Download jxb.oxfordjournals.org

Journal of Experimental Botany, Vol. 57, No. 10, pp. 2313–2323, 2006
doi:10.1093/jxb/erj203 Advance Access publication 3 July, 2006
This paper is available online free of all access charges (see http://jxb.oxfordjournals.org/open_access.html for further details)
RESEARCH PAPER
In planta mobilization of mPing and its putative
autonomous element Pong in rice by hydrostatic
pressurization
Xiuyun Lin1,3,*, Likun Long1,*, Xiaohui Shan1, Sanyuan Zhang3, Sile Shen4 and Bao Liu1,2,†
1
Laboratory of Plant Molecular Epigenetics, Institute of Genetics and Cytology, Northeast Normal University,
Changchun 130024, China
2
Key Laboratory for Applied Statistics of MOE, Northeast Normal University, Changchun 130024, China
3
4
Jilin Academy of Agricultural Sciences, Gongzuling 136100, China
The National Key Laboratory of Super-hard Material, Jilin University, Changchun 130020, China
Received 3 November 2005; Accepted 19 March 2006
Abstract
The miniature Ping (mPing) is a recently discovered
endogenous miniature inverted repeat transposable
element (MITE) in rice, which can be mobilized by
tissue culture or irradiation. It is reported here that
mPing, together with one of its putative transposaseencoding partners, Pong, was efficiently mobilized in
somatic cells of intact rice plants of two distinct cultivars derived from germinating seeds subjected to
high hydrostatic pressure, whereas the other autonomous element of mPing, Ping, remained static in the
plants studied. mPing excision was detected in several
plants of both cultivars in the treated generation (P0),
which were selected based on their novel phenotypes.
Southern blot analysis and transposon-display assay
on selfed progenies (P1 generation) of two selected P0
plants, one from each of the cultivars, revealed polymorphic banding patterns consistent with mobilization
of mPing and Pong. Various mPing excisions and de
novo insertions, as detected by element-bracketing,
locus-specific PCR assays, occurred in the different
P1 plants of both cultivars. Pong excision at one locus
for each cultivar was also detected by using a Pong
internal primer together with locus-specific flanking
primers in the P1 plants. In contrast to the pressurized
plants, immobility of both mPing and Pong in control
plants, and the absence of within-cultivar heterozygosity at the analysed loci were verified by Southern
blotting and/or locus-assay. Sequencing at 18 mPing
empty donor sites isolated from the pressurized
plants indicated properties characteristic of the element excision. Sequence-based mapping of 10 identified mPing de novo insertions from P1 progenies of
pressurized plants indicated that all were in unique
or low-copy regions, conforming with the targeting
propensity of mPing. No evidence for further mPing
activity was detected in the P2 plants tested. In spite
of the high activity of mPing and Pong in the pressurized plants, amplified fragment length polymorphism
(AFLP) analysis denoted their general genomic stability, and several potentially active retrotransposons
also remained largely immobile. Further investigation
showed that the same hydrostatic pressure treatments
also caused mobilization of mPing in the standard
laboratory cultivar for japonica rice, Nipponbare. Thus,
a simple and robust approach for in planta MITEmobilization in rice has been established by using
high hydrostatic pressure treatment, which may be
useful as an alternative for gene-tagging in this important crop plant.
Key words: Hydrostatic pressure, MITEs, rice, tagging, transposon mobilization
Introduction
Transposon-tagging is an important methodology for gene
isolation and functional studies in both animals and plants
* These authors contributed equally to this work.
y
To whom correspondence should be addressed. E-mail: [email protected]
ª 2006 The Author(s).
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which
permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
2314 Lin et al.
(Klinakis et al., 2000; Bessereau et al., 2001; Kumar et al.,
2003). In rice, an active copia-like long-terminal repeat or
LTR retrotransposon (Tos17) is currently being employed
to generate insertional mutations on a large scale, which
has facilitated the isolation of several important genes
(Hirochika, 2001; Kumar and Hirochika, 2001; Miyao
et al., 2003; Hirochika et al., 2004; Kurusu et al., 2004).
However, activation of Tos17 requires tissue culture, a process often-associated with somaclonal variation (Hirochika
et al., 1996). Obviously, an in planta transposon-tagging
method obviating the tissue culture process is highly
desirable in rice.
The miniature inverted transposable elements (MITEs)
represent a distinct type of class II DNA transposons
that usually transpose via the cut-and-paste mechanism
(Feschotte et al., 2002; Casacuberta and Santiago, 2003;
Jiang et al., 2004). Miniature-Ping or mPing, the only
active MITE so far discovered in any organism, is a 430 bp
DNA repeat endogenous to the rice genome, which
contains terminal inverted repeats or TIRs (15 bp) and
produces target site duplications or TSDs (TAA or TTA)
typical of a tourist-like MITE family (Feschotte et al.,
2002; Jiang et al., 2003; Kikuchi et al., 2003; Nakazaki
et al., 2003). mPing is cryptic under normal conditions
(but also see Nakazaki et al., 2003), but can be effectively mobilized by tissue culture (Jiang et al., 2003;
Kikuchi et al., 2003) or irradiation (Nakazaki et al., 2003),
with mobilized copies preferentially inserting into singlecopy, non-coding or genic regions (Jiang et al., 2003).
Because mPing has no coding-capacity, and hence is
non-autonomous, the transposase (TPase) responsible for
its mobilization is provided in trans, probably by either
or both of the identified mPing-related, transposaseencoding elements, Ping and Pong, which often showed
co-mobilization with mPing under the specific induction
conditions (Jiang et al., 2003; Kikuchi et al., 2003;
Nakazaki et al., 2003).
The finding that the copy number of mPing varies
dramatically among the rice cultivar-groups that are domesticated independently from a common wild species,
Oryza ruffipogon (Second, 1982; Ma and Bennetzen,
2004; Zhu and Ge, 2005) suggests that mPing, like
transposons in Drosophila and some LTR-retrotransposons
in plants, might be mobilized by factors other than tissue
culture or irradiation, such as environmental stresses (Capy
et al., 1990, 2000; Wessler, 1996; Grandibastien, 1998;
Jiang et al., 2003) and interspecific hybridization (Labrador
et al., 1994; Shan et al., 2005). Indeed, it was found
recently that mPing showed apparent mobility in several
introgressed rice lines derived from an intergeneric cross
between rice and wild rice (Zizania latifolia Griseb.) (Shan
et al., 2005).
High hydrostatic pressurization is a physical stress
whereby multiple cellular activities, including chromatin
structure (Kaarniranta et al., 1998), DNA methylation state
(Long et al., 2006), and gene expression (Symington et al.,
1991; Wilson et al., 2001; Sironen et al., 2002; Yang et al.,
2004), can be affected. Given that activity of transposons is
often controlled by epigenetic mechanisms (Okamoto et al.,
2001; Miura et al., 2001; Ros and Kunze, 2001; Singer
et al., 2001; Lippman et al., 2003; Bender, 2004), and can
be closely linked to the general celluar responses to stress
(Grandibastien, 1998; Capy et al., 2000), it is speculated
that high hydrostatic pressure might constitute a stressful
condition whereby some cryptic transposons like mPing
might be activated. The present study was aimed at
addressing this possibility. It is reported here that mPing,
together with one of its putative TPase-encoding partners,
Pong, was efficiently mobilized in somatic cells of pressurized rice plants from two distinct cultivars studied.
Moreover, multiple mPing insertions had occurred in
progeny plants derived from single pressurized parental
plants, which were then likely stably inherited. The possible
advantages of using hydrostatic pressure-induced mPing
mobility, relative to activity induced by tissue culture or
irradiation, for gene-tagging in rice is discussed.
Materials and methods
Plant material
Seeds of two established inbred japonica rice cultivars, JL307 and
JL01-124, were kindly provided by the Institute of Rice Breeding,
Jilin Academy of Agricultural Sciences, Gongzhuling, Jilin, China.
The choice of these two rice lines are mainly because of their elite
nature as newly released inbred commercial cultivars, and their clear
pedigree, such as none of their parental cultivars ever having been
subjected to tissue culture and irradiation. In addition to these two
cultivars, the standard laboratory cultivar for japonica rice ssp.
Nipponbare, was also used.
Hydrostatic pressurization
Rice seeds (soaked in distilled water at ambient temperature for 24 h)
were subjected to continuous high hydrostatic pressure (80 MPa,
20 min or 100 MPa, 15 min at ambient temperature), essentially as
reported (Fernandesa et al., 2004; Long et al., 2006). These conditions were chosen based on previous reports mainly on animal and
human cultured cells (Symington et al., 1991; Kaarniranta et al.,
1998; Wilson et al., 2001; Sironen et al., 2002; Yang et al., 2004).
The germinating seeds were allowed to grow to seedlings in Petri
dishes before being transplanted to a conventional paddy field.
PCR-based locus assay on mPing and Pong excision
To detect possible excisions of mPing (AB087615.1) and Pong
(BK000586.1), a set of 53 pairs of locus-specific primers each
bracketing an intact mPing and five pairs of locus-specific primers
each bracketing an intact Pong in the standard laboratory cultivar
for japonica rice ssp., Nipponbare (see supplementary Table 1 at
JXB online), was designed based on its available whole genome
sequence (http://rgp.dna.affrc.go.jp), by the Primer 3 software (http://
biocore.unl.edu/cgi-bin/primer3/primer3_www.cgi). Loci containing
a mPing or Pong in each of the two cultivars were identified by
PCR amplification with this set of primers. It turned out that JL-307
has 25 mPing-containing loci and one Pong-containing locus,
while JL01-124 has 11 mPing-containing and one Pong-containing
In planta transposable element mobilization
2315
Table 1. Characterization of isolated target sites flaking de novo mPing insertions in P1 progenies of pressurized plants in two rice
cultivars JL307 and JL01-124
IS locus
Insertion sitea
Locus-specific primers (59–39)
Isolated from
TIR
TSD
mpISL3
Ch.2; AP008208.1;
position: 18634566;
non-coding
Ch.4; AP008210.1;
position: 81645;
non-coding
Ch.3; AC146468.1;
position:88481;
non-coding
Ch.1; AP008207.1;
position: 23328654;
unknown protein (ORF);
7e-23
Ch.7; AP008213.1;
position: 4593123;
putative light-regulated
protein (ORF); 5e-12
Ch.4; AP008210.1;
position: 123776;
non-coding
Ch.3; AC121491.2;
position: 64666;
non-coding
Ch.3; AP008209.1;
position: 21161019;
non-coding
Ch.5; AC136219.2;
position: 76366;
non-coding
Ch.6; AP008212.1;
position: 29583478;
hypothetical protein (ORF); 2e-16
For: GGGGAGTTGCAAGTGTTGAT
Rev: TCCTCAAAACAGCCATAGCA
JL307#1-P1-2
GGCCAGTCACAATGG
TAA
For: TGGTTTGCTGGGACATGTAA
Rev: GCTCTTGCATAAGAGCCAACA
JL307#1-P1-2
JL307#1-P1-4
GGCCAGTCACAATGG
TAA
For: TCCCATTCAAAGATGACGAA
Rev: GAACACGAAACAACAGAACACC
JL307#1-P1-2
JL01-124#3-P1-1
GGCCAGTCACAATGG
TAA
For: TGGCTGGTCCTTACCTTTTG
Rev: GACGTGGAGAGGTGGAAGAG
JL307#1-P1-6
JL01-124-P1-4
GGCCAGTCACAATGG
TAA
For: GCACAGGCTCCAAGACGTA
Rev: AAAAACTGACCGTTGGATGG
JL307#1-P1-4
JL01-124#3-P1-2
GGCCAGTCACAATGG
TAA
For: CTGCACGCCTAGCCTCTTTA
Rev: AGCGCTCGACTACTCCAGAT
JL307#1-P1
GGCCAGTCACAATGG
TTA
For: TTGAGAGCATCCACAACGAA
Rev: ATCGGCATTAGCACAAAGGA
JL307#1-P1-1
JL307#1-P1-3
GGCCAGTCACAATGG
TTA
For: CATGTGCGTGGAAAACAGAG
Rev: GGTGCGGAACATGTCATCTA
JL307#1-P1-2
JL307#1-P1-3
GGCCAGTCACAATGG
TTA
For: CCAAATGAGCCCGTAAATCT
Rev: TCCAGACTCCAGTTCTGCAC
JL01-124#3-P1-2
GGCCAGTCACAATGG
TTA
For: GTCCGATGGATCCTACTGGT
Rev: ATTAAGCATGCATGGGTGTG
JL01-124#3-P1-3
JL01-124#3-P1-5
GGCCAGTCACAATGG
TAA
mpISL4
mpISL11
mpISL15
mpISL18
mpISL22
mpISL23
mpISL36
mpISL43
mpISL44
a
Based on BLASTN at the NCBI website.
locus (see supplementary Table 1 at JXB online). For the mPingcontaining locus assay, a pair of primers flanking mPing was used.
For the Pong-containing locus assay, a Pong-internal primer (59TGCATTGGAAACGCTAGAGTG, at positions 5032–5052) was
combined with a locus-specific primer at the 39-flanking region of
each locus. All PCR amplifications were performed at annealing
temperatures ranging from 58 8C to 62 8C depending on the different
pairs of primers. The amplicons were visualized by ethidium bromide
staining after electrophoresis through 2% agarose gels. Some of the
identified empty donor sites for mPing and Pong excisions were
isolated and sequenced, together with their corresponding elementcontaining loci.
Southern blot analysis
Genomic DNA was isolated from expanded leaves of individual
plants by a modified CTAB method and purified by phenol
extractions. Genomic DNA (;3 lg per lane) of the various plant
lines was digested by HindIII or XbaI (New England Biolabs,
Beverly, Massachusetts). Digested DNA was run through 1% agarose
gels and transferred onto Hybond N+ nylon membranes (Amersham
Pharmacia Biotech, Piscataway, New Jersey) by the alkaline transfer
recommended by the supplier. For probes, the near full-length
of mPing (positions: 6–430) was isolated by PCR with primers
of forward: 59-GTCACAATGGGGGTTTCACT and reverse: 59GGCCAGTCACAATGGCTAGT. For Pong, a fragment in the
second open reading frame (ORF) region, designated as PongORF2 (positions 3199–4255), was isolated by PCR with primers
of forward: 59-AACGAGGCTTCTGACCATCG and reverse: 59-
CAGGTTCCTGAACGGTTGAT. Because another mPing-related
autonomous element, Ping (AB087616.1) shares significant similarity with Pong in the two ORF regions (Jiang et al., 2003), a pair of
primers (forward: 59- CTACGGAGTACACCGCAACC and reverse:
59-AATGGATTGCCTACTGCTGACT) was designed for Ping in
the region before the first ORF, at positions 327–1513 ; within this
region no sequence similarity exists between Ping and Pong based
on pairwise sequence comparison. Thus, with this pair of primers
a Ping-specific fragment was amplified. The reverse transcriptase
(RT) regions of the three potentially active copia-like retrotranspons,
Tos10, Tos17, and Tos19 (Hirochika et al., 1996) were also obtained
by PCR amplifications using gene-specific primers. Authenticity of
all PCR products (mPing, Pong-ORF2, Ping-specific, and the three
retrotransposons) was verified by sequencing. The probe-fragments
were gel-purified and labelled with fluorescein-11-dUTP by the
Gene Images random prime-labelling module (Amersham Pharmacia
Biotech). Hybridization signal was detected by the Gene Images
CDP-Star detection module (Amersham Pharmacia Biotech) after
washing at a stringency of 0.23 SSC, 0.1% SDS for 2350 min. The
filters were exposed to X-ray films.
Isolation of de novo mPing insertion sites in progenies of
pressurized plants by transposon display
Transposon display (Van den Broeck et al., 1998; Casa et al., 2000)
was performed by either combining the mPing subterminal-specific
primers (Jiang et al., 2003) with a set of inter-simple sequence
repeat or ISSR primers (available upon request) and visualizing
the amplicons on 4% agarose gels by ethidium bromide staining
2316 Lin et al.
(Schulman et al., 2004; Shan et al., 2005), or by the protocol exactly
as reported by Jiang et al. (2003) except using silver-staining for band
visualization, as in the AFLP analysis (see below). Novel bands
that appeared in progenies of pressurized plants in the mPingISSR amplifications but were absent in the corresponding ISSRalone amplifications, were considered as putative mPing de novo
insertions and isolated for sequencing. The insertions were then confirmed by PCR amplifications using mPing-flanking primers, as
described above for the excision analysis.
Amplified fragment length polymorphism (AFLP) analysis
The standard AFLP technique employing EcoRI and MseI enzymes
was used (Vos et al., 1995), and the experimental conditions are
exactly as described (Wang et al., 2005).
Results and discussion
4000 germinating seeds were pressurized for each of two
established japonica rice cultivars, JL307 and JL01-124,
under the conditions specified (see Materials and methods).
More than 90% of the 4000 treated seeds of each cultivar
produced normal-looking adult rice plants in the field, and
no difference was observed between the two pressurization conditions. At the time of maturity, four plants in each
cultivar (designated as #1 to #4 for cultivars JL307 and
JL01-124, respectively) were selected out because they
showed apparent phenotypic novelty compared with their
respective control plants. The changed traits included spike
morphology (varied number and distribution of spikelets
per spike), kernel shape (ratio of length to width) and
fertility (X Lin, unpublished data). Such morphologically
aberrant plants were not observed in the two cultivars over
years of field tests and cultivation. To test for possible
mPing mobility in these eight (four of each cultivar)
phenotypically changed individuals, genomic DNA was
isolated from flag-leaves of the plants and from seedlings
of >1200 randomly chosen seeds of the control plants (in
128 pools, each containing 10 or 11 individual seedlings)
for each cultivar, and the samples were subjected to PCRbased locus analysis for possible mPing excisions. Of the
25 and 11 mPing-containing loci analysed, respectively, for
cultivar JL307 and JL01-124 (see supplementary Tables 1
and 2 at JXB online), 12 and two loci showed evidence for
possible element excision in one or more of the pressurized
plants, being reflected by simultaneous amplification of
both an upper and a lower band from a given sample, with
the size difference between the two bands being consistent
with deletion of an mPing copy (Fig. 1a, and data not
shown). This indicates that somatic cells of flag leaves from
the pressurized, phenotypically novel rice plants contained
heterogeneous cells with regard to the presence or absence
of members of mPing at specific loci. In contrast to
pressurized plants, all the >1200 control seedlings randomly collected from each cultivar showed singular upper
bands at all 36 loci analysed (25 and 11, respectively, for
cultivar JL307 and JL01-124) (see supplementary Fig. 1 at
JXB online, and data not shown). This strongly suggests
that potential allelic heterozygosity at these mPingcontaining loci within a cultivar was not a contributory
factor to the appearance of the lower bands in the pressurized plants (Fig. 1a). The second potential possibility is that
the selected phenotypically novel plants happened to be
plants, or descendants thereof, of either mechanically (other
rice cultivars) or biologically (pollination by other rice
cultivars) contaminated seeds. To address this concern, the
eight selected plants of both cultivars were subjected to
locus-specific PCR analysis at all the rest (28 and 42,
respectively, for JL307 and JL01-124) of the 53 loci, each
of these loci does not contain an mPing in either of the two
cultivars. Consequently, exactly identical amplification
patterns were found at all the loci analysed, which either
produced a small-sized band coinciding with lack of an
mPing for most of the loci, or no amplification product for
several other loci, probably due to divergence at the primers
designed according to the Nipponbare genomic sequence
(data not shown). Because each japonica rice cultivar has
distinct mPing-containing loci (Jiang et al., 2004; X Lin,
unpublished data), the above analysis thus confidently
ruled out contamination (mechanical or biological) as
a cause for the appearance of novel, small-sized bands in
the pressurized plants relative to the control plants in both
cultivars. This result also indicated that, in the pressurized
Fig. 1. Examples of mPing excision in flag-leaf somatic cells of pressurized rice plants (P0 generation) from two distinct cultivars, JL307 and JL01-124,
as revealed by PCR amplification with locus-specific primers: (a) locus mpL7 for JL307 and (b) locus mpL10 for JL01-124). Sizes of the lower bands
coincide with deletion of a full-length mPing copy at each locus, as confirmed by sequencing. The PCR products were visualized by ethidium bromidestained agarose-gels. M is the 100 bp molecular size marker (the Fermentas Biol., Maryland). Similar results were obtained at several other mPingcontaining loci.
In planta transposable element mobilization
plants, the reinsertion of mobilized mPing did not occur
within the loci analysed; this is as expected given the
genome-wide insertion propensity of mPing except for
a strong preference towards single-copy, non-coding or
genic regions (Jiang et al., 2003, 2004). A final concern is
that some unknown elicitors may have caused mobility of
mPing in the selected plants. Nonetheless, the fact that both
the pressurized and the control plants were grown together
under the same normal field conditions, and, furthermore,
the >1200 tested control seedlings in each cultivar did not
show even a single excision event (see supplementary
Fig. 1 at JXB online, and data not shown), render this possibility extremely remote.
To validate the mobilization of mPing and possibly also
of its putative transposase-donors, Pong and Ping (Jiang
et al., 2003, 2004; Kikuchi et al., 2003; Nakazaki et al.,
2003), as well as to test if the somatic cells wherein mPing
mobilization occurred would have formed gametes or germ
line, one plant from each cultivar (#1 for cultivar JL307,
designated as JL307P#1, and #3 for cultivar JL01-124,
designated as JL01-124#3), was selected to produce selfed
progenies (designated as P1 plants). These two P0 plants
were chosen because they showed the most mPing
excisions based on the locus analysis. Eight and 14 P1
plants, respectively, derived from JL307P#1 and JL01124#3 were used for Southern blot analysis, together with
their respective P0 and untreated parental lines, by using the
full-length mPing and fragments of Pong and Ping as
probes (see Materials and methods). It was found that
loss of parental bands and (or) the appearance of novel
bands occurred in either or both of the mPing and Pong
hybridization profiles in P0 and all eight P1 plants of
JL307P#1, and in P0 and five of the 14 P1 plants in JL01124#3 (Fig. 2a, b, d, e), whereas the hybridization patterns
of Ping remained constant in the pressurized plants studied
of both cultivars (Fig. 2c, f). This latter result suggested that
although Ping existed in these two rice cultivars, it was
stable under the high pressurization conditions, at least in
the plants studied, and hence, probably did not contribute to
the mobilization of mPing in these plants. Nevertheless, the
possibility can not be ruled out that Ping may have been
transcriptionally activated, and hence, provided some of the
TPase, which had facilitated mPing mobility (Jiang et al.,
2003). On the other hand, the loss and gain of hybridizing
bands in the Southern blotting patterns of mPing and Pong
is consistent with the ‘cut-and-paste’ model of mobilization
of mPing and Pong (Feschotte et al., 2002; Casacuberta and
Santiago, 2003; Jiang et al., 2004). The variable Southern
blotting patterns of mPing in the pressurized plants were
also fully supported by the well-established mPing-specific
transposon-display analysis (Jiang et al., 2003), where loss
and gain of mPing-anchored amplicons was easily recognized (see supplementary Fig. 2 at JXB online). Taken
together, these data not only implicated concomitant
mobilization of mPing and Pong in somatic cells of
2317
pressurized plants but also pointed to meiotic inheritance
of insertions to the next generation, i.e. the affected somatic
cells had given rise to gametal cells. Further, because the
analysed P1 progenies were derived from single P0 parental
individuals, but they produced apparent different banding
patterns in both mPing and Pong hybridization profiles
(Fig. 2), it is likely that each P0 gamete had harboured more
than one transposition event and different gametes contained different transpositions, a property required for
efficient tagging (Bessereau et al., 2001; Klinakis et al.,
2000; Kumar et al., 2003; Hirochika et al., 2004). To test if
parental heterozygosity might have been a contributory
factor to the observed variable hybridization patterns of
mPing and Pong in P0 as well as among P1 progenies of
pressurized plants (Fig. 2), eight randomly chosen, untreated control plants for each cultivar were analysed by the
same Southern blotting, and identical banding patterns
appeared for all eight plants in each cultivar for both mPing
and Pong (Fig. 3). This is consistent with the results of
the PCR-based locus-assay at both the P0 generation (see
supplementary Fig. 1 at JXB online, and data not shown)
and P1 generation (see below). Collectively, complete
stability of mPing in control plants for each cultivar was
evident, and hence, strongly suggests that within-cultivar
heterozygosity was not a cause for the observed variation
in mPing and Pong in the pressurized plants and their
progenies (Figs 1, 2, and see below).
To analyse the P1 plants that showed variable Southern
blot patterns for mPing and Pong (Fig. 2) further, a PCRbased locus assay was performed at all identified 36 mPingbracketing loci (25 and 11, respectively, for JL307 and
JL01-104) and two Pong-bracketing loci (one and one,
respectively, for JL307 and JL01-104) (see supplementary
Table 1 at JXB online). It was found that 18 and three
mPing-bracketing loci, respectively, for JL307 and JL01124 produced a lower-band in one or more of the studied P1
plants (Fig. 4a, b; data not shown). Notably, in some plants
only a lower-band was amplified (Fig. 4a, b), indicating
homozygosity of the plants at the loci. In other words, both
the paternal and maternal gametes forming the given zygote
must have had mPing at the specific loci excised. Of the
Pong-bracketing loci analysed, one in each cultivar (PonL5
in LJ307 and PonL4 in JL01-124) also showed clear
evidence for excision (Fig. 4c, d). Moreover, due to nature
of the Pong-bracketing locus-assay (using a Pong-internal
primer in combination with a flanking primer, see Materials
and methods), only homozygous Pong-devoid loci can be
identified. Therefore, as in the case of mPing, many of the
P1 plants were actually homozygous for Pong excisions
(Fig. 4c, d). To test for possible heterozygosity at the
assayed loci (mPing or Pong-containing) in control plants,
123 randomly chosen individuals (in 41 pools) for each
cultivar were analysed, and at all loci a monomorphic
pattern denoting the absence of an mPing or Pong was
observed (Fig. 4e, f, g, h; data not shown). This analysis
2318 Lin et al.
Fig. 2. Possible transposition of mPing, Pong, and Ping as revealed by Southern blot analysis. (a) Hybridization of mPing to blots containing HindIIIdigested genomic DNA of a control plant and eight P1 plants derived from a single pressurized P0 plant of cultivar JL307 (designated as JL307P#1).
mPing (AB087615.1) does not contain a HindIII restriction site, and hence, the changing hybridization patterns most likely reflect the presence or
absence of intact element members at the particular loci, rather than internal structural changes. Loss of original bands and the appearance of novel bands
in the pressurized progenies are, respectively, marked by empty and filled triangles. The P0 plant and all eight P1 plants (marked by asterisks above each
lane) derived from it showed changing patterns relative to the untreated control plant. (b) Hybridization of a Pong fragment in the ORF2 region to the
same blots as in (a). Pong (BK000586.1) contains two HindIII restriction sites (at positions 316 and 1147), both being upstream of the ORF2, thus the
probe enables detection of element copy number changes. Loss of original bands and appearance of novel bands in the pressurized progenies are,
respectively, marked by empty and filled triangles. The P0 plant and all eight plants (marked by asterisks) showed changing patterns relative to the
untreated control plant. (c) Hybridization of a Ping-specific fragment in the region before the first ORF of Ping, where there exits no similarity between
Ping and Pong, to a blot carrying XbaI-digested DNA of the same plants as in (a) and (b). Ping (AB087616.1) does not contain XbaI restriction sites
according to the Nipponbare sequence, and hence, the hybridization enables the detection of possible changes in element copy number. Complete
stability of Ping was revealed in the pressurized plants studied relative to the untreated control plant in this rice cultivar. (d) Hybridization of mPing to
a blot containing HindIII-digested genomic DNA of a control plant and 14 P1 progeny-plants derived from a single pressurized P0 plant of cultivar JL01124 (designated as JL01-124P#3). The rationale of the analysis is the same as in (a). The P0 and four of the P1 plants (marked by asterisks) showed
changing patterns compared with that of the control plant. (e) Hybridization of a Pong fragment in the ORF2 region to the same blot as in (d). The
rationale of the analysis is the same as in (b). The P0 and five of the P1 plants (marked by asterisks) showed changing patterns compared with that of
the control plant, and four out of the five P1 plants also showed changing patterns of mPing (d). (f) Hybridization of a Ping-specific fragment in the
region before the first ORF of Ping, where there exits no similarity between Ping and Pong, to a blot carrying XbaI-digested DNA of the same plants as
(d) and (e). The rationale of the analysis is the same as in (c). Complete stability of Ping was revealed in the pressurized studied plants relative to the
untreated control plant in this rice cultivar.
thus testified again that the observed mPing/Pong excisions in the pressured P1 plants were not due to original
heterozygosity, and the presence of homologous mPing- or
Pong-devoid loci was resultant from concomitant element
excision at the specific loci in both male and female
gametes.
It has been shown that MITEs often, but not always,
excise imprecisely, i.e. leave various excision footprints
In planta transposable element mobilization
Fig. 3. Immobility of mPing and Pong in control plants of both cultivars
as revealed by Southern blot analysis. (a) Hybridization of mPing to a blot
containing HindIII-digested genomic DNA of eight randomly chosen
control plants of cultivar JL307. (b) Hybridization of a Pong fragment in
the ORF2 region to the same blot as in (a). (c, d) The same analysis for
cultivar JL01-124. For a rationale of this Southern blot analysis see Fig. 2.
(Kikuchi et al., 2003; Nakazaki et al., 2003; Shan et al.,
2005). To test if the excision of mPing and Pong induced by
hydrostatic pressure would leave footprints or not, a set of
lower bands together with their corresponding upper ones
from the P1 plants of both cultivars was isolated. It was
found that of the 21 mPing excisions sequenced (18 and
three, respectively, for JL307 and JL01-124), only one
(mPL46 of JL307) left footprints (with a stretch of 14 extranucleotides at the excision site), whereas the rest (20) had
excised precisely (see supplementary Table 2 at JXB
online). Of the two Pong excisions sequenced, one
(PonL4 of JL01-124) had left footprint (with three nucleotides in front of the target site duplication, TAA, being
deleted) and the other had not (see supplementary Table 2 at
JXB online). This suggests that for the hydrostatic pressurization-mobilized mPing/Pong to leave an excision footprint or not is probably dependent on both the host
genotype and genomic positions of the elements, or is
simply stochastic.
A hint for mPing and Pong de novo insertions was
implicated by the appearance of novel bands in the two
pressurized P0 plants and their P1 progenies of both
2319
cultivars in Southern blot analysis (Fig. 2). To verify this,
a modified version (Shan et al., 2005) of the transposondisplay technique (Van den Broeck et al., 1998; Casa et al.,
2000), namely combining mPing or Pong subterminalspecific primers with one of a set of inter-simple sequence
repeat (ISSR) primers, was used to visualize and isolate
several novel bands present in P1 progenies of the
hydrostatic pressurized plants relative to their control
plants. Sequence analysis on the isolated fragments enabled
identification of respectively eight and five clones containing, at their 59 end, the stretch of nucleotides of mPing or
Pong (Table 1). The contiguous upstream sequences
putatively flanking complete members of mPing at these
loci were deduced from the public genome sequence for
japonica rice, cv. Nipponbare (http://rgp.dna.affrc.go.jp),
and hence, enabled the design of locus-specific primers (see
Materials and methods). PCR amplification using these
putative mPing-containing primers in untreated control
plants produced only lower bands of the sizes expected
for the absence of mPing at all the identified loci, whereas
the upper bands of sizes expected to contain a member of
mPing or Pong, either alone or together with a lower band,
were amplified from some P1 progenies of the pressurized
P0 plants (Fig. 5a, b; data not shown). Upon cloning and
sequencing the full-length (mPing-containing) of the isolated upper bands, it was found that all products indeed
contained the complete TIRs (GGCCAGTCACAATGG)
and the TSDs (TAA or TTA) characteristic of newly
transposed mPing (Jiang et al., 2003; Kikuchi et al.,
2003; Nakazaki et al., 2003). Thus, little doubt remains
that the isolated mPing-containing loci represent bona fide
de novo insertions of the elements present only in P1
progenies of the hydrostatically pressurized P0 plants.
Allelic heterozygosity in untreated control plants of both
cultivars was again not found in any of these loci, as shown
by the amplification of a singular lower band donating the
absence of an mPing member at each of the loci in 63
analysed random individual plants (in 21 pools) for each
cultivar (Fig. 5c, d; and data not shown).
For efficient gene-tagging by a specific transposon, it is
important that the host genome is not simultaneously
undergoing large-scale random rearrangements or being
mutagenized by other transposons or retrotransposons as
well. To address this issue, the general genomic composition of the pressurized plants relative to that of the control
plants was investigated first by the amplified fragment
length polymorphism (AFLP) technique (Vos et al., 1995;
Wang et al., 2005). Of the total of 396 and 402 clear bands
scored, that were generated by 20 EcoRI+MseI primer
combinations (each generating from 15 to 25 clear bands in
the middle-part of the gels), and that were completely
reproducible between the two duplicates for each sample
(starting from restriction and ligation, i.e. the first step
of AFLP), respectively, for the two cultivars, JL307 and
JL01-124, none showed evidence of genomic change in the
2320 Lin et al.
Fig. 4. Examples of PCR-based locus assay for mPing [loci mpL27 (a), mpL41 (b)], and Pong [loci ponL5 (c), ponL4 (d)] excisions in flag-leaf somatic
cells of P1 (selfed progenies of a single pressurized P0 plant) individuals of the two cultivars, which showed variable mPing and Pong patterns in
Southern blot analysis (Fig. 2). In (a) and (b), sizes of the lower bands coincide with deletion of a full-length mPing copy at each locus (determined by
sequencing). In (c) and (d), the presence of the expected bands (238 bp for locus ponL5, 248 bp for locus ponL4; determined by sequencing) was resulted
from amplifications by using a Pong-internal primer (59-TGCATTGGAAACGCTAGAGTG, at positions of 5032 to 5052) together with a locus-specific
primer located in the 39 flanking region for each Pong-containing locus (see supplementary Table 2 at JXB online). Thus, absence of the bands in some
of the P1 plants denotes excision of Pong at the specific loci. The asterisk refers to a non-specific band. Stability of mPing and Pong and lack of
heterozygosity at the analysed loci in untreated control plants of both cultivars were revealed by the same analysis on 123 randomly chosen plants
(in 41 pools, each containing three plants). The PCR products were visualized by ethidium bromide-stained agarose-gels. Identical results were obtained
for all analysed mPing- or Pong-containing loci. M is the 100 bp molecular size marker (the Fermentas Biol., Maryland).
pressurized plants as compared with their controls (Fig. 6;
and data not shown). Although this analysis can not rule out
the occurrence of random genomic rearrangements, it
clearly suggests that high pressurization has not induced
a general genomic instability in the two rice cultivars. Next,
Southern blots containing the same pressurized P1 plants of
the two cultivars were probed with three copia-like
retrotransposons, Tos10, Tos17, and Tos19, known to be
active under stress conditions like tissue culture (Hirochika
et al., 1996). Consequently, it was found that only Tos17
showed one possible retrotransposition event in a single
P1 plant of cultivar JL01-124, whereas Tos10 and Tos19
remained stable in all plants studied of both cultivars (see
supplementary Fig. 3 at JXB online, and data not shown).
Taken together, it appeared that the high pressurization
treatment specifically elicited activation of mPing and
Pong at least in the two rice cultivars studied. In this respect, hydrostatic pressurization might be advantageous
over some other treatments on intact plants, like ionizing
irradiation, which though induced efficient mPing mobilization (Nakazaki et al., 2003), is also known to generate
various genetic mutations and chromosomal aberrations.
For gene-tagging purpose, it is also important that the
element insertions are not only heritable but also stable in
the progenies (Bessereau et al., 2001; Klinakis et al., 2000;
Kumar et al., 2003; Hirochika et al., 2004). To test this, 30
randomly chosen P2 progenies of each of the P1 plants were
analysed by PCR amplification with several identified
mPing de novo insertions that were already homozygous
in the identified P1 plants (producing only an upper band).
No evidence was found for excision of these inserted mPing
copies in any of the P2 plants studied (data not shown).
An ideal property of mPing to be used for tagging is its
preference for unique or low-copy regions in the rice
genome (Jiang et al., 2003, 2004). It was found that the
hydrostatic pressure-mobilized mPing members also
showed this targeting propensity for single or low-copy
genomic regions, as all 11 de novo insertions isolated
mapped to low-copy, genic or non-coding regions involving different chromosomes (Table 1).
Given the dramatic genotypic difference in rice with
regard to the activity of mPing under a specific stress
condition (Jiang et al., 2003; Kikuchi et al., 2003;
Nakazaki et al., 2003; Shan et al., 2005), it is probably
premature to extrapolate the present results to other rice
cultivars. Nonetheless, preliminary data indicated that one
of the hydrostatic pressurization conditions reported here
(80 MPa, 20 min) also caused mPing activation in the
In planta transposable element mobilization
2321
Fig. 5. Examples of mPing de novo insertions, at two loci [mpISL36 (a) and mpISL44 (b)], in flag-leaf somatic cells of P1 (selfed progenies of a single
pressurized P0 plant) individuals of the two cultivars, which showed variable mPing patterns in Southern blot analysis (Fig. 2a, d). The loci upon which
specific primers being designed were identified by a modified transposon-display method (see Materials and methods). The novel upper bands appeared
in several P1 plants, and the size differences between the upper and lower bands (determined by sequencing) coincide with insertion of a full-length
mPing copy at each locus. The asterisk refers to a non-specific band. Absence of heterozygosity at the two loci [mpISL36 (c) and mpISL44 (d)] in
untreated control plants of both cultivars was verified by the same analysis on 63 randomly chosen plants (in 21 pools, each with three plants).
Fig. 6. Examples of AFLP analysis showing the general genomic stability in the same eight and five P1 plants, respectively, of cultivars JL307 (a) and
JL01-124 (b), which showed marked mPing and Pong mobilization (Figs 2, 4, 5). The primer combinations in (a) and (b) are, respectively, EcoRI+AAC/
MseI+CTA, and EcoRI+AAG/MseI+CAC. Duplications starting from the restriction and ligation step, i.e. the first step of AFLP, were employed for
each sample. In total, 20 primer combinations were used for each cultivar, and no genomic change was detected among the 798 assayed loci
(both cultivars).
japonica rice standard laboratory cultivar Nipponbare (Fig.
7). Specifically, of the 23 randomly selected P0 individual
plants germinated from pressure-treated Nipponbare seeds,
four showed apparent new mPing insertions, although both
Ping and Pong remained stationary (Fig. 7). One possible
explanation for this observation is that there might have
been transcriptional activation of either or both of the
TPase-donors (Ping and Pong), which although catalysed
2322 Lin et al.
for most efficient mPing and Pong mobilization in various
rice lines.
Supplementary material
Detailed information regarding the following contents is
available at the Journal of Experimental Botany website,
http:// jxb.oxfordjournals.org/ (i) 53 pairs of the mPingand Pong-harbouring, locus-specific primers; (ii) characteristics of mPing and Pong excisions in P1 progenies of
pressurized rice plants; (iii) stability of mPing in untreated
control plants; (iv) examples of mPing-specific transposon
display; and (v) near complete immobility of the copia-like
LTR retrotransposon Tos17 in the pressurized rice plants.
Acknowledgements
Fig. 7. Southern blot hybridization of mPing (a), Pong-ORF2 (b), and
Ping-specific (c) to 23 randomly selected pressurized P0 plants and an
untreated control plant of the standard japonica rice cultivar Nipponbare.
Genomic DNA was digested with HindIII, whose restriction site is absent
in mPing. Possible de novo mPing insertions in four plants (marked by
asterisks) were indicated by filled triangles. In contrast to mPing, no
changes were detected in Pong or Ping.
occasional mPing transposition, was nonetheless insufficient to catalyse their own movement, probably due to the
larger sizes of Ping and Pong (Jiang et al., 2004). In
contrast to mPing activity in pressurized plants, no change
in the mPing pattern was detected in 24 randomly chosen
Nipponbare plants (data not shown). Because the 23
pressurized plants were randomly chosen, this experiment
allows an estimation on frequency of mPing mobilization;
that is, at least 4/23 (or 17%) pressure-treated plants
showed mPing mobilization in this rice genotype. It is
thus reasonable to believe that by optimizing the relevant
parameters, hydrostatic pressurization can probably induce
activity of mPing in many rice cultivars. Although gamma
irradiation also efficiently induced mobilization of mPing in
a japonica rice cultivar, Gimbozu (Nakazaki et al., 2003), it
remains to be tested for other rice cultivars.
To conclude, an easily applicable method has been
established for mobilization of the rice endogenous MITE
mPing, and one of its autonomous elements, Pong, in intact
plants. This method may prove to be a useful alternative to
the currently used tagging system in rice based on the
activation of an endogenenous copia-like retrotransposon
Tos17 by tissue culture (Hirochika et al., 1996, 2004).
These data have also provided additional evidence in
support of the proposition that mPing and Pong, although
cryptic under normal conditions, can be mobilized by
various stresses (Jiang et al., 2004). Future studies are
required to elaborate further the pressurization conditions
This study was supported by the Program for Changjiang Scholars
and Innovative Research Team (PCSIRT) in University, the National
Natural Science Foundation of China (30430060, 30225003), and
the State Key Basic Research and Development Plan of China
(2005CB120805). We are grateful to two anonymous reviewers for
their critical and constructive comments to improve the manuscript.
References
Bender J. 2004. Chromatin-based silencing mechanisms. Current
Opinion in Plant Biology 7, 521–526.
Bessereau JL, Wright A, Williams DC, Schuske K, Davis MW,
Jorgensen EM. 2001. Mobilization of a Drosophila transposon in
the Caenorhabditis elegans germ line. Nature 413, 70–74.
Capy P, Chakrani F, Lemeunier F, Hartl DL, David JR. 1990.
Active mariner transposable elements are widespread in natural
populations of Drosophila simulans. Proceedings: Biological
Sciences 242, 57–60.
Capy P, Gasperi G, Biemont C, Bazin C. 2000. Stress and
transposable elements: co-evolution or useful parasites. Heredity
85, 101–106.
Casa AM, Brouwer C, Nagel A, Wang L, Zhang Q, Kresovich S,
Wessler SR. 2000. The MITE family heartbreaker (Hbr): molecular markers in maize. Proceedings of the National Academy of
Sciences, USA 97, 10083–10089.
Casacuberta JM, Santiago N. 2003. Plant LTR-retrotransposons
and MITEs: control of transposition and impact on the evolution of
plant genes and genomes. Gene 311, 1–11.
Fernandesa PB, Domitrovicb T, Kaoc CM, Kurtenbachb E.
2004. Genomic expression pattern in Saccharomyces cerevisiae
cells in response to high hydrostatic pressure. FEBS Letters
556, 153–160.
Feschotte C, Jiang N, Wessler SR. 2002. Plant transposable
elements: where genetics meets genomics. Nature Reviews
Genetics 3, 329–341.
Grandibastien MA. 1998. Activation of plant retrotransposons
under stress conditions. Trends in Plant Science 3, 181–187.
Hirochika H, Guiderdoni E, An G, et al. 2004. Rice mutant resources for gene discovery. Plant Molecular Biology 54, 325–334.
Hirochika H, Sugimoto K, Otsuki Y, Tsugawa H, Kanda M.
1996. Retrotransposons of rice involved in mutations induced by
tissue culture. Proceedings of the National Academy of Sciences,
USA 93, 7783–7788.
In planta transposable element mobilization
Hirochika H. 2001. Contribution of the Tos17 retrotransposon to
rice functional genomics. Current Opinion in Plant Biology 4,
118–122.
Jiang N, Bao Z, Zhang X, Hirochika H, Eddy SR, McCouch SR,
Wessler SR. 2003. An active DNA transposon family in rice.
Nature 421, 163–167.
Jiang N, Feschotte C, Zhang X, Wessler SR. 2004. Using rice to
understand the origin and amplification of miniature inverted
repeat transposable elements (MITEs). Current Opinion in Plant
Biology 7, 115–119.
Kaarniranta K, Elo M, Sironen R, Lammi MJ, Goldring MB,
Eriksson JE, Sistonen L, Helminen HJ. 1998. Hsp70 accumulation in chondrocytic cells exposed to high continuous hydrostatic
pressure coincides with mRNA stabilization rather than transcriptional activation. Proceedings of the National Academy of
Sciences, USA 95, 2319–2324.
Kikuchi K, Terauchi K, Wada M, Hirano HY. 2003. The
plant MITE mPing is mobilized in anther culture. Nature 421,
167–170.
Klinakis AG, Zagoraiou L, Vassilatis DK, Savakis C. 2000.
Genome-wide insertional mutagenesis in human cells by the
Drosophila mobile element Minos. EMBO Reports 1, 416–421.
Kumar A, Hirochika H. 2001. Applications of retrotransposons as
genetic tools in plant biology. Trends in Plant Science 6, 127–134.
Kumar S, Fladung M. 2003. Somatic mobility of the maize element
Ac and its utility for gene tagging in aspen. Plant Molecular
Biology 51, 643–650.
Kurusu T, Sakurai Y, Miyao A, Hirochika H, Kuchitsu K. 2004.
Identification of a putative voltage-gated Ca2+ -permeable channel
(OsTPC1) involved in Ca2+ influx and regulation of growth and
development in rice. Plant and Cell Physiology 45, 693–702.
Labrador M, Fontdevila A. 1994. High transposition rates of
Osvaldo, a new Drosophila buzzatii retrotransposon. Molecular
and General Genetics 245, 661–674.
Lippman Z, May B, Yordan C, Singer T, Martienssen R. 2003.
Distinct mechanisms determine transposon inheritance and methylation via small interfering RNA and histone modification. PLoS
Biology 1, E67.
Long L, Lin X, Zhai J, Kou H, Yang W, Liu B. 2006. Heritable
alteration in DNA methylation pattern occurred specifically at
mobile elements in rice plants following hydrostatic pressurization.
Biochemical and Biophysical Research Communications 340,
369–376.
Ma J, Bennetzen JL. 2004. Rapid recent growth and divergence of
rice nuclear genomes. Proceedings of the National Academy of
Sciences, USA 101, 12404–12410.
Miura A, Yonebayashi S, Watanabe K, Toyama T, Shimada H,
Kakutani T. 2001. Mobilization of transposons by a mutation
abolishing full DNA methylation in Arabidopsis. Nature 411,
212–214.
Miyao A, Tanaka K, Murata K, Sawaki H, Takeda S, Abe K,
Shinozuka Y, Onosato K, Hirochika H. 2003. Target site
specificity of the Tos17 retrotransposon shows a preference for
insertion within genes and against insertion in retrotransposon-rich
regions of the genome. The Plant Cell 15, 1771–1780.
2323
Nakazaki T, Okumoto Y, Horibata A, Yamahira S, Teraishi M,
Nishida H, Inoue H, Tanisaka T. 2003. Mobilization of a transposon in the rice genome. Nature 421, 170–172.
Okamoto H, Hirochika H. 2001. Silencing of transposable elements
in plants. Trends in Plant Science 6, 527–534.
Ros F, Kunze R. 2001. Regulation of activator/dissociation transposition by replication and DNA methylation. Genetics 157,
1723–1733.
Schulman AH, Flavell AJ, Ellis TH. 2004. The application of LTR
retrotransposons as molecular markers in plants. Methods in
Molecular Biology 260, 145–173.
Second G. 1982. Origin of the gene diversity of cultivated rice
(Oryza sativa L.): study of the polymorphism scored at 40
isoenzyme loci. Japanese Journal of Genetics 57, 25–57.
Shan XH, Liu ZL, Dong ZY, Wang YM, Chen Y, Lin XY, Long
LK, Han FP, Dong YS, Liu B. 2005. Mobilization of the active
mite transposons mPing and Pong in rice by introgression from
wild rice (Zizania latifolia Griseb.). Molecular Biology and
Evolution 22, 976–990.
Singer T, Yordan C, Martienssen RA. 2001. Robertson’s, mutator
transposons in A. thaliana are regulated by the chromatinremodeling gene decrease in DNA methylation (DDM1). Genes
and Development 15, 591–602.
Sironen RK, Karjalainen HM, Elo MA, Kaarniranta K,
Torronen K, Takigawa M, Helminen HJ, Lammi MJ. 2002.
cDNA array reveals mechanosensitive genes in chondrocytic cells
under hydrostatic pressure. Biochimica et Biophysic Acta 1591,
45–54.
Symington AL, Zimmerman S, Stein J, Stein GA, Zimmerman
M. 1991. Hydrostatic pressure influences histone mRNA. Journal
of Cell Science 98, 123–129.
Van den Broeck D, Maes T, Sauer MJZ, De Keukeleire P,
D’Hauw M, Van Montagu M, Gerats T. 1998. Transposon
Display identifies individual transposable elements in high copy
number lines. The Plant Journal 13, 121–129.
Vos P, Hogers R, Bleeker M, et al. 1995. AFLP: a new technique
for DNA fingerprinting. Nucleic Acids Research 23, 4407–4414.
Wang YM, Dong ZY, Zhang ZJ, Lin XY, Shen Y, Zhou D, Liu B.
2005. Extensive de novo genomic variation in rice induced by
introgression from wild rice (Zizania latifolia Griseb.). Genetics
170, 1945–1956.
Wessler SR. 1996. Plant retrotransposons: turned on by stress.
Current Biology 6, 959–961.
Wilson Jr RG, Zimmerman S, Zimmerman AM. 2001. The effects of hydrostatic pressure-induced changes on the cytoskeleton
and on the regulation of gene expression in pheochromocytoma
(PC-12) cells. Cell Biology International 25, 667–677.
Yang P, Agapova O, Parker A, Shannon W, Pecen P, Duncan J,
Salvador-Silva M, Hernandez MR. 2004. DNA microarray
analysis of gene expression in human optic nerve head astrocytes
in response to hydrostatic pressure. Physiological Genomics 17,
157–169.
Zhu QH, Ge S. 2005. Phylogenetic relationships among A-genome
species of the genus Oryza revealed by intron sequences of four
nuclear genes. The New Phytologist 167, 249–265.