THE DYNAMIN SUPERFAMILY: UNIVERSAL MEMBRANE
... The single isoforms of classical dynamin in D. melanogaster and Caenorhabditis elegans are assumed to cover the functions of the multiple isoforms in mammals. Mammalian dynamins 1 and 2 have been shown to have a role in scission of CCVs. In this process, the membrane invaginates to engulf cargo into ...
... The single isoforms of classical dynamin in D. melanogaster and Caenorhabditis elegans are assumed to cover the functions of the multiple isoforms in mammals. Mammalian dynamins 1 and 2 have been shown to have a role in scission of CCVs. In this process, the membrane invaginates to engulf cargo into ...
Selected Reaction Monitoring (SRM) to determine protein
... the abundance of a specific peptide derived from a protein. During an SRM experiment, sequential gating of precursor and product in a triple quadrupole mass spectrometer (QqQ-MS) allows millions of precursor/fragment ion combinations (transitions) to be assessed in complex peptide mixtures generated ...
... the abundance of a specific peptide derived from a protein. During an SRM experiment, sequential gating of precursor and product in a triple quadrupole mass spectrometer (QqQ-MS) allows millions of precursor/fragment ion combinations (transitions) to be assessed in complex peptide mixtures generated ...
The ribosome — a macromolecular machine par excellence
... compartments more or less by chance and in a diffusioncontrolled way, with the concept of the cell as a highly organized compendium of macromolecular machines. The metaphor of the macromolecular machine gained wide acceptance after Bruce Alberts’ influential article appeared in a special issue of Ce ...
... compartments more or less by chance and in a diffusioncontrolled way, with the concept of the cell as a highly organized compendium of macromolecular machines. The metaphor of the macromolecular machine gained wide acceptance after Bruce Alberts’ influential article appeared in a special issue of Ce ...
Evolution of Brachyury proteins: identification of a novel regulatory
... evolution. An N-terminal domain of variable length precedes a highly conserved 180-amino-acid DNA-binding T-domain (Kispert and Herrmann, 1993). The C-terminal half of the protein has been shown to mediate transcriptional activation in vertebrates (Conlon et al., 1996; Kispert et al., 1995) but is o ...
... evolution. An N-terminal domain of variable length precedes a highly conserved 180-amino-acid DNA-binding T-domain (Kispert and Herrmann, 1993). The C-terminal half of the protein has been shown to mediate transcriptional activation in vertebrates (Conlon et al., 1996; Kispert et al., 1995) but is o ...
Class I tRNA
... proteins are necessary only to maintain the rRNA in a structure in which rRNA can perform the catalytic function. Conformation of rRNAs is flexible during protein synthesis. The 3’ terminus of 16S rRNA pairs with the SD sequence of mRNA at ...
... proteins are necessary only to maintain the rRNA in a structure in which rRNA can perform the catalytic function. Conformation of rRNAs is flexible during protein synthesis. The 3’ terminus of 16S rRNA pairs with the SD sequence of mRNA at ...
ENS’06 FUSION PHAGE AS A BIOSELECTIVE NANOMATERIAL: EVOLUTION OF THE CONCEPT
... prepared by the fusion of the phage major coat protein pVIII with foreign random peptides. Phage particles and their proteins specific for cancer and bacterial cells were selected from the landscape libraries and exploited as molecular recognition interfaces in detection, gene- and drug-delivery sys ...
... prepared by the fusion of the phage major coat protein pVIII with foreign random peptides. Phage particles and their proteins specific for cancer and bacterial cells were selected from the landscape libraries and exploited as molecular recognition interfaces in detection, gene- and drug-delivery sys ...
Characterization of the Cytosolic Proteins Involved in the Amoeboid
... a tandem array of repeats with serine phosphorylation sites. P38, p40, and p42 appear to xi ...
... a tandem array of repeats with serine phosphorylation sites. P38, p40, and p42 appear to xi ...
Single-molecule insights into mRNA
... high accuracy (reviewed in [87]). Originally, five 50-nucleotide aminomodified oligodeoxynucleotides (ODNs), each of which directly labeled with five fluorescent dyes, were used for FISH in neurons [50]. This method enables highly sensitive detection of single probes bearing five dyes as well as sin ...
... high accuracy (reviewed in [87]). Originally, five 50-nucleotide aminomodified oligodeoxynucleotides (ODNs), each of which directly labeled with five fluorescent dyes, were used for FISH in neurons [50]. This method enables highly sensitive detection of single probes bearing five dyes as well as sin ...
Get PDF - Wiley Online Library
... eIF4GI(45–160), but not with GST–eIF4GI(45–155) (Figure 3D, compare lanes 1 and 2). While GST alone did not interact with FLAG-PABP (lane 4), the GST– eIF4GI(132–160) amino acid fusion protein bound FLAGPABP (lane 3). To examine whether the 29 amino acid segment binds to the endogenous PABP, GST or ...
... eIF4GI(45–160), but not with GST–eIF4GI(45–155) (Figure 3D, compare lanes 1 and 2). While GST alone did not interact with FLAG-PABP (lane 4), the GST– eIF4GI(132–160) amino acid fusion protein bound FLAGPABP (lane 3). To examine whether the 29 amino acid segment binds to the endogenous PABP, GST or ...
RNA PCR Kit (AMV)
... amplify RNA. However, synthesis of cDNA from RNA using reverse transcriptase enables to apply PCR process to the RNA analysis. Many reports of various fields have been made by applying this method, such as of structual analysis of RNA, efficient cDNA cloning, analysis of gene expression at the RNA l ...
... amplify RNA. However, synthesis of cDNA from RNA using reverse transcriptase enables to apply PCR process to the RNA analysis. Many reports of various fields have been made by applying this method, such as of structual analysis of RNA, efficient cDNA cloning, analysis of gene expression at the RNA l ...
Role of hsp90 and the hsp90-binding immunophilins in signalling
... The ubiquitous protein chaperone hsp90 has been shown to regulate more than 100 proteins involved in cellular signalling. These proteins are called ‘client proteins’ for hsp90, and a multiprotein hsp90/hsp70-based chaperone machinery forms client protein hsp90 heterocomplexes in the cytoplasm and th ...
... The ubiquitous protein chaperone hsp90 has been shown to regulate more than 100 proteins involved in cellular signalling. These proteins are called ‘client proteins’ for hsp90, and a multiprotein hsp90/hsp70-based chaperone machinery forms client protein hsp90 heterocomplexes in the cytoplasm and th ...
PDF
... Tata, Hamilton & Shields, 1972; Weinman & Roeder, 1974). This particular drug has been shown to be an efficient inhibitor of development in preimplantation rabbit (Van Blerkom, 1977) and mouse embryos (Golbus, Calarco & Epstein, 1973; Warner & Versteegh, 1974; Levey, Troike & Brinster, 1977; Braude, ...
... Tata, Hamilton & Shields, 1972; Weinman & Roeder, 1974). This particular drug has been shown to be an efficient inhibitor of development in preimplantation rabbit (Van Blerkom, 1977) and mouse embryos (Golbus, Calarco & Epstein, 1973; Warner & Versteegh, 1974; Levey, Troike & Brinster, 1977; Braude, ...
Daclatasvir Prevents Hepatitis C Virus by Blocking Transfer of
... the RNA-dependent RNA polymerase NS5B. Daclatasvir (DCV) and DCV-related molecules were discovered through screening of compounds inhibiting HCV subgenomic replicons3. In ...
... the RNA-dependent RNA polymerase NS5B. Daclatasvir (DCV) and DCV-related molecules were discovered through screening of compounds inhibiting HCV subgenomic replicons3. In ...
DOMAIN-BASED APPROACHES TO
... identification. Two groups of ionotropic glutamate receptors (iGluR’s) were identified with the topology of the binding core and pore-loop of the eukaryotic iGluR’s. Group 1 has a potassium-like selectivity filter and Group 2 is most closely related to eukaryotic iGluR’s. The relationship among them ...
... identification. Two groups of ionotropic glutamate receptors (iGluR’s) were identified with the topology of the binding core and pore-loop of the eukaryotic iGluR’s. Group 1 has a potassium-like selectivity filter and Group 2 is most closely related to eukaryotic iGluR’s. The relationship among them ...
Identification and Analysis of Dicer Associated Proteins in
... obtained from peptide sequencing of Dicer and TRBP immunopurifications were compared, and proteins identified in both preparations, among them the E3 Ubiquitin ligase Ro52, were considered for further analyses as likely components of a Dicer/TRBP complex. Ro52, also known as Sjoegren Syndrome Antige ...
... obtained from peptide sequencing of Dicer and TRBP immunopurifications were compared, and proteins identified in both preparations, among them the E3 Ubiquitin ligase Ro52, were considered for further analyses as likely components of a Dicer/TRBP complex. Ro52, also known as Sjoegren Syndrome Antige ...
Phosphate Groups Modifying Myelin Basic Proteins Are
... The time course of the appearance and decay of the radioactive label on basic proteins in isolated myelin was followed for 1 too. Incorporation was maximal by 1 h, followed by a decay phase with a half-life of approximately 2 wk. However, radioactivity in the acid-soluble precursor pool (which alway ...
... The time course of the appearance and decay of the radioactive label on basic proteins in isolated myelin was followed for 1 too. Incorporation was maximal by 1 h, followed by a decay phase with a half-life of approximately 2 wk. However, radioactivity in the acid-soluble precursor pool (which alway ...
Capacitation-associated Changes in Protein
... sperms were incubated in TALP devoid of BSA, and the Indirect immunofluorescence Immunofluorescence was employed to examine the percentage of sperms undergoing capacitation was subcellular localization of proteins phosphorylated in measured. When guinea pig sperms were incubated in TALP, tyrosine re ...
... sperms were incubated in TALP devoid of BSA, and the Indirect immunofluorescence Immunofluorescence was employed to examine the percentage of sperms undergoing capacitation was subcellular localization of proteins phosphorylated in measured. When guinea pig sperms were incubated in TALP, tyrosine re ...
Evidence for RNA Tumor Viruses in Human
... peaks are detected at both the 70 S and 52 S positions. It is further demonstrated that these complexes are due to an RNA-dependent reaction, as prior treatment with RNase eliminates both of the peaks. When equivalent quantities of either a normal or an uninvolved spleen from ...
... peaks are detected at both the 70 S and 52 S positions. It is further demonstrated that these complexes are due to an RNA-dependent reaction, as prior treatment with RNase eliminates both of the peaks. When equivalent quantities of either a normal or an uninvolved spleen from ...
μMACS™ mRNA Isolation Kits
... methods that circumvent common pitfalls: DNA contaminations and degradation of the RNA during the isolation can lead to false results, contaminating ribosomal RNA (rRNA) lowers the efficiency of the reverse transcription, and mRNA is often lost during conventional precipitation and washing steps. Th ...
... methods that circumvent common pitfalls: DNA contaminations and degradation of the RNA during the isolation can lead to false results, contaminating ribosomal RNA (rRNA) lowers the efficiency of the reverse transcription, and mRNA is often lost during conventional precipitation and washing steps. Th ...
Proteome analysis of tobacco BY-2 cell culture - ETH E
... distinguish plant cells from those of other eukaryotes. The origin and evolution of plastids has been an important subject in biological sciences. Plastids represent the endosymbiotic remnants of a free-living cyanobacterial progenitor, which lost the vast majority of its ancestral cyanobacterial ge ...
... distinguish plant cells from those of other eukaryotes. The origin and evolution of plastids has been an important subject in biological sciences. Plastids represent the endosymbiotic remnants of a free-living cyanobacterial progenitor, which lost the vast majority of its ancestral cyanobacterial ge ...
Brown, V, Small, K, Lakkis, L, Feng, Y, Gunter, C, Wilkinson, KD and Warren, ST: Purified recombinant Fmrp exhibits selective RNA-binding as an intrinsic property of the fragile X mental retardation protein. Journal of Biological Chemistry 273:15521-15527 (1998).
... production were constructed by inserting the sequence GACTACAAGGACGACGATGACAAG encoding the FLAG epitope into full-length fmr1 cDNA between the second and third amino acids. The fmr1 Mc2.17 cDNA (18) includes 123 bases upstream of the translational start codon, all 17 exons and 2288 bases of 39 untr ...
... production were constructed by inserting the sequence GACTACAAGGACGACGATGACAAG encoding the FLAG epitope into full-length fmr1 cDNA between the second and third amino acids. The fmr1 Mc2.17 cDNA (18) includes 123 bases upstream of the translational start codon, all 17 exons and 2288 bases of 39 untr ...
REVIEWS Structural insights into the function of the
... in FAD binding to flavoproteins. The structure is rotated ~180 ~ about the vertical relative to (a) to of wild-type Rab2~ Further exbring the FAD-binding groove and the ~(~13unit (yellow) and the remnant GXG motif (red) into view. The orange strands flanking the 13(~i3unit are part of the extended s ...
... in FAD binding to flavoproteins. The structure is rotated ~180 ~ about the vertical relative to (a) to of wild-type Rab2~ Further exbring the FAD-binding groove and the ~(~13unit (yellow) and the remnant GXG motif (red) into view. The orange strands flanking the 13(~i3unit are part of the extended s ...
HIS-Select Nickel Affinity Gel (P6611) - Technical - Sigma
... The HIS-Select Nickel Affinity Gel is stored in 30% ethanol. The ethanol must be removed just prior to use. Thoroughly resuspend the affinity gel with gentle inversion and remove an appropriate aliquot for use. Take only the amount of affinity gel that is necessary for the purification to be done. T ...
... The HIS-Select Nickel Affinity Gel is stored in 30% ethanol. The ethanol must be removed just prior to use. Thoroughly resuspend the affinity gel with gentle inversion and remove an appropriate aliquot for use. Take only the amount of affinity gel that is necessary for the purification to be done. T ...
SR protein
SR proteins are a conserved family of proteins involved in RNA splicing. SR proteins are named because they contain a protein domain with long repeats of serine and arginine amino acid residues, whose standard abbreviations are ""S"" and ""R"" respectively. SR proteins are 50-300 amino acids in length and composed of two domains, the RNA recognition motif (RRM) region and the RS binding domain. SR proteins are more commonly found in the nucleus than the cytoplasm, but several SR proteins are known to shuttle between the nucleus and the cytoplasm.SR proteins were discovered in the 1990s in Drosophila and in amphibian oocytes, and later in humans. In general, metazoans appear to have SR proteins and unicellular organisms lack SR proteins.SR proteins are important in constitutive and alternative pre-mRNA splicing, mRNA export, genome stabilization, nonsense-mediated decay, and translation. SR proteins alternatively splice pre-mRNA by preferentially selecting different splice sites on the pre-mRNA strands to create multiple mRNA transcripts from one pre-mRNA transcript. Once splicing is complete the SR protein may or may not remain attached to help shuttle the mRNA strand out of the nucleus. As RNA Polymerase II is transcribing DNA into RNA, SR proteins attach to newly made pre-mRNA to prevent the pre-mRNA from binding to the coding DNA strand to increase genome stabilization. Topoisomerase I and SR proteins also interact to increase genome stabilization. SR proteins can control the concentrations of specific mRNA that is successfully translated into protein by selecting for nonsense-mediated decay codons during alternative splicing. SR proteins can alternatively splice NMD codons into its own mRNA transcript to auto-regulate the concentration of SR proteins. Through the mTOR pathway and interactions with polyribosomes, SR proteins can increase translation of mRNA.Ataxia telangiectasia, neurofibromatosis type 1, several cancers, HIV-1, and spinal muscular atrophy have all been linked to alternative splicing by SR proteins.