DNA sequence of the rat growth hormone gene: location of the 5
... Digestions were usually done with a s u b s t a n t i a l excess of enzyme and approximately in accordance with t h e conditions provided by t h e manufact u r e r . Gel e l e c t r o p h o r e t i c separations, unless specified otherwise, were performed e i t h e r on 1% agarose gels or fi% acryla ...
... Digestions were usually done with a s u b s t a n t i a l excess of enzyme and approximately in accordance with t h e conditions provided by t h e manufact u r e r . Gel e l e c t r o p h o r e t i c separations, unless specified otherwise, were performed e i t h e r on 1% agarose gels or fi% acryla ...
jxb.oxfordjournals.org
... primers (forward: 59- CTACGGAGTACACCGCAACC and reverse: 59-AATGGATTGCCTACTGCTGACT) was designed for Ping in the region before the first ORF, at positions 327–1513 ; within this region no sequence similarity exists between Ping and Pong based on pairwise sequence comparison. Thus, with this pair of p ...
... primers (forward: 59- CTACGGAGTACACCGCAACC and reverse: 59-AATGGATTGCCTACTGCTGACT) was designed for Ping in the region before the first ORF, at positions 327–1513 ; within this region no sequence similarity exists between Ping and Pong based on pairwise sequence comparison. Thus, with this pair of p ...
Biosynthesis of the Antibiotic Nonribosomal Peptide Penicillin in
... the best combination of promoter strengths for increased yields. We observed that this always required strong expression of the peroxisomally-located enzyme pclA. As engineered heterologous biosynthesis of penicillin has only previously been observed with Hansenula polymorpha, a methylotrophic yeast ...
... the best combination of promoter strengths for increased yields. We observed that this always required strong expression of the peroxisomally-located enzyme pclA. As engineered heterologous biosynthesis of penicillin has only previously been observed with Hansenula polymorpha, a methylotrophic yeast ...
Evolutionary Origin and Adaptive Function of Meiosis
... Natural bacterial transformation involves the transfer of DNA from one bacterium to another through the surrounding medium. Transformation depends on the expression of numerous bacterial genes whose products appear to be designed to carry out this process (Chen and Dubnau, 2004; Johnsborg et al., 20 ...
... Natural bacterial transformation involves the transfer of DNA from one bacterium to another through the surrounding medium. Transformation depends on the expression of numerous bacterial genes whose products appear to be designed to carry out this process (Chen and Dubnau, 2004; Johnsborg et al., 20 ...
Document
... Epigenetic machinery was established by Life for ‘genome protection’ purposes first. In the further course of evolution, however, the mechanisms of processing of epigenetic information - which allow recognition of different epigenetic marks and channeling the signals encoded in these marks along app ...
... Epigenetic machinery was established by Life for ‘genome protection’ purposes first. In the further course of evolution, however, the mechanisms of processing of epigenetic information - which allow recognition of different epigenetic marks and channeling the signals encoded in these marks along app ...
Identification of Short Motifs for Comparing Biological Sequences
... DIALIGN by A. Subramanian [4]. In addition to alignmentbased methods, other techniques are alignment-free [1] and had a focus on addressing the speed issue as well the quality issue. Alignment-free methods are not new subject and they are in the literature for a while as discussed by K. Song et al. ...
... DIALIGN by A. Subramanian [4]. In addition to alignmentbased methods, other techniques are alignment-free [1] and had a focus on addressing the speed issue as well the quality issue. Alignment-free methods are not new subject and they are in the literature for a while as discussed by K. Song et al. ...
thymine dimers - Glen Research
... is probably the most popular approach for the preparation of proteins with variations at specific sites. This protein engineering technique uses oligonucleotides of mixed sequences to generate libraries of proteins for screening potential improvements in specific biological function. It is certainly ...
... is probably the most popular approach for the preparation of proteins with variations at specific sites. This protein engineering technique uses oligonucleotides of mixed sequences to generate libraries of proteins for screening potential improvements in specific biological function. It is certainly ...
Sequence Alignment - Mainlab Bioinformatics
... Search for short nearly exact matches" is useful for primer or short nucleotide searches. Short sequences (less than 20 bases) will often not find any significant matches to the database entries under the standard nucleotide-nucleotide BLAST settings. The usual reasons for this are that the signific ...
... Search for short nearly exact matches" is useful for primer or short nucleotide searches. Short sequences (less than 20 bases) will often not find any significant matches to the database entries under the standard nucleotide-nucleotide BLAST settings. The usual reasons for this are that the signific ...
Microsoft Word (Chapter 3) - DORAS
... 1021. The indicator strain S. meliloti 2011rhbA62 produced the clearest halos because background was eliminated by the mutation in the rhizobactin 1021 biosynthesis operon. The results for S. meliloti 2011rhbA62 confirmed those of S. meliloti 2011. S. meliloti 2011rhtX-3 was shown to be defective in ...
... 1021. The indicator strain S. meliloti 2011rhbA62 produced the clearest halos because background was eliminated by the mutation in the rhizobactin 1021 biosynthesis operon. The results for S. meliloti 2011rhbA62 confirmed those of S. meliloti 2011. S. meliloti 2011rhtX-3 was shown to be defective in ...
Characterisation of the diol dehydratase pdu operon of Lactobacillus
... The activity of the dehydratase measured in L. collinoides grown under di¡erent conditions is presented in Fig. 4A. Dehydratase activity was detected when glucose was used as carbon source. This activity increased during the exponential growth phase before being stable in stationary phase (0.36 U mg ...
... The activity of the dehydratase measured in L. collinoides grown under di¡erent conditions is presented in Fig. 4A. Dehydratase activity was detected when glucose was used as carbon source. This activity increased during the exponential growth phase before being stable in stationary phase (0.36 U mg ...
Intelligent Icons: Integrating Lite-Weight Data Mining
... The three files in the example are ASCII text files, each of which contains approximately 16,000 base pairs of mitochondrial DNA. Here we used string edit distance as suggested in [15] to measure the distance between file names, and Euclidean distance to measure the distance between the file icons ( ...
... The three files in the example are ASCII text files, each of which contains approximately 16,000 base pairs of mitochondrial DNA. Here we used string edit distance as suggested in [15] to measure the distance between file names, and Euclidean distance to measure the distance between the file icons ( ...
The nucleotide sequence and derived amino acid
... Blancetot etal., 1983; Penniea etal., 1983; Jolly et al., 1983) suggests that such a phenomenon may not be as uncommon as previously thought. However, no significance has as yet been associated with large 3'-nontranslated regions. In CA II mRNA following the termination signal the same reading frame ...
... Blancetot etal., 1983; Penniea etal., 1983; Jolly et al., 1983) suggests that such a phenomenon may not be as uncommon as previously thought. However, no significance has as yet been associated with large 3'-nontranslated regions. In CA II mRNA following the termination signal the same reading frame ...
1 - IPPC
... indicated in Figures 1 and 2 are the minimum requirements for the diagnosis, but further tests may be required by the national plant protection organization (NPPO), especially for the first report in a country. For example, serological tests may facilitate a presumptive diagnosis of symptomatic plan ...
... indicated in Figures 1 and 2 are the minimum requirements for the diagnosis, but further tests may be required by the national plant protection organization (NPPO), especially for the first report in a country. For example, serological tests may facilitate a presumptive diagnosis of symptomatic plan ...
Biology 409 - CSU, Chico
... procedural comments your instructor makes about a lab; the exact protocol you used; any and all raw data as well as summarized data with titles and legends for tables, graphs, and figures; all numerical values should have units. Protocol handouts and printed figures may be pasted into your notebook. ...
... procedural comments your instructor makes about a lab; the exact protocol you used; any and all raw data as well as summarized data with titles and legends for tables, graphs, and figures; all numerical values should have units. Protocol handouts and printed figures may be pasted into your notebook. ...
2004-009_-Draft-Anne..
... serological methods may facilitate a presumptive diagnosis of symptomatic plant material; however, an additional test based on a different biological principle should be used for detection. In all tests, positive and negative controls must be included. The use of products of commercial brands in thi ...
... serological methods may facilitate a presumptive diagnosis of symptomatic plant material; however, an additional test based on a different biological principle should be used for detection. In all tests, positive and negative controls must be included. The use of products of commercial brands in thi ...
Molecular cloning of a rhodopsin gene from salamander rods.
... with the GeneReleaser reagents (Bio Ventures, Murfreesboro, TN) according to the manufacturer's instructions to release their RNA. The single cell lysates were then subjected to RT-PCR amplification and Southern blot analysis as described above, except that a nested oligonucleotide (GAAGGCTGAGAAAGAG ...
... with the GeneReleaser reagents (Bio Ventures, Murfreesboro, TN) according to the manufacturer's instructions to release their RNA. The single cell lysates were then subjected to RT-PCR amplification and Southern blot analysis as described above, except that a nested oligonucleotide (GAAGGCTGAGAAAGAG ...
SNP-Based Mapping of Crossover Recombination in
... tage of being phenotypically neutral (in general) and codominant, thus avoiding potential complications due to viability and sim plifying scoring. In addition, multiple markers can be followed in a single cross (limited only by the number of PCRs one can carry out on the DNA sample obtained). A sub ...
... tage of being phenotypically neutral (in general) and codominant, thus avoiding potential complications due to viability and sim plifying scoring. In addition, multiple markers can be followed in a single cross (limited only by the number of PCRs one can carry out on the DNA sample obtained). A sub ...
A new heavy lanthanide-dependent DNAzyme
... only moderate cleavage was observed with Tb3+ . Efficient cleavage occurred from Dy3+ to Tm3+ , and then the cleaved product decreased rapidly with Yb3+ and Lu3+ . This is a general trend for all the six tested DNAzymes and their activities are quantified in Figure 2D. Based on this study, we reason ...
... only moderate cleavage was observed with Tb3+ . Efficient cleavage occurred from Dy3+ to Tm3+ , and then the cleaved product decreased rapidly with Yb3+ and Lu3+ . This is a general trend for all the six tested DNAzymes and their activities are quantified in Figure 2D. Based on this study, we reason ...
Collaborative coupling between polymerase and helicase for
... holoenzyme destabilizes the first few base pairs of the fork thereby increasing the efficiency of helicase unwinding. The model implies that both enzymes are localized at the fork, but does not require a specific interaction between them. The model quantitatively reproduces homologous and heterologo ...
... holoenzyme destabilizes the first few base pairs of the fork thereby increasing the efficiency of helicase unwinding. The model implies that both enzymes are localized at the fork, but does not require a specific interaction between them. The model quantitatively reproduces homologous and heterologo ...
The specificity of regulatory protein binding to DNA is due to a
... were made in the case of two-component ligand binding. It should be noted that in the case of binding of a two-(four)-component ligand the probability of binding to DNA sites partially overlapped with the specific binding site depends on the arrangement of reaction centres along the ligand. This dep ...
... were made in the case of two-component ligand binding. It should be noted that in the case of binding of a two-(four)-component ligand the probability of binding to DNA sites partially overlapped with the specific binding site depends on the arrangement of reaction centres along the ligand. This dep ...
Painting the target around the matching profile
... (i.e. alleles not associated with the sample) are sometimes detected, a phenomenon known as allelic ‘drop-in’ A further complication is that evidentiary samples are often mixtures of DNA from more than one person. It can be difficult to tell how many contributors there were to a mixed sample (Paolet ...
... (i.e. alleles not associated with the sample) are sometimes detected, a phenomenon known as allelic ‘drop-in’ A further complication is that evidentiary samples are often mixtures of DNA from more than one person. It can be difficult to tell how many contributors there were to a mixed sample (Paolet ...
Sequence Information Encoded in DNA that May Influence Long
... 51,833 (100 kb) windows (giving a ‘‘genome average’’ value of 0.204 signals per window). Larger genomic DNA regions ($300 kb) that contained clusters of nearly-consecutive signals, as well as regions $1 Mb that completely lacked signals were also identified. These results are available in Table S2. ...
... 51,833 (100 kb) windows (giving a ‘‘genome average’’ value of 0.204 signals per window). Larger genomic DNA regions ($300 kb) that contained clusters of nearly-consecutive signals, as well as regions $1 Mb that completely lacked signals were also identified. These results are available in Table S2. ...
Molecular Plant-Microbe Interactions 13:
... carbon and nitrogen source supplemented with rifampicin (25 µg/ml), kanamycin (50 µg/ml), and tetracycline (10 µg/ml). Cosmids were isolated from the complemented mutant, transformed into E. coli (DH5), reisolated, and digested with EcoRI. The inserts of cosmids complementing P121R25 were subcloned ...
... carbon and nitrogen source supplemented with rifampicin (25 µg/ml), kanamycin (50 µg/ml), and tetracycline (10 µg/ml). Cosmids were isolated from the complemented mutant, transformed into E. coli (DH5), reisolated, and digested with EcoRI. The inserts of cosmids complementing P121R25 were subcloned ...
Bisulfite sequencing
Bisulphite sequencing (also known as bisulfite sequencing) is the use of bisulphite treatment of DNA to determine its pattern of methylation. DNA methylation was the first discovered epigenetic mark, and remains the most studied. In animals it predominantly involves the addition of a methyl group to the carbon-5 position of cytosine residues of the dinucleotide CpG, and is implicated in repression of transcriptional activity.Treatment of DNA with bisulphite converts cytosine residues to uracil, but leaves 5-methylcytosine residues unaffected. Thus, bisulphite treatment introduces specific changes in the DNA sequence that depend on the methylation status of individual cytosine residues, yielding single- nucleotide resolution information about the methylation status of a segment of DNA. Various analyses can be performed on the altered sequence to retrieve this information. The objective of this analysis is therefore reduced to differentiating between single nucleotide polymorphisms (cytosines and thymidine) resulting from bisulphite conversion (Figure 1).