Download Figure S1

Supplementary information
Methods
Constructs and antibodies
Mouse Smyd2, Smyd3, Smyd5 and Suv4-20h1 were cloned into pGEX vectors and purified from
BL21 cells. cDNAs of mouse Smyd2 and Smyd2(MD) were subcloned into mammalian
expression vector with or without FLAG tag. Antibodies specific to p53K370me1, me2 and me3
were raised in rabbit, using p53 peptides as antigens, and purified as IgG fraction. Smyd2
antibody was raised against amino terminal peptide (NH2-CKDHPYISEIKQEIESH-COOH) and
antigen purified from crude serum.
RT-PCR and realtime PCR
Real-time PCR was run on an ABI 7000 SDS machine. mRNA Levels were measured by realtime PCR and normalized to that of GAPDH. The relative mRNA level was calculated by
comparing the normalized values to that at 0-hour time point treated with control siRNA, the
value of which was set to 1. Primers for GAPDH: 5’-TGGGCTACACTGAGCACCAG-3’ and
5’-GGGTGTCGCTGTTGAAGTCA-3’; for p21: 5’-AGCGATGGAACTTCGACTTTG-3’ and
5’-CGAAGTCACCCTCCAGTGGT-3’; for mdm2: 5’-CCGGATCTTGATGCTGGTGT-3’ and
5’-CTGATCCAACCAATCACCTGAAT-3’.
siRNA transfection
For siRNA transfection, cells were transfected with two rounds of 100nM siRNA (Dharmacon)
and DharmaFECT 1 (Dharmacon) with 24-hour interval. Cells were treated with or without
0.5uM adriamycin as indicated. siRNA target sequence for:
1
luciferase control: 5’-UAAGGCUAUGAAGAGAUAC-3’;
for Smyd2: 5’-GCAAAGAUCAUCCAUAUAU-3’;
for Set9: 5’- UGUAGACGGAGAGCUGAAC-3’.
Re-ChIP (Sequential ChIP)
H1299 cells were transfected with FLAG-p53 or FLAG-p53(K370R) together with or without
Smyd2 or Smyd2(MD) expression vector. After the first ChIP with FLAG antibody, IPed
materials were eluted with FLAG peptide and subject to Re-ChIP with p53K370me1 antibody or
IgG. Percentage of input was calculated as IP signal (Re-ChIP)/IP signal (ChIP). Primers for p53
binding site on p21: 5’-GGCTGGTGGCTATTTTGTCC-3’ and 5’TCCCCTTCCTCCCTGAAAAC-3’; on mdm2: 5’-AAACCATGCATTTTCCCAGC-3’ and 5’CAGGTCTACCCTCCAATCGC-3’; on Bax: 5’-AGCGTTCCCCTAGCCTCTTT-3’ and 5’GCTGGGCCTGTATCCTACATTCT-3’.
Lentivirus transduction
Luciferase control
Top strand:
5’CACCGCCCTGGTTCCTGGAACAATTCGAAAATTGTTCCAGGAACCAGGGC3’
Bottom strand:
5’AAAAGCCCTGGTTCCTGGAACAATTTTCGAATTGTTCCAGGAACCAGGGC3’
Smyd2
Top strand:
5’CACCGGATTGTCCAAATGTGGAAGACGAATCTTCCACATTTGGACAATCC3’
2
Bottom strand:
5’AAAAGGATTGTCCAAATGTGGAAGATTCGTCTTCCACATTTGGACAATCC3’
Lentiviruses were produced per manufacturer’s protocol. Stable clones constitutively expressing
shRNAs were obtained by transducing cells with lentivirus expressing shRNAs followed by
selecting with 250ug/ml (U2OS) or 100ug/ml (H1299) Zeocin for two weeks. For inducible
stable clones, U2OS cells expressing TetR were obtained by transducing with Lenti6/TR
lentivirus and selecting with 2.5ul/ml Blasticidin for one week. U2OS/Lenti6/TR cells were then
transduced with Lentivirus expressing FLAG-Smyd2 and selected with Zeocin. Cells transduced
with p53 shRNA lentivirus were selected with 1ug/ml puromycin and 40ug/ml Zeocin for three
days.
Legends
Figure S1. a, Autoradiograms and Coomassie stainings of histone methyltransferase (HMTase)
assays with recombinant Smyd2, Smyd3, Smyd5 and Suv4-20h1 on p53 peptide 358-393,
histone octamers or linker histone H1d. b, Mass spectrometry analysis of indicated p53 peptides
methylated by Smyd2.
Figure S2. a, Dotblot analysis with antibodies raised against unmodified, mono-, di- or trimethylation of p53K370 on peptides corresponding to p53 361-381. b, Detection of
p53K370me1 by western blot. Expression vector encoding FLAG-p53 (lane1-3), FLAGp53(K370A) (lane4-6) or FLAG-p53(K370R) (lane7-9) were co-transfected with empty vector
(lane1, 4, 7) or expression vector for Smyd2 (lane 2, 5, 8) or for Smyd2(MD) (lane3, 6, 9).
3
Eluates from FLAG immunoprecipitation were subjected to western blot analysis with DO1 and
p53K370me1 antibodies to detect the total p53 and p53K370 methylation, respectively.
Figure S3. Protein sequence alignment of SET domains of Set domain containing proteins.
Highly conserved residues are marked by asterisks. The Histidine 207 (arrow) in Smyd2 was
mutagenized to Alanine to generate methylation defective (MD) mutant of Smyd2.
Figure S4. Smyd2 regulates p53 responsive genes. a, Realtime PCR analysis of relative mRNA
level of Smyd2 from BJ and BJ-DNp53 cells transfected with control (grey bar) or Smyd2
(striped bar) siRNA followed by adriamycin treatment for 8 hours. Results were the average
from two independent experiments measured as triplicates. b, Realtime PCR analysis of relative
mRNA level of Smyd2, p21 and mdm2 from U2OS cells transfected with control (grey bar) or
Smyd2 (striped bar) siRNA followed by adriamycin treatment for indicated time. Results were
the average from two independent experiments measured as triplicates. c, Western blot analysis
to detect protein levels of Smyd2, p21, mdm2, DO1 and -actin in U2OS and H1299 cells stably
expressing shRNA against luciferase (Ctr.) or Smyd2 mRNA.
Figure S5. ChIP assay to measure the promoter associated total p53 and methylated p53 at K370.
a, ChIP assay with DO1 and p53K370me1 antibody in U2OS treated with adriamycin for
indicated time followed by realtime PCR analysis. b, relative percentage of methylated p53 at
K370 bound to p21 promoter was calculated by dividing p53K370me1 signal by total p53 signal.
4
Figure S6. Western analysis to measure effect of Smyd2 on the distribution of p53 between
cytoplasm and nucleus. U2OS cells were transfected with control (lane 1, 2, 5 and 6) or Smyd2
(lane 3, 4, 7 and 8) siRNA followed by mock (lane 1, 3, 5 and 7) or adriamycin (lane 2, 4, 6 and
8) treatment for 8 hours. 25ug cytoplasmic (lane 1-4) or nuclear lysate (lane 5-8) was loaded for
each lane followed by western blot analysis with p53 specific antibody, DO1.
Figure S7. Western analysis to measure effect of Smyd2 on the level of p53K382 acetylation
and p53S15 phosphorylation. U2OS cells were transfected with control (lane 1, 2, 5 and 6) or
Smyd2 (lane 3, 4, 7 and 8) siRNA followed by mock (lane 1, 3, 5 and 7) or adriamycin (lane 2, 4,
6 and 8) treatment for 8 hours. Lysates were immunoprecipitated with IgG (lane 1-4) or DO1
(lane 5-8) and followed by western blot analysis with p53K382 acetylation (top), p53S15
phosphorylation (middle) and p53 (bottom, FL393) specific antibodies.
Figure S8. Effect of Smyd2 overexpression on the levels of p21 promoter-associated p53. a,
Western blot analysis of Smyd2 in lysates from U2OS/Lenti6/TR cells inducibly expressing
vector (Ctr.) (lanes 1 and 2) or FLAG-Smyd2 (f-Smyd2) (lanes 3 and 4) treated without (lanes 1
and 3) or with (lanes 2 and 4) doxycycline (Dox.) for 24 hours. b, ChIP assay of U2OS cell lines
inducibly expressing none or FLAG-Smyd2 with DO1 or IgG after 8h adriamycin treatment. c,
the relative mRNA level of p21 in U2OS/lenti6/TR cells expressing vector or f-Smyd2 treated
without (grey bar) or with (striped bar) adriamycin for 8 hours. d, Western blot analysis of vector
control (lanes 1 and 2) or f-Smyd2 (lanes 3 and 4) cells incubated with Doxycyline for 24 hours
followed by mock (lanes 1 and 3) or adriamycin treatment (lanes 2 and 4) for 8 hours.
5
Figure S9. Measurement of p53 protein and mRNA levels. U2OS cells stably expressing control
or Smyd2 shRNA (levels shown in S4c) were transduced with lentivirus carrying a luciferase
control or p53 shRNA. Western blot analysis of the protein with DO1 (a) and realtime PCR
analysis of the mRNA (b) of p53.
Figure S10. Effect of Smyd2 on p53-mediated apoptosis. H1299/Ctr shRNA (column 1 and 3)
and H1299/Smyd2 shRNA (column 2 and 4) cells were transfected with empty (column 1 and 2)
or p53 (column 3 and 4) expression vectors followed by mock (top) or 10Gy gamma irradiation
(bottom) for 12 hours. Apoptotic cells were washed off and plates were stained by crystal violet.
The level of H1299/Ctr shRNA and H1299/Smyd2 shRNA are shown in Fig. S4c.
Figure S11. a, Set9 methylation of p53 peptides in vitro. Autoradiograph of HMTase assay with
recombinant Set9 and p53 peptide un-, mono- or di-methylated at K372. b, K372me1 does not
interfere with the recognition of p53K370me1 antibody on K370me1. Dotblot analysis with
p53K370me1 antibody and Ponceau staining.
6