suc gradient centrifugation and gel-based spot analysis. However, there is less than 20% overlap between the protein lists reported in these two studies. The removal of contaminants is essential for accurate curation of subcellular organelle proteomes. While dual targeting o ...
Question paper - Unit F215 - Control, genomes and
Question paper - Unit F215 - Control, genomes and

... Suggest why physiological problems are more common in pedigree animals. ...
Classification and Phylogenetic Analysis of the cAMP
Classification and Phylogenetic Analysis of the cAMP

... (Ustilago maydis; P49605) (Table 1). The theoretical isoelectric points covered a range from 4.82 (Blastocladiella emersonii; P31320) to 9.17 (Colletotrichum trifolii; O42794) Most of the sequence variation occurred in the N-terminal region preceding the inhibitory sequence, which contains the varia ...
Fulltext - Jultika
Fulltext - Jultika

... A data base search using the amino acid sequence of Saccharomyces cerevisiae Etr1p, the last enzyme of mitochondrial fatty acid synthesis type II (FAS II), revealed a highly similar human protein, NRBF-1. Expression of NRBF-1 in a yeast etr1? strain rescued its respiratory deficiency. NRBF-1 resides ...
Pathophysiology of Heme Synthesis
Pathophysiology of Heme Synthesis

... • Decreased cellular iron levels: ...
Two glucose/xylose transporter genes from the yeast Candida
Two glucose/xylose transporter genes from the yeast Candida

... of toxic compounds in hemicellulose hydrolysates, would also be used to convert the pentose fraction in these hydrolysates into ethanol. However, S. cerevisiae does not utilize xylose, which is the predominant pentose in hemicellulose, as a carbon and energy source. To circumvent this obstacle, the ...


... In this study, a topology protein prediction (TPP) using three transmembrane helix servers (TMHMM, TMpred and TopPred) was performed on hypothetical Chloride channel sequence (Rv0143c). Multiple alignment and structure threedimensional prediction was carried out on ClustalW and Insight II (Asselryx) ...
Synthesis of Oligonucleotides
Synthesis of Oligonucleotides

... Nucleobases. Permanent protecting groups for the exocyclic amino groups of adenine, cytosine and guanine have been used for many years in oligonucleotide synthesis.1 Acyl protecting groups were chosen, since they are stable for long periods during mildly basic and acidic conditions used during oligo ...
3-2 Organelles and the Cytoplasm
3-2 Organelles and the Cytoplasm

... • 3-1 List the functions of the plasma membrane and the structural features that enable it to perform those functions. • 3-2 Describe the organelles of a typical cell, and indicate the specific functions of each. • 3-3 Explain the functions of the cell nucleus and discuss the nature and importance o ...
ch_03_cells_presentation
ch_03_cells_presentation

... • 3-1 List the functions of the plasma membrane and the structural features that enable it to perform those functions. • 3-2 Describe the organelles of a typical cell, and indicate the specific functions of each. • 3-3 Explain the functions of the cell nucleus and discuss the nature and importance o ...
tRNA aminoacylation by arginyltRNA synthetase: induced
tRNA aminoacylation by arginyltRNA synthetase: induced

... conformational changes in the catalytic center of the Ê structure of a protein. The comparison with the 2.9 A binary complex formed by yeast arginyl-tRNA synthetase and tRNAArg reveals that L-arginine binding controls the correct positioning of the CCA end of the tRNAArg. Important structural change ...
AlgPred: prediction of allergenic proteins and mapping of
AlgPred: prediction of allergenic proteins and mapping of

... severe reactions such as acute and fatal anaphylactic shock can also occur. It affects a large population with very high prevalence particularly of skin sensitization (4,5). Most allergic responses occur on mucous membrane surface in response to allergens that enter the body by either inhalations or ...
How ribosomes make peptide bonds
How ribosomes make peptide bonds

... of peptide bonds – the peptidyl-transferase center – is composed solely of rRNA. Thus, the ribosome is the largest known RNA catalyst and the only natural ribozyme that has a synthetic activity. The ribosome employs entropic catalysis to accelerate peptide-bond formation by positioning substrates, r ...
Drosophila Forkhead Homologues Are Expressed in
Drosophila Forkhead Homologues Are Expressed in

... (prealbumin) gene by binding to the promoter sequence TGACTAAGTCAATAATCAGA (-1 I O to -90 from the start ~ i t e ) .This ~ , ~sequence is not homologous to any other transcription factor DNA binding sequence. HNF-3A is expressed in other tissues besides the liver,4 and thus may not be the sole reaso ...
Document
Document

pDsRed-Monomer-C1 Vector Information
pDsRed-Monomer-C1 Vector Information

... The multiple cloning site (MCS) in pDsRed-Monomer-C1 is positioned between the DsRed-Monomer coding sequence and the SV40 polyadenylation signal (SV40 poly A). Genes cloned into the MCS will be expressed as fusions to the C-terminus of DsRed-Monomer if they are in the same reading frame as DsRed-Mon ...
Drosophila Forkhead Homologues Are Expressed in
Drosophila Forkhead Homologues Are Expressed in

... (prealbumin) gene by binding to the promoter sequence TGACTAAGTCAATAATCAGA (-1 I O to -90 from the start ~ i t e ) .This ~ , ~sequence is not homologous to any other transcription factor DNA binding sequence. HNF-3A is expressed in other tissues besides the liver,4 and thus may not be the sole reaso ...
Write on zinc fingers
Write on zinc fingers

... structural families. Unlike many other clearly defined super secondary structures such as Greek keys or β hairpins, there are a number of types of zinc fingers, each with a unique threedimensional architecture. A particular zinc finger protein's class is determined by this threedimensional structure ...
magamtol talalt cikkek
magamtol talalt cikkek

... The sequences of two Drosophila and one rabbit protein phosphatase (PP) 1 catalytic subunits were determined from their cDNA. The sequence of Drosophila PP1 alpha 1 was deduced from a 2.2-kb cDNA purified from an embryonic cDNA library, while that for Drosophila PP1 beta was obtained from overlappin ...
Molecular genetics of the extracellular lipase of
Molecular genetics of the extracellular lipase of

... The structural gene (&A) coding for the extracellularlipase of Pseudomonus aeruginusa PAOl has been cloned on plasmid pSW118. Nucleotide sequence analysis revealed a gene of 936 bp. 1ipA codes for a proenzyme of 311 amino acids including a leader sequence of 26 amino acids. The mature protein was pr ...
PSLDoc: Protein subcellular localization prediction based on
PSLDoc: Protein subcellular localization prediction based on

... Bayesian network to decide the final prediction. PSORTb v.2.0, released in 2005, uses SVM as the underlying machine learning model and takes frequent subsequences occurring in proteins as input features. CELLO also uses SVM trained by multiple feature vectors derived from npeptide compositions. The ...
In situ hybridization
In situ hybridization

... 7. Better reproducibility. In situ hybridization with oligonucleotide probes is highly reproducible in every tissue and with every probe. It is possible to make a series of probes that have the same GC content; Since G/C base pairs bond more strongly than A/U base pairs, differences in GC content (o ...
Lesson 15a Components of DNA #1 PPT
Lesson 15a Components of DNA #1 PPT

... Other genes in the nuclear DNA code for tRNA molecules. ...
Mistranslation and its control by tRNA synthetases
Mistranslation and its control by tRNA synthetases

... oligonucleotide substrates that contain only a few base pairs from the end of the acceptor arm are robust substrates, provided they encode G:U [41]. Because the G:U base pair is distinct from and distal to the anticodon triplet of the code, the relationship between alanine and the nucleotide triplet ...
The polymorphism in MUC1 gene in Nelore cattle
The polymorphism in MUC1 gene in Nelore cattle

... et al. 2001). In the female reproductive tract, MUC1 has been associated with embryo implantation control where it is thought to provide a barrier between the blastocyst and the epithelial cells of the endometrium (Brayman et al. 2004). For this role, studies of gene expression during implantation i ...
< 1 ... 28 29 30 31 32 33 34 35 36 ... 524 >

Gene expression



Gene expression is the process by which information from a gene is used in the synthesis of a functional gene product. These products are often proteins, but in non-protein coding genes such as transfer RNA (tRNA) or small nuclear RNA (snRNA) genes, the product is a functional RNA.The process of gene expression is used by all known life - eukaryotes (including multicellular organisms), prokaryotes (bacteria and archaea), and utilized by viruses - to generate the macromolecular machinery for life.Several steps in the gene expression process may be modulated, including the transcription, RNA splicing, translation, and post-translational modification of a protein. Gene regulation gives the cell control over structure and function, and is the basis for cellular differentiation, morphogenesis and the versatility and adaptability of any organism. Gene regulation may also serve as a substrate for evolutionary change, since control of the timing, location, and amount of gene expression can have a profound effect on the functions (actions) of the gene in a cell or in a multicellular organism.In genetics, gene expression is the most fundamental level at which the genotype gives rise to the phenotype, i.e. observable trait. The genetic code stored in DNA is ""interpreted"" by gene expression, and the properties of the expression give rise to the organism's phenotype. Such phenotypes are often expressed by the synthesis of proteins that control the organism's shape, or that act as enzymes catalysing specific metabolic pathways characterising the organism.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report