Download Supplementary Tables and Figures (doc 5938K)

Supplementary Table 1: Z scores of the NCI-60 panel of cancer cell lines. The first
column represents all the genes with quality-passing probe sets in the five platforms
used in the NCI-60. The HUGO Nomenclature has been used for all gene symbols. All
values for each gene in the NCI-60 represents a z scored intensity in a given cell line.
The last two columns indicate the total number of probe sets for each gene and the
number of correlating probe sets.
Supplementary Table 2: List of primers
oligonucleotide name
sequence (5' to 3')
Chk2 E2 s
AACTCCAGCCAGTCCTCTCA
Chk2 E4 as
TGTCCCTCCCAAACCAGTAG
Chk2 E4 s
CTACTGGTTTGGGAGGGACA
Chk2 E5 as
ATTCAAAGGACGGCGTTTTC
Chk2 E15 s
TGGGTATCCACCTTTCTCTGA
Chk2 E16 as
CGGGTGTCTTAAGGCTTCTTC
2 s
CTCACGTCATCCAGCAGAGA
2 as
TCTTTTTCAGTGGGGGTGAA
Supplementary Figure 1: Copy number aberrations of CHEK2 locus in cancer cell
lines from the NCI-60 panel. A: Schematic representation of a genomic area spanning
300 kilo-base pairs (kbps) in the CHEK2 locus (chromosome 22, cytoband 22q12.2).
The plus and minus signs refer to the position of genes (sense/antisense). B: Array-CGH
data for 15 Mbps upstream and downstream the CHEK2 locus for three cancer cell lines
showing evident copy number aberrations for Chk2. Ovarian cancer cell line OVCAR-5
has a local amplification, amounting to approximately four copies, whereas lung cell line
NCI-H226 and melanoma SK-MEL-2 show diffuse hypodiploidy in the genomic area
surrounding CHEK2 locus. C: Table of copy number variations in cancer cell lines from
the NCI-60. Data obtained using Nimblegen 385k aCGH arrays. Array processing is
loess, copy number generated by circular segmentation (Partek® Genomics Suite 6.5).
Supplementary Figure 2: z-score profiles of CHEK2 transcription factors. A:
Average intensities, range, and standard deviations for putative CHEK2 transcription
factors that show high correlation to CHEK2 transcript, obtained by averaging all
Affymetrix probe sets available for gene expression in the NCI-60 (see text for further
details). B: Bar charts of putative CHEK2 transcription factors showing a correlation with
CHEK2 transcript greater than 0.414 (Pearson’s correlation coefficient, P < 0.001). From
left to right: CHEK2, SP1, ELF1, and MYC. Tissues of origin are color-coded (see
legend). C: Table of Pearson’s correlations between CHEK2 and putative CHEK2
transcription factors, known to bind CHEK2 promoter from published ChIP-chip studies
(from the TRANSFAC database). Data obtained using z-score profiles for gene
transcripts.
Supplementary Figure 3: CHEK2 exon probes Log2 intensities and robust z score
normalized intensities for HCT-116 and SK-OV-3 cancer cell lines. A: Box plot of
probe sets hybridizing CHEK2 exons, according to the SpliceCenter Suite. Y axis: Log2
intensity. X axis: Probe set index. Boxes represent interquartile range. Thick horizontal
bars show median values for each probe set. Whiskers highlight the 95% confidence
intervals. Individual outliers are represented by hollow dots. Values are from the
Affymetrix Human Exon arrays 1.0 ST, after GCRMA processing, quantile normalization,
and Log2 transformation. B: Schematic representation of the main (RefSeq) Chk2
isoforms (highlighted in bold characters) and other described isoforms for which qualitypassing probe sets were found in the Human Exon arrays for the NCI-60. C: Robust zscore-normalized values for CHEK2 exons in the ovarian SK-OV-2 cancer cell line
(lower panel) compared to the colorectal cancer cell line HCT-116 (upper panel). Y axis:
Robust z-scored-normalized intensities. X axis: Probe set index.
Supplementary Figure 4: Representative Western blot pictures of pT68-Chk2, total
Chk2 and  -actin in the NCI60. Colored bars correspond to the tissues of origin.
Supplementary Figure 5: Centrosomal localization of pT68-Chk2 T68 is partially
linked to DNA damage. pT68-Chk2 confocal immunofluorescence staining in HeLa
cells. pT68-Chk2 was labeled in pink and nuclei were stained in blue with DAPI. Scale
bars: 10 microns.
Supplementary Figure 6: High levels of activated Chk2 are associated with an
increased number of chromosomal rearrangements. Scatterplot representing the
number of clonally structurally re-arranged chromosomes (x axis), as determined by
spectral karyotyping by Roeschke et al. (Karyotypic complexity of the NCI-60 drugscreening panel. Roschke AV, et al. Cancer Res. 2003;63(24):8634-47) plotted against
the mean levels of activated Chk2 (as obtained from the quantitation means of pT68Chk2 Western blots, y axis). Individual cell line names of cell lines with high pT68-Chk2
intensities are reported in the plot. On the left of y axis and below x axis, boxplots
showing medians, 25th and 75th percentiles, 95% confidence intervals, and individual
outliers for each variable are represented.
Supplementary Figure 7: The homologous recombination and Fanconi anemia
DNA repair pathway is downregulated in high pT68 Chk2 cell lines. Genes
downregulated in high pT68 Chk2 cell lines are indicated in green. Among them are
several components of the Fanconi anemia complex, Brca2, Bard1, as well as the DNA
damage sensor kinase DNA-PK. The enrichment of such pathways is statistically
significant (p < 0.05). The represented network and functional analysis were generated
through the use of Ingenuity Pathways Analysis (Ingenuity® Systems).