• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
ANALYSIS OF MULTIPLE RESTRICTION FRAGMENT LENGTH
ANALYSIS OF MULTIPLE RESTRICTION FRAGMENT LENGTH

... fragments in the FF individuals; therefore, an allelic Sac I fragment could not be identified (Fig . 4) . Sac I also generated a CRI-1 +, CRI-4'}, 7 .9-kb restriction fragment that was present only in the DNA of the four FF donors and two FS donors who exhibited the CRI-1+, GBIR1+, 14 .5-kb Bam HI f ...
004 - cse.sc.edu
004 - cse.sc.edu

... This will set the owner to have read, write; add the permission for the group and the world to read ...
Complete
Complete

... as Brownian ratchets, structures that permit Brownian motion in only one direction [1–7]. When particles flow through such an array driven by an electric field (Fig. 2.1A), particles diffusing to the left (path 1; Fig. 2.1A) are blocked and deflected back to gap B, whereas those diffusing to the rig ...
Chromosomal breakpoint positions suggest a direct role for radiation
Chromosomal breakpoint positions suggest a direct role for radiation

... chromosomal regions with increased lability (fragile) sites (Ehrlich et al., 1993; Stary and Sarasin, 1992; Hyrien et al., 1987). By contrast, our results indicate that in post-Chernobyl tumors the RET/PTC breakpoints were distributed relatively randomly across the respective introns, except for clu ...
Induction of XIST expression from the human active
Induction of XIST expression from the human active

... restriction enzyme sites near the 5′ end of the gene (22). We used a PCR-based assay to examine methylation at a subset of these sites (Fig. 2). Primers AT-2 and 29r amplify DNA from the 5′ flanking region into the first exon of XIST generating a 555 bp product that spans methylation-sensitive restr ...
a method for detecting and typing of salmonella by multiplex pcr
a method for detecting and typing of salmonella by multiplex pcr

... AGCTGCCAGAGGTTACGCTG ...
Dynamic changes of yak (Bos grunniens) gut microbiota during
Dynamic changes of yak (Bos grunniens) gut microbiota during

... Statistical analysis The Statistical Analysis of Metagenomic Profiles (STAMP; version 2.0.2) statistical probability model ...
Isolation, Identification, and Enumeration of Pathogenic Salmonella
Isolation, Identification, and Enumeration of Pathogenic Salmonella

... The determination of allelic presence after the MPCR’s compete is by analyzing the amplicon banding patterns via PFGE. For the MPCR reactions, 2 uL of extracted gDNA is added to a PCR kit such as the QIAGEN Multiplex PCR Kit (Qiagen, Hilden, Germany) along with the appropriate primer set, all of wh ...
Generation and analysis of mutated clonal scFv Jiya George
Generation and analysis of mutated clonal scFv Jiya George

... subcloned into the pAK400 expression vector. The computer-based models, created using the Swiss PDB Deep Viewer 4.02 software, were used to predict the antigen-binding site and affinity analysis of both parent and mutated scFv’s. Mutated clone 1 failed to bind to the R7V epitope whereas mutated clon ...
Archives of Microbiology
Archives of Microbiology

... Mo-medium (Raina et al. 1992; Thiel et al. 2002b). Remarkably, V-nitrogenases evolve three times more molecular hydrogen and have a higher energy demand than the Mo-enzyme (Eady 2003). At present, the biological relevance of alternative nitrogenases for the organism and its habitat is unknown. Besid ...
Repeat-induced point mutation and the population
Repeat-induced point mutation and the population

... repetitive DNA and is suggested to limit the accumulation of transposable elements. The genome of Microbotryum violaceum has a high density of transposable elements compared to other fungi, but there is also evidence of RIP activity. This is the first report of RIP in a basidiomycete, and was obtain ...
Surveying Saccharomyces Genomes to Identify Functional Elements
Surveying Saccharomyces Genomes to Identify Functional Elements

... BLOSUM62 matrix. Several additional alignments could be generated using alternative matrices (such as PAM120) and altered GAP penalties, but essentially equal numbers of alignments were generated using less stringent matrices since these parameters often miss short alignments near the ends of the pr ...
1Department of Hematology, 2Department of Dermatology, Leiden
1Department of Hematology, 2Department of Dermatology, Leiden

... fluorescence activated cell sorting (FACS) and from these populations mRNA was isolated, cDNA synthesized, and expression of the 26 genes that comprise the GPI anchor biosynthesis pathway was analyzed by conventional PCR using specific primers and visualized by gel electrophoresis Two different B-AL ...
Databases_what_and_w..
Databases_what_and_w..

... TIFF ( Uncompressed) decompressor are needed to see thi s pi ctur e. QuickTime™ and a TIFF (Uncompressed) decompressor are needed to see this picture. ...
Author`s personal copy
Author`s personal copy

... and Har. hispanica would provide considerable insights into the PHA metabolism and its regulation in the domain Archaea. If a highly efficient method for mutant construction is developed, a genome-wide analysis of gene function is possible (Hammelmann and Soppa, 2008). It would not only accelerate t ...
DNA METHODS FOR HLA TYPING A WORKBOOK FOR - ASHI-U
DNA METHODS FOR HLA TYPING A WORKBOOK FOR - ASHI-U

Imprinting and Seed Development
Imprinting and Seed Development

... These include imprinting as a defense against chromosome loss or gain or as a means to accurately control gene expression (Hurst, 1997). Or, imprinting could be a by-product of maintaining chromatin structural differences between homologous chromosomal regions, which could be important for some cell ...


... Choice A: Ligand binding data is obtained for a nucleic acid binding protein using equilibrium dialysis. The concentration of the protein inside the dialysis bag is 1 μM ([MT]). The concentration of nucleic acid bound to the protein ([ML]), in μM, was measured and the data are shown in the table bel ...
Natiiona Str An l D ate nua 20 NA gy l R 15/ A Da Boa epo /16 tab rd
Natiiona Str An l D ate nua 20 NA gy l R 15/ A Da Boa epo /16 tab rd

... crime. The number of matches made between profile records uploaded onto the database against those already on it rose slightly from last year’s figure of 63.2% to 63.3%; this is the highest it has been since records began. In 2015/16, NDNAD provided 31,173 routine matches including to 390 homicides ...
Epigenetics & Chromatin Xist through transcriptional control of Dnmt3a
Epigenetics & Chromatin Xist through transcriptional control of Dnmt3a

... cells we anticipated that sense transcription would not be detectable but that antisense Tsix transcription would be unaltered. However, analysis by strand specific polymerase chain reaction (PCR) revealed unexpectedly that the mutant allele transcribes both sense and antisense RNAs and moreover tha ...
Mutation Analysis of the Ornithine Transcarbamylase (OTC) Gene in
Mutation Analysis of the Ornithine Transcarbamylase (OTC) Gene in

Erp, an extracellular protein family specific to
Erp, an extracellular protein family specific to

... paratuberculosis (http :\\www.cbc.umn.edu\cgi-bin\ blasts\AGAC.restrict\blastn.cgi) were released, showing the erp gene to be present in both species, thereby confirming and extending our data. It is thus very likely that erp is common to all members of the genus Mycobacterium. Conservation of the e ...
$doc.title

... Urediospores that make contact with plant leaves initiate the fu ngal infection of the host plant. The urediospores carry a limited supply of triglyserides that function as a metabolic energy source for the formation of urediospore germ tubes (Bushnell & Roelfs, 1984). The germ tubes grow laterally ...
Gene Detection Systems Catalog
Gene Detection Systems Catalog

... helping them achieve success is a priority at Gene Link. These customers are located worldwide. Gene Link is a leading supplier of custom oligonucleotides for use in PCR, sequencing, cloning, and mutagenesis. Gene Link services include genotyping, sequencing and gene construction. Gene Link offers a ...
Bruce Wallace Biotechnology Lab Program Student Guide 5th
Bruce Wallace Biotechnology Lab Program Student Guide 5th

... 1b. What evidence allowed you to arrive at this conclusion? 2a. Molecular size can play a role in separation with small molecules moving through the gel matrix more rapidly than larger molecules. The formula (or molecular) weights for these dyes are Orange G (452.38), Bromophenol blue (669.98) and ...
< 1 ... 10 11 12 13 14 15 16 17 18 ... 353 >

Bisulfite sequencing



Bisulphite sequencing (also known as bisulfite sequencing) is the use of bisulphite treatment of DNA to determine its pattern of methylation. DNA methylation was the first discovered epigenetic mark, and remains the most studied. In animals it predominantly involves the addition of a methyl group to the carbon-5 position of cytosine residues of the dinucleotide CpG, and is implicated in repression of transcriptional activity.Treatment of DNA with bisulphite converts cytosine residues to uracil, but leaves 5-methylcytosine residues unaffected. Thus, bisulphite treatment introduces specific changes in the DNA sequence that depend on the methylation status of individual cytosine residues, yielding single- nucleotide resolution information about the methylation status of a segment of DNA. Various analyses can be performed on the altered sequence to retrieve this information. The objective of this analysis is therefore reduced to differentiating between single nucleotide polymorphisms (cytosines and thymidine) resulting from bisulphite conversion (Figure 1).
  • studyres.com © 2026
  • DMCA
  • Privacy
  • Terms
  • Report