Download Chapter 1-The Chemical Nature of Cells

Chapter 1-The Chemical Nature of Cells
The chemical nature of biomolecules
Atoms
All substances, whether solid, liquid or gas are composed of particles called atoms. At the centre of an
atom is a nucleus containing two main types of particle: positively charged protons, and neutrons
which have no charge. Negatively charged electrons spin around the nucleus in regions of space known
as atomic orbitals (see Figure). In an uncharged atom the total number of electrons is equal to the
number of protons in the nucleus.
Elements are the (ingredients' from which all substances are
111 elements, each consisting of atoms with a unique number of
nucleus. This is known as the atomic number of the element,
the Periodic Table of the elements. For example, all carbon
protons in their nucleus and all oxygen atoms contain 8 protons
made. We know of
protons in their
and can be seen in
atoms contain 6
in their nucleus.
Compounds Substances made of two or more elements chemically bonded together are called
compounds. Chemical bonds are the electrostatic forces of attraction that hold the particles of a
substance together. The type of bond depends on the types of particle present.
Ionic Compounds In nature, atoms will interact in such a way that they become more stable. When
atoms of an element that is a metal interact with atoms of an element that is a non-metal, a small
number of electrons transfer from the surface of the metal atom to the surface of the non-metal
atom. This means that the metal atoms now have more protons than electrons and so have a net
positive charge. They are then called cations. The non-metal atoms, on the other hand, have more
electrons than protons and so have a net negative charge. They are then called anions.
An example of a cation is the magnesiuum ion, which has the formula Mg2+. This formula tells
us that the magnesium atom has lost two electrons. An example of an anion is the oxide ion, 02-, This.
formula tells us that the oxygen atom has gained two electrons. (Anions are given a name that have
different ending from their parent atom.)
These ions (charged atoms) have more stable structures than their (parent atoms'. They
collect together in a giant lattice, which we see as a crystal. For example, crystals of table salt
consist of a lattice of sodium ions, formula Na+, and chloride ions, formula CI-. Strong
electrostatic forces of attraction known as ionic bonding, hold these oppositely charged ions
together in the crystal lattice. The compounds produced are termed ionic compound although they
are commonly known as salts.
Molecular Compounds: When atoms of non-metals interact with one another, they gain a more stable
structure by partially merging with one another and sharing some of electrons on their surfaces.
The resultant particle consists of a cluster of two or more atoms strongly bound together known as
a molecule. When there is more than one type of atom present, the compound produced is termed a
molecular compound. The net electrostatic force of attraction between the atoms in the molecule is
termed a covalent bond.
Most molecules that make up cells and control cellular functions are composed largely of nonmetal atoms, such as carbon, hydrogen, oxygen and nitrogen. It is important that the atoms of
biomolecules stay together and do not fall apart easily - especially in water, where chemical
reaction takes place. Strong Covalent bonds are keep them together.
Examining Molecules: In this chapter, we examine the various kinds of molecules such as
carbohydrates, proteins, lipids and nucleic acids found in living cells and consider their various
functions.
 In addition, we consider water as it is the most abundant molecule found in cells and the medium
in which most cellular processes occur.
 A synchrotron is a ‘super microscope’ used to examine molecules in fine detail.
 It enables scientists to examine high-resolution three-dimensional detail about molecules,
particularly proteins.
Water: a unique compound








Water: tasteless, odourless and nearly colourless inorganic substance, the most universal solvent and
essential for all. Water: a unique compound known forms of life; formula H2O
It is the most abundant compound in living organisms. Tissue fluid, blood plasma and the cell
cytoplasm are mainly composed of water.
All metabolic reactions occur in watery solutions.
The Polar Molecule: Each water molecule consists of a combination of a single oxygen atom with two
hydrogen atoms. Each hydrogen atom is linked to the oxygen atom by a strong covalent bond.
Although a water molecule overall has a neutral charge, the oxygen at the end of a covalent bond is
slightly negative and the hydrogen atoms are slightly positive areas and hence is a polar molecule.
Water can occur in three different states under natural conditions: solid, liquid and gas.
Water molecules are said to be highly cohesive. They tend to stick together, held by so-called
hydrogen bonds, which are weaker than covalent bonds.
Hydrogen bonding results in high surface tension, which allows the insects to walk on water.
Cohesive forces allow water molecules to travel up the vascular tissues of the tallest tree without
the stream being broken.
Water is a versatile solvent




Water is a good solvent for ionic compounds (NaCl) and polar molecules (sugars).
Substances that dissolve readily in water are called hydrophilic or polar.
Substances that tend to be insoluble in water are called hydrophobic or non-polar.
Water is a good transport medium. Even a large protein can dissolve in water if it has enough ionic
and polar regions on the surface.
Acid or alkaline?





The pH scale is a measure of hydrogen ions in solution.
Pure water has a pH of 7.0 and is a neutral solution.
Values of pH below 7 are acidic, indicating a higher concentration of hydrogen ions than in neutral
solution.
Values higher than pH 7 are alkaline, also called basic, and indicate a higher concentration of
hydroxide ions than is found at neutral pH.
Most biological fluids are within the range of 6-8 pH.
Organic molecules
 Organic molecules are often large molecules made of smaller sub-units that are bonded together
in various ways.
 Small molecules called monomers join together to form large molecules called polymers and the
process by which they are made is called polymerization.
 Organic polymers include carbohydrates, proteins, lipids and nucleic acids.
Carbohydrates — energy rich compounds
 Carbohydrates are organic compounds, composed of carbon (C), hydrogen (H) and oxygen (O).
 Uses: Used as energy source for organisms, Glucose is vital to cellular respiration, Cellulose- a
component in plant cell wall and glycolipids- recognize sites on cell surfaces etc.

Carbohydrates containing one or two sugar units are often referred to as simple carbohydrates;
those containing many sugar molecules are called complex carbohydrates (see figure 1.10).

Carbohydrates can also be classified into monosaccharides, disaccharides and polysaccharides.
Monosaccharides
 A monosaccharide is a molecule that comprises a single sugar with a general formula is
(CH2O)n.There are many monosaccharides but the most important is glucose (C6H12O6).
 Glucose is a product of photosynthesis. The simplified summary for this complex process is:
Disaccharides
 A disaccharide is formed when two monosaccharides combine (see below)
 The most familiar example is sucrose, the form in which carbohydrate is transported in plants,
the sugar you use in your tea.
 It is formed from the combination of glucose with fructose:
The joining of monomers to form a larger molecule is called condensation reaction (water
molecule is released).
 A disaccharide can be split into 2 monomers by adding water to the glycosidic bond in a
hydrolysis reaction.
 Other disaccharides include lactose and maltose.
Polysaccharides — complex carbohydrates
 Polysaccharides are polymers of many sugar molecules but not considered to be sugars. The most
common polysaccharides are starch, glycogen, cellulose and chitin.
 They are all composed entirely of glucose and yet their structures and properties are quite
different from one another because of the way they link together.

 Unlike sugars, many polysaccharides are insoluble in water.
Glycogen
 Are energy storage molecules in animals in the liver and muscles of the animals.
 Are located in the cytoplasm as solid grains inside a cell that does not interfere with the normal
functioning of the cell.
Starch
 Are energy storage molecules in plants (spiral in shape).
 Located in a chloroplast or amyloplast (starch grain) as solid grains inside a cell those do not
interfere with the normal functioning of the cell (no effect on osmotic action).
 Inulin a type of starch, soluble in water, not digested by animals.
 Iodine solution can be used to test/visualize starch that turns starch blue black in colour.
Cellulose
 is found in cell walls of plant.
 Used to support or protect plant
 Molecules are long and unbranched.
Chitin: used in exoskeletons of crustaceans and cell wall of fungi.
Pectin: substance between cell walls of plant tissue cells.
Proteins







Organic molecules and contain nitrogen, carbon, hydrogen and oxygen. Some also contain sulfur
and phosphorus.
Proteins are large molecules built of sub-units called amino acids.
There are 20 naturally occurring amino acids
Different proteins contain different numbers and proportions of each of the amino acids.
The general formula of an amino acid is:
Each amino acid has one part of its molecule, the R group different from other amino acids.
Two amino acids join together as a dipeptide when a peptide bond forms between the amino
group of one amino acid and the carboxyl group of another amino acid (see figure below )
 When a number of amino acids join in this way, a polypeptide is formed.
The structure and shape of proteins
 Proteins are very large molecules and can be classified on the basis of the way in which their
chains of amino acids, joined by peptide bonds, are folded into different shapes.
 Proteins can also be classified on the basis of their different functions.
 Protein structure is described at four different levels of organization.
Primary structure
 is the specific linear sequence of amino acids in the protein.
 Different proteins have different primary structures and hence have different functions.
 The sequence of amino acids in a protein is determined by the genetic material (DNA) in the
nucleus.
Secondary structure
 Amino acid chains fold in three different ways
 Hydrogen bonds form between segments of the folded chain that have come close together and
help stabilise the three-dimensional shape.
The following are some examples of secondary structure:
 Alpha helix-results from tight polypeptide coils held together by H-bonding every fourth amino
acid and are stretchable.
 Beta pleated sheet-in which two regions of the polypeptides line chain the parallel to each other.
H-bonds between parallel parts of the backbone hold the structure together and are already
stretched.
 Any major protein or portion is called random coiling if it does not fit into alpha- or beta-coiling.
The place of the random coil is often the most active site of a molecule.
Tertiary Structure
 Total irregular folding held together by hydrogen, ionic and disulfide bonds.
 Determines the function of the particular protein.
Quaternary Structure
 Describes the structure in which two or more polypeptide chains interact to form a protein,
 Can be globular-haemoglobin or fibrous- collagen
Conjugated proteins
 the chains of amino acids conjugate with other groups. This is particularly the case for those
proteins in the nucleus.
 nucleoproteins – they comprise a molecule containing both protein and nucleic acid.
 The amino acid sequence in a protein is important. If the order of amino acids in either chain is
altered, a defective chain results.
 An individual inherits the ability to make a beta chain from each parent. If the defect is
inherited from each parent, an individual is unable to produce any normal haemoglobin and they
have the disease thalassaemia.
Non-active to active molecule
 Many enzyme proteins are produced in an inactive form and only become active if the appropriate
enzyme is present to convert them for active service.
Example: insulin is produced as inactive as a hormone. It is produced as a single chain of amino acids
with folds that are held together by three di-sulfide bonds.
An active insulin molecule comprises two chains of amino acids held together by three di-sulfide bonds.
A section of this molecule is removed by an activating enzyme leaving the active enzyme as two
chains of amino acids held together by the three di-sulfi de bonds.
 The proteome of an organism is the complete array of proteins produced by that organism.
 The study of the proteome is called proteomics.
Lipids
 Lipid is the general term for fats, oils and waxes that are all made of carbon, hydrogen and
oxygen.
 contain relatively little water so can carry much more energy per molecule than any other kind of
compound found in either plants or animals.
Fats
 A fat molecule is made of two kinds of molecules, fatty acids and glycerol.
 Triglycerides, common fat molecules, are each made of a glycerol molecule with three fatty
acids attached.
 Saturated fatty acids if there is no carbon to carbon double bond; are solid at at room
temperature.
 Unsaturated fatty acids have one or more double bonds between carbon atoms; liquid at room
temperature.
 Phospholipid molecules each have two fatty acids and a phosphate group attached to a glycerol
molecule.
 The fatty acid tails are hydrophobic whilst the phosphate head is hydrophilic
 Fats and other compounds insoluble in water are called hydrophobic.
Steroids
 characterized by a carbon skeleton consisting of four fused c-rings. Examples are cholesterol
and steroid hormones.
Glycolipid
 is a lipid with a short carbohydrate chain attached to it.
 Located in membranes and are involved in cell-to-cell recognition.
Nucleic Acids (Polynucleotides)
 Organic molecules containing C, H, O, N and P.
 Carry instructions for making proteins by determining the amino acid sequence of the proteins
produced at the ribosomes.
 There are two kinds of nucleic acid: DNA and RNA. Both are built from nucleotide sub-units.
DNA — an influential molecule
 Discovered by James Watson and Francis Crick.
 The genetic material deoxyribonucleic acid is a polymer of nucleotides. Each nucleotide unit has:
o a sugar (deoxyribose) part
o a phosphate part
o an N-containing base.
There are four different kinds of nucleotides because four different kind of N-containing bases
are involved: adenine (A), thymine (T), cytosine (C) and guanine (G).
 The base pairs between the two strands, namely A with T, and C with G, are said to be
complementary pairs. Complete the sequence:
Template strand:
ATTAAGGCATGATAGGATCCC

Complimentary Strand: TAATTCCGTACTATCCTAGGG
 Three bases in DNA strand together , are collectively called a triplet, coding for one amino acid.
 Each DNA molecule consists of two chains (double helical) of nucleotides that are complementary
to each other and held together by hydrogen bonds.
 One nucleotide strand is known as the template or sense strand and the other as the
complimentary or antisense strand.
 The nucleotide sub-units (a) are assembled together to form a chain (b) in which the sugar of one
nucleotide is bonded with the phosphate of the next nucleotide in the chain. Each DNA molecule
contains two chains (c) that bond with each other because the bases in one chain pair with the
bases in another.
The DNA double helix combines with certain proteins to form a chromosome (PRESENT IN THE
NUCLEUS)
 DNA they contain carries genetic instructions that control all functions of the cell.
 All metabolic reactions in cells are controlled by enzymes. Proteins are formed from polypeptide
chains — chains of amino acids.
 Hence, the DNA of a cell controls what occurs in a cell through the polypeptide chains that the
DNA causes to be produced.
 The sequence of N-bases along one of the chain of nucleotides carries a set of information that
controls the production of polypeptide and is a code.
o Code comprises of four bases
o Operates with three letters at a time
o Eg AAA means amino acid phenylalanine is added to the polypeptide chain.
o Endless possibilities of proteins.
 A change in amino acid sequence in a chain can make it non-functional or harmful.
Ribonucleic acid
 In RNA, each nucleotide consists of a ribose sugar part, a phosphate part and an N-containing
base.
 Each RNA molecule consists of a single strand of nucleotides
 It differs from DNA in that it is an unpaired chain of nucleotide bases and exists in three
different forms.
 RNA is constructed from four different bases, three of which — adenine, guanine and cytosine
— are identical to those in DNA. The fourth nucleotide is uracil that is capable of pairing with A.
 The three different forms of RNA are all produced in the nucleus against DNA as a template:
o messenger RNA (mRNA), that carries the genetic message to the ribosomes where the
message is translated into a particular protein.
o ribosomal RNA (rRNA) which, together with particular proteins, makes the ribosomes
found in cytosol.
o transfer RNA (tRNA), molecules that carry amino acids to ribosomes where they are used
to construct proteins.
