Download part v - dna extraction of epithelial cells

Name___________________________Period______ Date _______________
PreAP BIOLOGY I LAB – DNA, RNA, & Protein Synthesis 1-10
Novak
PAPLbDNA RNA ProteinSyn1-10.doc
Prelab
Most of the following introduction questions can be found in chapter 12, a dictionary and using Google.
Match the following vocabulary words and prefixes to the definition below by putting the capitalize vocabulary
word into its blank below. Each term is used just once.
AMINO ACIDS, ANTICODON, BASE-PARING, CODON, DENATURE, DEOXYRIBOSE,
DNA, GENE, HYDROGEN, MESSENGER RNA (mRNA), NITROGENOUS BASE,
NUCLEOTIDE, PEPTIDE, PROTEIN, REPLICATION, RIBOSE, RIBOSOMES,
TRANSCRIPTION, TRANSFER RNA (tRNA), TRANSLATION, URACIL,
ELECTROPHORESIS, LYSIS, ENZYME, RESTRICTION ENZYME, CENTRIFUGE,
MICROPIPET, DNA EXTRACTION
1________________________ The molecule in which genetic code is located within the nucleus
2________________________ An organic compound that is made of one or more chains of amino acids and
that is a principle component of all cells
3________________________ One of twenty different organic molecules that combine to form proteins
4________________________ A type of chemical bond holding amino acids together
5________________________ A section of DNA coding for one protein
6________________________ A basic unit of DNA composed of three subunits
7________________________ A type of chemical bond holding bases together in the center of the DNA
double helix
8________________________ A subunit of a nucleotide containing either adenine, thymine, guanine, or
cytosine"
9________________________ The DNA rule in which adenine always connects with thymine and cytosine
always connects with guanine
10________________________ The type of sugar in a DNA nucleotide
11________________________ The process of making a copy of DNA
12________________________ The process by which DNA is copied onto RNA
13________________________ The molecule onto which the DNA code is copied during transcription
14________________________ The type of sugar in RNA
15________________________ The nitrogenous base of RNA that pairs with adenine"
16________________________ A three nucleotide base sequence that encodes for one amino acid
17________________________ The portion of protein synthesis that takes place in the cytoplasm and that
uses the codons in mRNA molecules to specify the sequence of amino acids
18________________________ The site in the cytoplasm of protein synthesis
19________________________ During protein synthesis, a type of RNA molecule that transfers amino acids
to the growing end of the polypeptide chain in the ribosome
20________________________ The triplet code on the transfer RNA that pairs with the codon on the
messenger RNA during protein synthesis
21. ________________________ A process of removing DNA from cells for testing
22. ________________________ the movement of charged particles in a fluid or gel under the influence of an
electric field and is usually used to separate different sizes of DNA fragments for DNA analysis.
23. ________________________ to modify the molecular structure of (such as a protein or DNA) especially by heat,
acid, alkali, or ultraviolet radiation so as to destroy or diminish some of the original properties and especially the specific
biological activity
24. ________________________ A protein that acts as a biological catalyst to bring about a specific
biochemical reactions
25. ________________________ An enzyme having the property of cleaving DNA molecules at or near a
specific sequence of bases. It is used as a “scissor” to cut DNA into various sizes.
Put the following terms related to protein synthesis in the correct order starting with DNA: ribosomes, amino
acids, protein, DNA, mRNA, transcription, tRNA,
translation_________________________________________________________
PreAP Lab DNA/RNA 1-10Robert Novak
Page 1
6/24/2017
1
In the following amino acids, give all possible codons in the mRNA (use the chart on page 303):
26. Glycine ________________________________________________
27. Trytophan ________________________________________________
28. Leucine ________________________________________________
29. Valine ________________________________________________
30. Serine ________________________________________________
31. Asparagine ________________________________________________
32. Tyrosine ________________________________________________
33. Aspartic Acid ________________________________________________
34. Glutamic Acid ________________________________________________
35. Arginine ________________________________________________
36. Cysteine ________________________________________________
37. Phenylalanine ________________________________________________
38. Proline ________________________________________________
39. Name the stop codons ________________________________________________
40. Name the start codon (see text on page 303) ____________
PART I - A MODEL FOR DNA
In this part of the lab you will construct a DNA molecule using push pins and soda straws.
Materials: push pins (five colors), small paper clips, scissors, striped soda straws, solid color soda
straws, “amino acid” cards, scotch tape, bookcover, piece of notebook paper
The straws and paper clips will represent the sugar phosphate “backbone” on each side of the
molecule. Cut all the soda straw pieces the same length. The push pins will represent the nitrogenous
bases of the nucleotides. Blue push pins will represent thymine, green push pins will represent
adenine, yellow push pins will represent cytosine, and orange or red push pins will represent guanine.
BE CAREFUL WITH THE PUSH PINS, THEY ARE VERY SHARP. Put all push pins in the middle of
the sada straw sections. According to your teachers directions construct one side or strand of the DNA
molecule in this exact base sequence:
TACACAATGAAGCTTTTAACAGGGGCACCAATT
Lay this strand on a bookcover which represents the nucleus of the cell. Label the bookcover the
nucleus. This above sequence of letters represents the DNA base sequence of one gene. What do
you guess these bases code for? 1-1________________ How many bases are in this sequence? 12________________ How many codons are in this DNA sequence or gene? 1-3________________
How many amino acids do you guess this sequence will assemble? 1-4________________ Which
base is used the most in this DNA sequence or gene? 1-5________________ Which base is used the
least in this DNA sequence or gene? 1-6________________ Where would this DNA sequence be
located within the cell? 1-7________________ Show you teacher the assembled DNA strand you
have just constructed.
Next, assemble the complementary side of the above DNA sequence. Match the push pins of the first
sequence above to the push pins on the complementary side by matching the colors. The blue with
the green and the yellow with the red or orange. These matching or pairing bases in the DNA are
matched together according to the 1-8________________ ________________ rule. In DNA, what
always matches or joins with adenine? 1-9________________ In DNA, what always matches or joins
with cytosine? 1-10________________ How many rungs do you now have in this DNA “ladder”? 111________________ You’re your teacher the assembled DNA molecule you have constructed.
PART II – A MODEL FOR MESSENGER RNA
DNA never leaves the nucleus. Instead it makes a copy of the code of the gene and sends it out of the
nucleus to the 2-1________________. This process of copying the DNA to mRNA is called 22________________. This copy of the DNA code is a molecule called 2-3________________. This
molecule acts as a template on which the protein molecule will be synthesized. Remove the second
PreAP Lab DNA/RNA 1-10Robert Novak
Page 2
6/24/2017
2
(complementary) strand of DNA you constructed so that the original strand can be “read” to make
mRNA in this nucleus. Since RNA has a different sugar along the sugar phosphate sides use the solid
color straws to assemble the mRNA strand. As you assemble the mRNA strand remember that RNA
substitutes thymine found in DNA for a base called 2-4________________. For the base uracil use
white push pins. How many uracils will the mRNA have? 2-5________________. How many bases
does the mRNA strand have altogether in this gene? 2-6________________ How many codons does
the mRNA strand have? 2-7________________ How many amino acids do you guess this strand of
mRNA will code for? 2-8________________ Cut a piece of notebook paper into a large circle and
label the circle the ribosome. Lay the mRNA strand onto the ribosome. As soon as you have finished,
show your teacher your mRNA strand on the ribosome. What happens at this ribosome? 29___________________________
PART III – A MODEL FOR PROTEIN SYNTHESIS
When the mRNA reaches the ribosome, it is ready to be used as a template for protein synthesis. The
assembling of the protein at the ribosome using the mRNA as a template is called 31________________ The mRNA attaches to the ribosome and the codons are matched with the
anticodons of the tRNA as the tRNA brings amino acids to the mRNA. After the match, the tRNA
releases the mRNA and leaves the amino acid at the ribosome to be joined with the next amino acid
brought in by the next tRNA. What type of bond joins amino acids? 3-2________________ obtain a
sheet of amino acid cards and cut them along the lines provided. According to your teachers
directions make tRNA molecules with anticodons attached to the amino acid cards. Then bring the
anticodons with their amino acid to the mRNA. With each new tRNA attach the amino acid to the
previous amino acid using scotch tape. Continue until all the codons on the mRNA have been read.
Keep in mind, the first and the last codons on the mRNA do NOT code for an amino acid. What do
they do? 3-3________________________________________________ How many amino acids are
in the chain? 3-4________________ Which of the amino acids are repeated? 3-5________________
In the following blank, give the sequence of the amino acids (in order). 36_____________________________________________________________________________
This chain of amino acids represents the 3-7________________ ADH. ADH is a hormone in human
plasma that controls the fluid level of your blood. Show your protein molecule of ADH you made to
your teacher.
Now go back to the original DNA strand. Replace only one base. Replace the fourth base adenine
with cytosine. How does this change of only one base change the eventual amino acid sequence in
the protein molecule of ADH? 3-8________________________________________________ This is
an example of a mutation which is a change is a 3-9_______________. Like a broken key that will not
unlock its door, the substitution of only one amino acid changes the 3-10________________ of the
protein molecule preventing it from working properly.
PART IV – VIRTUAL ELECTOPHORESIS
Go to the following website: http://learn.genetics.utah.edu/ At this website we will learn some
characteristics of DNA and methods making it possible to study it.
On this website find and click on the link titled “DNA EXTRACTION” then click on “start lab”. In
each step of the experiment, click on the “next” arrow to advance. As you do, answer the
questions below.
Name three situations in which you would have to extract DNA from a person. 41________________________________________________________________________________
____ How long is the DNA inside the nucleus of the cell? 4-2________________ One of the best
places to gather cells for DNA extraction is inside of our 4-3________________
STEP 1 - We will collect the 4-4________________ cells
STEP 2 - We will 4-5________________ the cells open to release the DNA
STEP 3 – We will separate DNA from 4-6________________ and 4-7________________
STEP 4 – We will 4-8________________ concentrated DNA
PreAP Lab DNA/RNA 1-10Robert Novak
Page 3
6/24/2017
3
Name each piece of lab equipment you will use: 49________________________________________________________________
What is used to obtain the cell samples from the subject? 4-10________________ What is inside the
check cells? 4-11________________ The cells will be put into a 4-12________________ tube. Next,
using a micropipettor a 4-13________________ solution is added to the tube. Then the tube is put
into a warm water 4-14________________. The lysis solution now in the tube with the cheek cells,
contains 4-15________________ which bursts the cells open and 4-16________________ which cuts
apart the chromatin histones holding the DNA. The swab is remove since the DNA has been released
from the cells. A concentrated 4-17________________ solution is added to the tube using the
micropipettor. The salt solution causes 4-18________________ and other cellular 419________________ to clump together. The tube is then placed into a 4-20________________
which then spins at high speeds resulting in the proteins and debris at the bottom of the tube while the
4-21________________ remains distributed through the liquid. Another micropipettor is then used to
remove the top liquid containing only the 4-22________________ and place it into a clean tube. Using
the micropipettor, 4-23________________ is now added to the tube with the DNA and the tube is
slightly agitated. The alcohol causes the DNA to 4-24________________ so that it can be seen with
the unaided eye. The tube is again placed into the 4-25________________ which causes the
clumped DNA to go to the bottom of the tube. The liquid is then removed with a micropipettor and the
DNA can be stored in a 4-26________________ for many years and can be re-dissolved at any time
to test the DNA. This is how DNA is removed from cells to be tested.
===============================================================================
Next, click on the home icon which will take you back to the original web page.
Click on the link entitled “Gel Electrophoresis“. On this page, click on “Can DNA Demand A Verdict?”
and answer the following questions Since the year 4-27________________ DNA analysis has made
appearances in U.S. courtrooms. Every single cell in our bodies contains DNA, the genetic material
that programs how cells work. 99.9 percent of human DNA is the same in everyone, meaning that only
4-28________________ percent of our DNA is unique! Our unique DNA, 0.1 percent of 3 billion,
amounts to 3 4-29________________ base pairs. This is more than enough to provide profiles that
accurately identify a person. At a crime scene, 4-30________________ is everywhere. It is present in
all kinds of evidence collected at the scene, including blood, hair, skin, saliva and semen. Scientists
can analyze the DNA in evidence samples to see if it matches a suspect's DNA. Below is the general
process of DNA extraction and gel electrophoresis that makes DNA analysis possible.
STEP 1 - Collect the DNA evidence from the crime scene
STEP 2 – 4-31________________ the DNA from the evidence samples
STEP 3 – Cut the DNA into fragments using specialized protein “scissors” called 432________________. For every person, the sizes of the cut fragments are unique – except for
identical twins
STEP 4 – Separate the negatively charged DNA fragments in a 4-33________________ by passing
an 4-34________________ current through it.
STEP 5 - Transfer the DNA fragments from the gel to a sheet of membrane
STEP 6 – Probe with DNA fragments that complement the DNA sequence of the fragments of interest
STEP 7 – Compare the fragment profile of the evidence DNA with those of the suspects, detective and
victim to see if they match.
STEP 8 – If the profiles from the evidence DNA and a suspect match multiple times, then it is very
likely that the evidence DNA came from the suspect.
According to the on the gel diagram, did the evidence DNA fragments match suspect 1, suspect 2, the
victim, or the officer? 4-35________________
===============================================================================
Return to the original website and click on the large picture icon labeled “Gel Electrophoresis” again. In
this part of the website, you will conduct an experiment to run a gel from a DNA sample to analyze it.
Start the experiment and advance each step by clicking on the “forward arrow” and answer the
questions below. Gel electrophoresis is a method to sort DNA according to 4-36________________.
PreAP Lab DNA/RNA 1-10Robert Novak
Page 4
6/24/2017
4
To sort the strands a 4-37________________ is used that acts like a filter. The DNA is placed in 438________________ or wells at the end of the gel. The DNA is pushed through the gel filter by
adding an 4-39________________ current. Because of the filter effect of the gel and the movement of
the DNA, the different lengths of strands move to different distances from the holes. Which type of
DNA strands moves the furthest from the holes? 4-40________________ 4-41________________
the sorted groups of DNA makes them more visible to the naked eye. Although we can’t see a single
DNA strand, we can see large 4-42________________ of stained DNA strands of the same length.
These groupings of similar length DNA strands show up as 4-43________________ in the gel.
In this experiment we will:
STEP 1- Make the 4-44________________
STEP 2 - Set up the gel 4-45________________
STEP 3 - Load the DNA sample into the gel
STEP 4 - Hook up the electric current and 4-46________________ the gel
STEP 5 - 4-47________________ the gel and analyze the results
Name the materials you will need to make the gel. 448________________________________________________________________
Put a small amount of 4-49________________ into a flask then add some liquid 4-________________
which will help electrical 4-50________________ flow through the gel. A 4-51________________ is
then used to heat the liquid to melt the agarose into the buffer. The melted agarose mixture is then
poured into the 4-52________________. A 4-53________________ is placed into the gel on one end
and the gel is allowed to cool. The comb is then removed leaving empty 4-54________________ at
one end for the DNA samples. The gel is ready to put into a 4-55________________ box after adding
4-56________________ so that the gel is barely submerged. The buffer helps to conduct 457________________ and keeps the gel from drying out. You are now ready for STEP 3. Name the
materials you are using in STEP 3: 458________________________________________________________________________________
Add loading buffer to the DNA sample using the micropipettor and a clean pipette 459________________. The loading buffer has 4-60________________ to make the DNA easier to
see and heavier so it will sink into the 4-61________________ instead of floating away. Using the
micropipettor, suck up some of the DNA sample into the pipette tip then inject it into the 462________________. Use a clean pipette tip to transfer DNA from the “DNA size standard” to the
next 4-63________________ well. The “DNA size
Standard” is a tube fill with DNA pieces of 4-64________________ length. Running it on the gel will
give you a reference by which you can estimate the 4-65________________ of the DNA pieces in the
original sample you are testing. You are now ready for STEP 4. Hook up the electricity and run an
electrical 4-66________________ through the gel. DNA has an overall 4-67________________
charge. The 4-68________________ you observe is the proof that your current is running. Repelled
by the negative charge, the DNA pieces 4-69________________ toward the positive end of the gel.
The 4-70________________ strands of DNA move more quickly than the 4-71________________
DNA strands. Over time the 4-72________________ DNA strands move further away from the wells
than the 4-73________________ strands of DNA. Even though we cannot see the DNA strands
migrating, we can see the 4-74________________ that we put in the loading buffer. We are now ready
for STEP 5. Remove the gel from the electrophoresis box. Put the gel into a 4-75________________
tray and stain the DNA pieces with ethidium bromide which binds to the DNA. Even though we cannot
see the individual DNA strands, large groups of similar size DNA pieces sort out and show up as 476________________. It takes about 4-77________________ minutes to stain out the DNA bands.
Remove the gel from the staining tray and put it on a fluorescent light apparatus, turn on the light and
put on your 4-78________________ to protect your eyes. To determine the size of your sample DNA
pieces, compare them to the “DNA size standard” sample. About how many base pairs were your
largest DNA pieces? 4-79________________ About how many base pairs were your middle sized
DNA pieces? 4-80________________ About how many base pairs were your smallest DNA pieces?
4-81________________ You have now completed a gel electrophoresis analysis of a DNA sample.
PreAP Lab DNA/RNA 1-10Robert Novak
Page 5
6/24/2017
5
PART V - DNA EXTRACTION OF EPITHELIAL CELLS
DNA is a complex molecule that is found inside cells. This molecule is so small that you can’t
normally see it with the naked eye or even with a light microscope, but if you release the DNA of
thousands of cells at the same time, the molecules become visible because of their sheer
number of collected cells. We will collecting epithelial cells from one of your team members.
What is an epithelial cell? 5-0________________________________ We will then in this part
of the lab, collect some epithelial cells from the skin on the inside of the volunteer’s mouth,
break the cells open, release the DNA and concentrate it in a liquid so you can see it.
Materials: 500 milliliters of drinking water, 7 grams of cooking salt or table salt, 1 clear
disposable drinking cup, safety goggles, 125ml of chilled rubbing alcohol, 1 eyedropper or
spoon, 1 drop of clear dishwashing detergent, 1 stir-stick, graduated cylinder, scale
STEP 1 - Add the salt to the water and stir until this grains of salt have disappeared (teacher
prepared). Pour 15 milliliters of the salty water into a clear container
STEP 2 - Pick one person in your team as the test subject. Have the test subject check on the
inside of his/her checks, gargle and swish all the salty water from the cup around your mouth
for about 30 seconds. Do NOT swallow the water. Spit the salt water back in the cup.
STEP 3 - Dip the stir-stick in the drop of dishwashing detergent and gently stir it in the cup.
Less froth in the cup is better so stir only two or three times . What is the purpose of the
detergent? 5-1________________________________
STEP 4 – Add two or three drops of food coloring to the cold rubbing alcohol and stir well.
What is the purpose of the food color? 5-2________________________________
STEP 5 – Put on your goggles (for the alcohol). Use the eyedropper to dribble the cold rubbing
alcohol down along the inside wall of the cup. Try to add the cold alcohol very gently, so that
water and the alcohol do NOT mix. You want the alcohol to form a separate layer on top of the
water. It helps to hold the cup at about a 20 degree angle while your do this.
Pour enough rubbing alcohol to create a cm-high layer on top of the water. Even if you added
the food coloring to the alcohol, the water will remain transparent.
STEP 6 – Examine the layer of alcohol closely. You should notice that thin strands of DNA
collect together. Which chemical do you think causes the DNA strand to collect into fibers? 53________________ The strands link together and form nets or webs of DNA. What color are
the strands of DNA? 5-4________________ Take a good look – its a part of you that you
usually don’t get to see! If the alcohol is cloudy so that you cannot see the DNA strands, try the
experiment again and add the cold alcohol more slowly.
STEP 7 – Discard the liquids into the sink, throw away your cup and return the goggles to the
goggle cabinet. Answer the following questions. What removed the cells from your test
subjects mouth? 5-5________________ What chemical broke down the cell membranes since
they are protected by a fatty layer? 5-6________________ What chemical caused the DNA to
collect into strands? 5-7________________ If you could actual see the individual DNA strands,
what shape would they be? 5-8________________
PART VI – ENZYME CATALYSIS OF HYDROGEN PEROXIDE
Catalase is a common enzyme found in nearly all living organisms which are exposed to
oxygen, where it functions to catalyze the decomposition (define decomposition 61___________________________) of hydrogen peroxide (normally formed during cellular
activity) to harmless water and oxygen. Catalase then serves the cell well since hydrogen
peroxide acts as a free radical which can have a mutagenic (define mutagenic 62________________________________) on DNA. Catalase has one of the highest turnover
numbers of all enzymes; one molecule of catalase can convert millions of molecules of
hydrogen peroxide to water and oxygen per second. Catalase is a tetramer of four polypeptide
chains, each over 500 amino acids long. It contains four porphyrin heme (iron) groups that
PreAP Lab DNA/RNA 1-10Robert Novak
Page 6
6/24/2017
6
allow the enzyme to react with the hydrogen peroxide. It acts as an antioxidant that is it breaks
down chemicals harmful to the cell. It also binds up free radicals which are also toxic to the cell.
The optimum pH for catalase is approximately 7, while the optimum temperature varies by
species.
In this part of the lab, you will using catalase enzyme from a fungus (yeast - it is the very same
enzyme produced by your cells) to test the ability of it to convert hydrogen peroxide to water
and oxygen. The general chemical equation for this decomposition reaction of hydrogen
peroxide in the presence of the catalase enzyme is 2H2O2  2H2O + O2
Materials: plastic pipette inserted into single hole rubber stopper, test tube, test tube rack, two
10 ml or 25 ml graduated cylinders, hydrogen peroxide (fresh), catalase enzyme from one
package of yeast in 250 ml of warm (room temperature) water, catalase enzyme from one
package of yeast in 250 ml of chilled water, ice water, plastic container about shoe box size, a
clock or watch with seconds indicator
STEP 1 - Place the pipette into the stopper with the tapered side first. Press in for a snug fit.
STEP 2 – Fill the plastic container about seven centimeters deep with tap water.
STEP 3 – Place six ml of hydrogen peroxide into the test tube.
STEP 4 – Fill one of your graduated cylinder with tap water
STEP 5 – Place your thumb over the cylinder full of water so that water cannot leak. Invert the
cylinder, place the mouth of the cylinder under the water in the plastic container, and remove
your thumb. As long as the mouth of the cylinder is under water, the water inside the cylinder
will remain there.
STEP 6 – Add three milliliters of the off the warm yeast solution to the hydrogen peroxide
solution within the test tube, insert the rubber stopper with the pipette, place it side down in the
water in the plastic container, immediately place the end of the pipette into the mouth of the
graduated cylinder and begin timing for one minute. You should notice bubbles coming out of
the end of the pipette into the upside down graduated cylinder.
STEP 7 – After one minute, remove the pipette from the graduated cylinder. How many
milliliters of oxygen bubbled into the graduated cylinder? 6-3________________ Where did the
oxygen come from? 6-4________________ What caused the hydrogen peroxide to
breakdown? 6-5________________
STEP 8 – Take apart your equipment and rinse.
STEP 9 – Next, repeat the experiment only use a chilled yeast solution with chilled hydrogen
peroxide. How many milliliters of oxygen from the chilled yeast solution bubbled into the
graduated cylinder? 6-6________________ Was this more or less than the warm yeast
solution? 6-7________________ What effect do you think the colder temperature had on the
catalase enzyme? 6-8___________________________ Proteins like catalase are affected by
the conditions within their environment. Their shapes can be changed by acidity, temperature
or other factors. This is known as the denaturing of the protein. What happens when a protein
changes shape? 6-9__________________________ In this experiment, what denatured the
catalase enzyme? 6-10________________ What affect on the amount of oxygen produced
from enzyme catalysis do you think would have occurred by using more yeast solution and
hydrogen peroxide? 6-11________________ What affect on the amount of oxygen produced
from enzyme catalysis do you think would have occurred by adding an acid to the yeast solution
and hydrogen peroxide? 6-12________________ Would change in temperature or pH
denature catalysis? 6-13 _________________
PreAP Lab DNA/RNA 1-10Robert Novak
Page 7
6/24/2017
7
POST LAB – (REVIEW & APPLICATION)
On a piece of notebook paper number and answer the following (you do not have to write the questions):
R1. What makes up the “backbone” of DNA?
R2. What is the most important part of a nucleotide and why?
R3. Explain the DNA base pair rule.
R4. Name two ways RNA differs from DNA
R5. Briefly explain the difference between transcription and translation in protein synthesis.
R6. In the following DNA sequence, give its complementary bases pairing. A A T C G A T G G C T T
R7. In the previous question, give the mRNA sequence that would form from it.
R8. In the previous question, give the amino acid sequence that would form from it.
R9. If a mRNA codon was UGC, what anticodon would be on tRNA?
R10.What is the function of a start and stop codon.
R11. Give an example of a Start codon.
R12. Give an example of a Stop codon
R13. What is the role of tRNA in protein synthesis?
R14. With what kind of chemical bond are amino acids joined?
R15. During protein synthesis, where in the cell does mRNA first form?
R16. During protein synthesis, where is mRNA located in the cytoplasm?
R17. Before protein synthesis, where is tRNA located
R18. What is ADH and what is its function?
R19. Shape is the most important quality of a protein. What gives any protein its correct shape?
R20. What is a mutation?
R21. How does a mutation affect protein?
R22. Name at least two causes of mutations.
R23. Name three types of mutations causing the malformation of proteins.
R24. Name three reasons why you would have to extract DNA from a person.
R25. What is the function of a micropipettor?
R26. What is the purpose of a lysis solution?
R27. What is the function of a centrifuge?
R28. What is the function of restriction enzymes?
R29. What is the purpose of gel electrophoresis?
R30. During gel electrophoresis, what is the purpose of the “comb”?
R31. What is meant by the phrase “loading the DNA”?
R32. What is meant by “running the gel”?
R33. Why does DNA form bands at different places along the gel during electrophoresis?
R34. How does electricity in the gel cause DNA to move?
R35. What was the purpose of the “DNA size standard” sample?
R36. In what “units” were the DNA pieces measured in to determine their length?
R37. In this lab you were able to see DNA with the unaided eye. How is that possible since DNA is too small to
seen?
R38. Define epithelial tissue.
R39. Nearly all cells in your body have DNA. Why did you obtain cells from the mouth?
R40. High salt concentration has what effect on cells?
R41 How does detergent solution affect cells?
R42. During DNA extraction, what is the effect of alcohol?
R43. Describe the BASIC shape of DNA.
R44. Define the phrase “free radical” and give an example.
R45. Define the term mutagenic.
R46. As far as proteins are concerned and based on this lab, how are the cells of yeasts and humans the
same?
R47. Define enzyme.
R48. Name two conditions that affect the rate at which catalase breaks down hydrogen peroxide.
R49. What is a decomposition reaction?
R50. Give the equation for enzyme catalysis of hydrogen peroxide.
R51. Briefly describe enzyme catalysis of hydrogen peroxide from its equation.
R52. One catalase enzyme protein molecule would have at least how many amino acids?
R53. What is meant when we say that the catalase enzyme protein was denatured?
PreAP Lab DNA/RNA 1-10Robert Novak
Page 8
6/24/2017
8