Download Fish and Shellfish Immunology

Fish & Shellfish Immunology 31 (2011) 564e570
Contents lists available at ScienceDirect
Fish & Shellfish Immunology
journal homepage: www.elsevier.com/locate/fsi
Immune response of gilthead seabream (Sparus aurata) following experimental
infection with Aeromonas hydrophila
Martha Reyes-Becerril a, b, Tania López-Medina a, Felipe Ascencio-Valle a, María Ángeles Esteban b, *
a
b
Centro de Investigaciones Biológicas del Noroeste (CIBNOR), Mar Bermejo 195, Col. Playa Palo de Santa Rita, La Paz, B.C.S. 23090, Mexico
Fish Innate Immune System Group, Department of Cell Biology and Histology, Faculty of Biology, University of Murcia, 30100 Murcia, Spain
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 2 March 2011
Received in revised form
21 June 2011
Accepted 2 July 2011
Available online 12 July 2011
The Gram-negative bacteria Aeromonas hydrophila is a heterogeneous organism that causes the disease
known as motile aeromonad septicaemia, which is responsible for serious economic loss in seabream
culture due to bacterial infections. However, the immune mechanisms involved in this disease in fish are
still poorly understood. For the purpose of this study, gilthead seabream (Sparus aurata L.) specimens
received a double intraperitoneal injection of bacterial inoculums: a primary infection with 1 107 cell
ml1 A. hydrophila, followed by a secondary infection with 1 108 cell ml1 fourteen days later. Changes in
cellular innate immune parameters e phagocytosis, respiratory burst activity and peroxidase leucocyte
content e were evaluated 24 and 48 h after each injection. Simultaneously, the expression levels of nine
immune-relevant genes (TLR, NCCRP-1, HEP, TCR, IgM, MHC-IIa, IL-1b, C3 and CSF-1R) were measured in the
head-kidney, spleen, intestine and liver, by using q-PCR. Generally, the results showed a significant
decrease in cellular immune responses during the primary infection and a significant enhanced during the
second infection, principally in respiratory burst and peroxidase activity, thus indicating a recovery of the
immune system against this bacterial pathogen. Finally, transcript levels of immune genes were downregulated during the first infection, except for the IL-1b gene. In contrast, mRNA expression levels
during the re-infection were significantly up-regulated. The results seem to suggest a relatively fast
elimination of the bacteria and recovery of fish during the secondary infection.
Ó 2011 Elsevier Ltd. All rights reserved.
Keywords:
Aeromonas hydrophila
Cellular immune system
Gene expression
Gilthead seabream (Sparus aurata L.)
1. Introduction
Gilthead seabream is a marine fish with high economic value in
the Mediterranean aquaculture sector due to its good market price,
high survival rate and feeding habits. The most significant factor
affecting aquaculture is the incidence of microbial pathologies,
mainly bacterial in origin [1]. One of the major bacterial diseases is
caused by the Gram-negative bacterium Aeromonas hydrophila,
which produces diseases known as motile aeromonad septicaemia
[2] affecting a wide variety of freshwater fish species and, occasionally, marine fish [3,4]. This bacterium can also behave as
a secondary opportunistic pathogen, by assailing already compromised or stressed hosts [5]. Several extracellular toxins and
enzymes have been described as responsible for the virulence of
A. hydrophila, including cytotoxins and enterotoxins [6] and
a repertoire of enzymes that digest cellular components, mostly
proteases and haemolysins [7]. Previous studies indicate that
disease resistance in fish species is correlated with innate immune
parameters, and that these parameters probably affect the inherent
* Corresponding author. Tel.: þ34 868367665; fax: þ34 868363963.
E-mail address: [email protected] (M. Á. Esteban).
1050-4648/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.fsi.2011.07.006
capacity of fish to resist pathogens before a specific immune
response [2,8,9]. Innate immune response mechanisms against
A. hydrophila have been studied in several fish species [3,4,9];
however little is known on gilthead seabream. Understanding the
immune defence mechanisms of fish against bacteria is important
in terms of control and prevention, as it could provide the basis for
the development of improved vaccines [10]. The present work
contributes to the understanding of the complex interactions
between cellular immune parameters in head-kidney leucocytes
(main haemopoietic organ) and the transcriptional activity of
a range of genes involved in the innate and adaptive immune
system in gilthead seabream (Sparus aurata L.) responding to
primary and secondary A. hydrophila infections. Additionally, the
mechanisms involved in the A. hydrophila pathogenesis and the
role displayed by the immune response of fish are discussed.
2. Materials and methods
2.1. Fish and rearing conditions
Forty-eight specimens (84 g mean body weight) of the
hermaphroditic protandrous seawater teleost gilthead seabream
M. Reyes-Becerril et al. / Fish & Shellfish Immunology 31 (2011) 564e570
(S. aurata L.), obtained from CULMAREX S.A. (Murcia, Spain), were
kept running in seawater aquaria (flow rate 1500 l h1) at 28&
salinity, 20 C and a 12 h light:12 h dark photoperiod. The animals
were fed with a commercial pellet diet at a rate of 1% body weight
day1. Animals were acclimated for 15 days prior to the experiments. Seabream were confirmed bacterial-free by standard
microbiological techniques to determine the presence or absence
of allochthonous A. hydrophila [11] and by a PCR technique using
the primers combination strategy described by Vazquez-Juarez
et al. [12].
2.2. Bacteria
Virulent A. hydrophila was isolated from intestine of leopard
grouper (Mycteroperca rosacea) during an experimental infection
and maintained at the Laboratory of Microbial Pathogenesis of the
Center of Biological Investigation of Northwest (CIBNOR), La Paz,
B.C.S., México. Just before the experimental challenge in gilthead
seabream, some bacteria were reactivated and cultured on LuriaBertani, L3152 (LB, SIGMA) agar plates for 24 h at 30 C. Biomass
was recovered from plates and resuspended in 10 ml of phosphatebuffered saline (PBS 7.4). The bacterial cells were then collected by
centrifugation (2000 rpm, 10 min) and washed three times with
PBS also by centrifugation. The pellet obtained was suspended in
PBS at a concentration of 1 109 cells ml1, and then it was serially
diluted to obtain the 1 108 and 1 107 cells ml1 suspensions.
Gilthead seabream were injected intraperitoneally twice with
bacterial inoculum (first infection, day 1:200 ml of 1 107 cell ml1;
second infection, day 15:200 ml of 1 108 cell ml1) or PBS (first
infection, day 1:200 ml of PBS; second infection, day 15:200 ml of
PBS) (control group).
To confirm the efficacy of infection, some bacteria were recovered from tissues of experimentally challenged fish and their
identities were confirmed according to Popoff criteria [11] and
polymerase chain reaction (PCR) detection [12].
2.3. Sample collection
Six fish from each aquarium were randomly sampled at 24 and
48 h after each bacterial injection (days 2, 3, 16 and 17 after starting
the experimental design). Before sampling, the fish were starved
for 24 h and, after being euthanized, head-kidney leucocytes (HKLs)
were isolated from each fish under sterile conditions, according to
Esteban et al. [13]. Briefly, the head-kidney was excised, cut into
small fragments and transferred to 8 ml of sRPMI [RPMI-1640
culture medium (Gibco)] supplemented with 0.35% sodium chloride, 100 IU ml1 penicillin (Flow), 100 mg ml1 streptomycin
(Flow), 10 IU ml1 heparin (Sigma) and 5% foetal calf serum (FCS,
Gibco). Cell suspensions were obtained by forcing fragments of the
organ through a 100 mm nylon mesh, washed twice (400 g, 10 min),
counted (Z2 Coulter Particle Counter) and adjusted to 107 cells ml1
in sRPMI. Cell viability was determined by the trypan blue exclusion test. Head-kidney, spleen, intestine and liver fragments were
also sampled and immediately stored at 80 C in TRIzol Reagent
(Invitrogen) for RNA extraction (see below).
2.4. Phagocytic activity
The phagocytosis carried out by HKLs of gilthead seabream was
studied by flow cytometry according to Rodríguez et al. [14]. Heatkilled and lyophilized yeast cells were labelled with fluorescein
isothiocyanate (FITC; Sigma), washed and adjusted to
5 107 cells ml1 sRPMI. Phagocytosis samples consisted of
labelled yeast cells and leucocytes. Samples were mixed, centrifuged (400 g, 5 min, 22 C), resuspended in sRPMI, incubated at
565
22 C for 30 min and then placed on ice to stop phagocytosis, at
which point 400 ml ice-cold PBS was added to each sample. The
fluorescence of the extracellular yeasts was quenched by the
addition of 40 ml ice-cold trypan blue (0.4% in PBS). Standard
samples of FITC labelled yeast or leucocytes were included in each
phagocytosis assay. The samples were then analyzed in a FACScan
(Becton Dickinson) flow cytometer with an argon-ion laser
adjusted to 488 nm. Phagocytic ability was defined as the
percentage of cells with ingested yeast cells (green-FITC fluorescent
cells, FL1þ) within the phagocyte cell population. The relative
number of ingested yeasts per cell (phagocytic capacity) was
assessed in arbitrary units from the mean fluorescence intensity of
the phagocytic cells.
2.5. Respiratory burst activity
The respiratory burst activity of gilthead seabream HKLs was
studied using the chemiluminescence method [15]. Briefly, samples
of 106 leucocytes in sRPMI were placed in the wells of a flatbottomed 96-well microtitre plate and filled with 100 ml Hanks
balanced salt solution (HBSS) containing 1 mg/ml phorbol myristate
acetate (PMA; Sigma) and 104 M luminol (Sigma). The plate was
shaken and immediately read in a microplate reader (BIO-RAD,
model 3350-UV) for 1 h at 2-min intervals. The reaction kinetic was
analyzed and the maximum slope of each curve was calculated.
Backgrounds of luminescence were calculated using reagent solutions containing luminol but not PMA.
2.6. Leucocyte peroxidase activity
The peroxidase content inside HKLs was determined using
a colorimetric method [16]. Briefly, aliquots of 1 106 lysed leucocytes were dispensed in a 96-well plate containing 25 ml of
10 mM 3,3,5,5-tetramethylbenzidine hydrochloride and 5 mM
H2O2. The colour-change reaction was stopped after 2 min by
addition of 50 ml 2 M sulphuric acid and the optical density was
read at 450 nm in a plate reader. Standard samples without HKL’s
were used as blanks.
2.7. Real-time PCR
Twenty-four and forty-eight hours after each injection (days 2,
3, 16 and 17 after the start the experiment), total RNA was extracted
from 0.5 g of pooled seabream head-kidney (main haematopoietic
organ), spleen and intestine (secondary immune organs) and liver
using TRIzol Reagent (Invitrogen). It was then quantified and the
purity assessed by spectrophotometry; 260:280 ratios were
1.8e2.0, and treated with DNase I (Promega) to remove genomic
DNA contamination. Complementary DNA (cDNA) was synthesized
from 1 mg of total RNA using the SuperScript III reverse transcriptase (Invitrogen) with an oligo-dT18 primer. The expression of the
nine immune-relevant genes selected was analyzed by real-time
PCR, which was performed with an ABI PRISM 7500 instrument
(Applied Biosystems) using SYBR Green PCR Core Reagents (Applied
Biosystems). Reaction mixtures (containing 10 ml of 2 SYBR Green
supermix, 5 ml of primers (0.6 mM each) and 5 ml of cDNA template)
were incubated for 10 min at 95 C, followed by 40 cycles of 15 s at
95 C, 1 min at 60 C, and finally 15 s at 95 C, 1 min at 60 C and 15 s
at 95 C. For each mRNA, gene expression was corrected against the
endogenous level of the house keeping gene 18S content in each
sample in order to standardize the results by eliminating variation
in mRNA and cDNA quantity and quality [8].
No amplification product was observed in negative controls and
no primer-dimer formations were observed in the control
templates. The primers used are shown in Table 1. In all cases, each
566
M. Reyes-Becerril et al. / Fish & Shellfish Immunology 31 (2011) 564e570
concentration (1 108 cell ml1) 14 days after the primary infection. The fish infected during the first infection showed typical
signs of acute septicaemia with swollen, haemorrhages around the
anus and the caudal fins. After the second infection no mortality
was registered. On the other hand, external symptoms were not
observed in re-infected fish (secondary infection). Internal clinical
signs (visceral hemorrhages principally in liver) were detected in all
infected fish and never in fish from control groups.
Table 1
Primers used for real-time PCR.
Gene
GenBank number
Primer sequence (50 e30 )
18S
AY587263
TLR9A
AY751797
NCCRP-1
AY651258
Hep
EF625900
TCRa
AY751745
IgM
AY619988
MHCIIa
DQ019401
IL-1b
SAU277166
C3
CX734936
CSF-1R
AM050293
CGAAAGCATTTGCCAAGAAT
AGTTGGCACCGTTTATGGTC
ATTCCCGGAGTCCCAACAAG
GCTGCTGAACCATGAAGAAAGC
ACTTCCTGCACCGACTCAAG
TAGGAGCTGGTTTTGGTTGG
GCCATCGTGCTCACCTTTAT
CTGTTGCCATACCCCATCTT
GGAAGTGGAACCAGACTGAACG
GATCACTCTGAGGCACAGGACG
TTACTACTGTCAGAGTTTTC
ATCCCAGTGAGGGGAAGC
ATGATGAAGATGATGAAGATGATG
TCACGCTCTGTCCGTTCTTGG
GCTCAACATCTTGCTGGAGAGC
GGCACATATCCACTGGCTTG
ATAGACAAAGCGGTGGCCTA
GTGGGACCTCTCTGTGGAAA
ACGTCTGGTCCTATGGCATC
AGTCTGGTTGGGACATCTGG
3.2. Phagocytic activity
A. hydrophila significantly inhibited the phagocytic ability
(percentage of phagocytic cells) of leucocytes from fish sampled 24
and 48 h after the first bacterial injection, if compared with those
isolated from the control group (non-infected fish). However, after
the second injection (1 108 cell ml1), the phagocytic ability was
enhanced in infected fish respect to the control group, observing
a significant difference after 24 h (Fig. 1). The phagocytic capacity of
infected fish was no significantly affected at any time of the
experiment (Fig. 2).
3.3. Respiratory burst activity
PCR was performed with triplicate samples and repeated at least
twice. Modification of gene expression is represented with respect
to the control sampled at the same time of the treatment.
The respiratory burst activity e measured as the production of
reactive oxygen species (ROS) from head-kidney leucocytes of
experimentally infected fish e was significantly lower than that
obtained from leucocytes of the control group, both 24 and 48 h
after the first injection. Conversely, leucocytes from re-infected fish
increased significantly this activity after 24 and 48 h, if compared
with the control group (Fig. 3).
2.8. Statistical analysis
All bioassays were made in duplicate and all measurements
were performed on three replicates; the mean standard error
(SE) for each group was calculated. Two-way ANOVA was performed to determine the effects of treatments (non-infected and
infected) on different parameters (injections and time) after
checking for normality and homogeneity of variance by the
Kolgomorov-Smirnov and Levene tests (P > 0.05), respectively. All
statistical tests were conducted using the computerized software
Statistical Package for Social Sciences (SPSS) v.15.0 software.
Differences were considered significant at P 0.05.
3.4. Leucocyte peroxidase activity
Peroxidase activity of head-kidney leucocytes was significantly
lower 24 h but not 48 h after the first bacterial injection in infected
specimens. After the second injection, this activity was enhanced in
infected fish, but the increase was not-statistically significant, if
compared with the fish control group (Fig. 4).
3. Results
3.5. Real-time PCR
3.1. Pathogenicity
Genes considered important for the immune system were
analyzed using real-time PCR from seabream head-kidney, spleen,
intestine and liver (Table 2). Low levels of constitutive expression of
all the examined genes were detected 24 and 48 h during the
A total of 40 fish (corresponding at 83% of survival) survived the
primary infection and received re-infection with a highest
100
Non-infected
1st injection
2nd injection
Infected
Phagocytic cells (%)
80
*
60
40
*
*
20
0
24h
48h
24h
48h
Fig. 1. Effect of Aeromonas hydrophila infection 515 on gilthead seabream head-kidney leucocyte phagocytic ability. Data represent the mean SE (n ¼ 6). Asterisk denotes
statistically significant differences between control and challenged groups (P 0.05).
Table 2
Quantitative expression (q-PCR) of immune genes in different tissues of gilthead seabream following primary and secondary infection with Aeromonas hydrophila.
Gene
Group
Relative gene expression level
Spleen
Liver
1st injection
24
2nd injection
48
24
Intestine
1st injection
48
24
2nd injection
48
24
48
Control
0.9 .0.04 0.1 0.00
1.1 0.00 1.3 0.01
4.2 1.60 14.1 0.04
0.9 0.02 1.3 Infected
1.1 0.06 0.3 0.00
0.9 0.02 0.8 0.01
0.3 0.10 0.7 0.02
0.8 0.03 0.7 NCCRP-1 Control
0.2 0.02 9.9 1.30
0.4 0.00 0.4 0.00
1.0 0.20 0.7 0.00
0.9 0.06 0.7 Infected
5.9 0.95 0.0 0.00
2.2 0.04 2.3 0.20
1.0 0.20 1.4 0.03
1.3 0.10 1.6 Hep
Control
0.1 0.01 0.1 0.00
0.0 0.00 0.1 0.00
2.6 0.04 0.8 0.00
0.4 0.00 0.2 Infected 9.0* 1.50 0.0 0.00 19.5* 2.70 8.0 0.50
0.4 0.00 1.3 0.09
2.2 0.20 5.6 Control
6.6 0.10 0.1 0.00
1.7 0.02 1.0 0.00
5.9 0.28 3.1 0.60
1.0 0.01 0.9 TCR b
Infected
0.2 0.00 0.2 0.00
0.6 0.02 1.1 0.03
0.2 0.00 0.3 0.07
1.0 0.02 1.0 IgM
Control
9.5 0.84 0.1 0.00
0.9 0.00 0.5 0.00 48.1 8.47 0.8 0.11
1.0 0.00 0.4 1.0 0.02 2.1 0.08
0.0 0.00 1.3 0.10
1.0 0.00 2.7 Infected
0.1 0.00 0.0 0.00
1.6 0.00 0.0 0.00
1.5 0.01 3.7 0.60
4.5 0.70 24.9 1.80
1.4 0.06 3.8 MHCIIa Control
Infected
0.6 0.00 0.0 0.00
0.7 0.01 0.3 0.03
0.2 0.02 0.0 0.00
0.7 0.02 0.3 Control
0.0 0.00 13.9 1.20
0.2 0.00 0.2 0.00
0.0 0.00 0.1 0.00
0.0 0.00 0.4 IL-1b
Infected 46.3* 0.90 0.0 0.00
7.3 0.60 5.7 0.10 53.4* 3.10 11.8 0.60 26.2* 3.20 2.2 C3
Control
4.8 0.08 0.8 0.00
0.3 0.00 0.2 0.00
4.0 0.05 0.9 0.00
0.5 0.00 0.4 3.6 0.20 5.8 0.40
0.3 0.00 1.1 0.03
2.2 0.03 2.5 Infected
0.2 0.00 1.9 0.01
CSF-1R Control
0.1 0.00 0.9 0.00
1.5 0.00 1.2 0.04
0.7 0.00 2.3 0.06
0.6 0.01 1.0 Infected
0.1 0.00 0.0 0.00
0.7 0.00 0.9 0.03
0.1 0.00 0.4 0.01
1.7 0.06 1.0 TLR
Head-kidney
1st injection
24
48
2nd injection
1st injection
24
24
48
2nd injection
48
24
0.08 0.5 0.06 2.9 0.06 1.0 0.02
0.4 0.01
0.4 0.01
1.4 0.08 1.7 0.04 2.0 0.20 0.4 0.05 1.0 0.00
2.4 0.20
2.3 0.07
0.7 0.02 0.6 0.00 0.8 0.04 2.4 0.01 0.9 0.01
0.8 0.02
0.5 0.01
0.5 0.00 0.5 0.03 1.3 0.00 0.4 0.04 1.1 0.04
1.2 0.04
1.9 0.05
1.9 0.20 2.0 0.00 1.5 0.06 0.5 0.00 0.8 0.06
0.3 0.00
1.0 0.06
1.0 0.06 0.5 0.10 0.7 0.02 2.0 0.04 1.2 0.02
3.7 0.20
1.0 0.06
1.1 0.06 2.4 0.00 2.1 0.08 4.8 0.60 0.5 0.00
0.7 0.00
6.2 0.57
3.1 0.50 1.1 0.00 0.5 0.01 0.2 0.02 1.8 0.04
1.4 0.09
0.2 0.01
0.3 0.00 1.0 0.00 8.1 3.00 7.2 0.80 1.6 0.21
0.3 0.00
2.9 0.93 11.8 1.00 0.9 0.08 0.1 0.02 0.1 0.00 0.6 0.02
3.1 0.10
0.4 0.07
0.1 0.01 1.0 0.09 5.2 0.15 10.3 6.9 0.5 0.00
0.9 0.08
3.9 0.24
0.5 0.06 1.8 0.01 0.2 0.00 0.0 0.00 1.9 0.00
1.0 0.03
0.3 0.01
2.7 0.03 0.5 0.00 0.1 0.00 3.5 0.90 0.2 0.00
0.1 0.00
0.0 0.00
0.0 0.00 0.2 0.05 11.8 1.00 0.3 0.02 4.5 0.04 12.4* 0.90 20.8* 0.70 49.6* 2.50 6.3 0.00 0.9 0.08 1.1 0.04 1.2 0.02
0.2 0.00
2.2 0.05
0.1 0.00 0.9 0.10 1.2 0.10 0.9 0.05 0.8 0.05
4.6 0.70
0.4 0.10 12.7* 0.80 1.3 0.02 7.1 0.90 3.7 0.57 0.7 0.00
0.2 0.00
9.0 1.30
0.4 0.00 0.8 0.01 1.2 0.00 0.3 0.00 1.4 0.10
5.4 0.04
0.3 0.00
2.8 0.01 1.2 24 and 48 h post-injection. Fold increase of target gene relative to elongation factor a ( S.D.). Expression was compared to controls injected with PBS.
*Indicates significant up-regulation relative to control (p<0.05).
48
0.00
0.8 0.00
0.02
1.3 0.10
0.00
0.2 0.00
0.06
4.4 0.30
0.01
0.2 0.00
5.7 1.00
0.30
0.60
0.6 0.01
0.01
1.3 0.06
0.04
0.8 0.00
0.04
1.3 0.04
0.09
2.9 0.08
0.02
0.3 0.00
0.00
0.0 0.00
0.50 25.0* 0.10
0.04
0.8 0.01
0.03
1.3 0.06
0.00
0.6 0.01
0.00
1.9 0.08
568
M. Reyes-Becerril et al. / Fish & Shellfish Immunology 31 (2011) 564e570
1400
2nd injection
1st injection
Non-infected
Infected
Mean fluorescence intensity
per phagocyte
1200
1000
800
600
400
200
0
24h
48h
24h
48h
Fig. 2. Effect of Aeromonas hydrophila infection on gilthead seabream head-kidney leucocyte phagocytic capacity. Data represent the mean SE (n ¼ 6). Asterisk denotes statistically
significant differences between control and challenged groups (P 0.05).
25000
2nd injection
1st injection
Non-infected
Infected
Respiratory burst activity
(Slope min )
20000
*
*
15000
10000
*
*
5000
0
24h
48h
24h
48h
Fig. 3. Effect of Aeromonas hydrophila infection on gilthead seabream head-kidney leucocyte respiratory burst activity. Data represent the mean SE (n ¼ 6). Asterisk denotes
statistically significant differences between control and challenged groups (P 0.05).
primary infection (Table 2). One of the most interesting results was
that pro-inflammatory cytokine (IL-1b) expression levels were
significantly regulated due to infection. Thus, IL-1b was expressed
in all the tissues sampled 24 h after the first injection, although the
greatest increase was observed in the liver (53.4 fold up-regulated),
followed by the head-kidney (49.5 fold) 48 h after the fist infection.
During the re-infection period or secondary infection, the expression of several genes was up-regulated after 24 and 48 h (Table 2).
50
Again, we can observe an increase in IL-1b level in the second
injection any time of the experiment in all the tissues sampled. Proinflammatory cytokine IL-1b expression was 26.1-fold higher in
liver-infected fish 24 h after the secondary infection compared with
the control group. On the other hand, the transcripts of the C3 and
Hep were significantly increased in spleen and head-kidney during
the first and second injection, respectively. The number of C3 gene
transcripts was 12.7 fold increased 48 h in the infected fish
1st injection
Non-infected
2nd injection
Infected
Peroxidase activity
(Units 10 leucocytes)
40
30
20
*
10
0
24h
48h
24h
48h
Fig. 4. Effect of Aeromonas hydrophila infection on seabream head-kidney leucocyte peroxidase content. Data represent the mean SE (n ¼ 6). Asterisk denotes statistically
significant differences between control and challenged groups (P 0.05).
M. Reyes-Becerril et al. / Fish & Shellfish Immunology 31 (2011) 564e570
(primary infection), whereas the antimicrobial peptide Hep was
elevated 19.5 fold 24 h after re-infection.
4. Discussion
The present study reveals the changes in cellular innate immune
response and immune-relevant gene expression of gilthead seabream exposed to primary and secondary infection with A. hydrophila. The use of this bacterium as a model pathogen to elucidate
immune mechanisms in seabream is of significance, because acute
septicaemia caused by this pathogen is a serious threat to fish
production [17]. The bacteria were isolated from the infected
seabream and identified as a motile Aeromonas strain, and it was
responsible for the disease outbreak. In this work, seabream
infected with A. hydrophila showed typical signs of acute septicaemia with gross haemorrhagic lesions on the ventral surface of
the body, the fin and the tail rot, as well as visceral haemorrhages.
Similar lesions have also been described in Indian major carp, Labeo
rohita [2], zebrafish, Danio rerio [9] and leopard grouper, M. rosacea
[4], where external and internal symptoms (abdominal and visceral
haemorrhages with abdominal distension) were always observed
after experimental infections.
It is evident that immune defence mechanisms play a critical
role in preventing bacterial disease in fish [18]. Several authors
have documented such changes in innate as well as in adaptive
immune parameters in fish exposed to different pathogens
[9,10,19,20]. However, the immunomodulation mechanism
induced by A. hydrophila in fish is still poorly understood. In this
study A. hydrophila did not cause significant mortality, although
seabream specimens were found to be very sensitive to this
bacterium, as it is reported above in the description of the gross
lesions visible on skin and muscle. In this study a clear decrease in
the main cellular immune parameters were observed after the first
infection. Similarly, phagocytosis and respiratory burst diminished. Phagocytosis is a major mechanism used to remove pathogens and cell debris; respiratory burst is the rapid release of
reactive oxygen species from immune cells e mainly superoxide
radical and hydrogen peroxide. Concomitantly, 24 h after the first
injection, the leucocyte peroxidase content of this group was
significantly lower than that of the control group. The resistance of
A. hydrophila to oxygen radicals has already been reported by
some authors [21]. These authors have reported that some Aeromonas bacteria possess a Mn-superoxide dismutase (Mn-SOD) and
catalase enzyme that protects them from the external anion
superoxide and hydrogen peroxide generated by macrophages
inhibiting phagocyte activity. Conversely, numerous experiments
with a variety of microbes have demonstrated that the apoptosis
of professional phagocytes is a common event in pathogenesis and
plays a pivotal role in the initiation of the infection, the survival of
the pathogens, and the evasion of the first line of defence of the
immune system [22].
Fourteen days following the first infection, the surviving seabream were re-infected with a second injection using a concentration (1 108 cell ml1) higher than that used in the first injection.
Twenty-four and forty-eight hours after the second injection the
innate immune parameters recovered e in contrast to the parameters in the specimens of the control group e and no mortality was
observed. The results demonstrate that a second challenge of gilthead seabream with A. hydrophila confers them partial immunity. A
similar recovery pattern of fish immune system was found in
rainbow trout challenged twice with the enterobacterium Yersinia
ruckeri [19].
Regarding the expression of the immune-relevant genes, the
results show a pronounced increase of the cytokine interleukin-1b
569
in infected seabream in both primary and secondary infections,
thus suggesting a strong inflammatory response to A. hydrophila.
Evidence that many bacterial toxins induce cytokine release is
accumulating in recent years [23]. IL-1b is a major player in
immune response of fish as in mammals [24]. It is a key mediator in
the response to microbial invasion and tissue injury, and it can
stimulate immune responses by activating lymphocytes, or by
inducing the release of other cytokines capable of triggering
macrophages, NK cells and lymphocytes. Macrophages are the
primary source of IL-1b, although it is also produced by a wide
variety of other cell types. Bacterial components are known to
stimulate rainbow trout macrophages, induce IL-1b expression and
stimulate lymphocyte proliferation [25,26]. This can explain the
marked peak in transcript of IL-1b, seen in different tissues of
seabream during the primary infection. During the re-infection
(secondary infection), the number of transcript such as Hep, C3,
CSF-1R, NCCR-1 genes was significantly up-regulated, if compared
with their expression during the primary infection. Hepcidin is an
antimicrobial peptide that acts against Gram-negative and Grampositive bacteria [27], and it has recently been suggested to also
act as a central regulator of intestinal iron absorption and iron
recycling by macrophages [28]. In mammalian, hepcidin is greatly
stimulated by inflammation, and it is principally induced by
interleukin-1, interleukin-6, LPS and iron overloading [29]. In this
context, it is worth noting that a highly significant correlation exists
between Hep and IL-1b expression, as it was found in this work, and
in agreement with some reactions found in other fish species
following bacterial infection [19]. In addition, small but significant
increases in complement factors C3 were noted during the
secondary infection. Fish have a well-developed complement
system that plays an important role in their innate immune
response, including membrane attack complex (which lyses
bacteria), opsonisation for phagocytosis, and release of the anaphylatoxins C3a and C5a, which attract neutrophilic granulocytes to
the site of inflammation and infection [30,31]. Finally, NCCRP-1 and
CSF-1R genes were only up-regulated during the secondary infection. These genes encode leucocyte receptors that, in some
instances, might be considered cell markers for non specific cytotoxic cells (NCC), antigen cells and macrophages respectively, and
several studies have concluded that they are very good candidates
for this end [32,33].
In conclusion, this is the first study on the immune response of
gilthead seabream against primary and secondary infections with A.
hydrophila. The cellular immune parameters, as well as the transcript level (pro-inflammatory cytokines) studied in this research
indicate immunodepresion of seabream during the primary infection, but not in re-infection. The results suggest that recovery of
cellular innate immune activities and up-regulation of cytokines
(such IL-1b) may play an active role for the rapid elimination of this
pathogen during the re-infection period. Further extensive work is
recommended to get an insight into the mechanisms involved in the
recovery of the immune system following the first infection and in
the generation of immunological memory, which made the rapid
elimination of bacteria possible in successive challenges.
Acknowledgements
The author thanks Francisco Guardiola and Rebeca Cerezuela for
technical support. M. Reyes received a postdoctoral scholarship from
the Mexican Consejo Nacional de Ciencia y Tecnología (CONACYT
grant 164653). T. López has a fellowship from the CONACYT-México
(grant 48444). This work was partially funded by the Spanish
Ministry for Science and Innovation (AGL2008-05119-C02-01) and
Fundación Séneca de la Región de Murcia, Spain (06232/GERM/07).
570
M. Reyes-Becerril et al. / Fish & Shellfish Immunology 31 (2011) 564e570
References
[1] Zorrilla I, Chabrillón M, Arijo S, Díaz-Rosales P, Martínez-Manzanares E,
Balebona MC, et al. Bacteria recovered from diseased cultured gilthead sea
bream (Sparus aurata L.) in southwestern Spain. Aquaculture 2003;218:
11e20.
[2] Sahoo PK, Das Mahapatra K, Saha JN, Barat A, Sahoo M, Mohanty BR, et al.
Family association between immune parameters and resistance to Aeromonas
hydrophila infection in the Indian major carp, Labeo rohita. Fish and Shellfish
Immunology 2008;25:163e9.
[3] Sahu S, Das BK, Mishra BK, Pradhan J, Sarangi N. Effect of Allium sativum on the
immunity and survival of Labeo rohita infected with Aeromonas hydrophila.
Journal of Applied Ichthyology 2007;23:80e6.
[4] Reyes BM, Tovar RD, Ascencio VF, Civera CR, Gracia LV, Barbosa SV, et al.
Effects of dietary supplementation with probiotic live yeast on the immune
and antioxidant systems of leopard grouper Mycteroperca rosacea infected
with Aeromonas hydrophila. Aquaculture Research; 2010:1e11.
[5] Tellez BMC, Santerre A, Casas-Solis J, Zairseva G. Endosulfan increases seric
interleukin-2 like (IL-2L) factor and immunoglobulin M (IgM) of Nile tilapia
(Oreochromis niloticus) challenged with Aeromonas hydrophila. Fish and
Shellfish Immunology 2010;28:401e5.
[6] Yadav M, Indira G, Ansary A. Cytotoxin elaboration by Aeromonas hydrophila
isolated from fish with epizootic ulcerative syndrome. Journal of Fish Diseases
1992;5:183e9.
[7] Leung KY, Stevenson RMW. Characteristics and distribution of extracellular
proteases from Aeromonas hydrophila. Journal of General Microbiology 1988;
134:151e60.
[8] Reyes BM, Salinas I, Cuesta A, Meseguer J, Tovar RD, Ascencio VF, et al. Oral
delivery of live yeast Debaryomyces hansenii modulates the main innate
immune parameters and the expression of immune-relevant genes in the
gilthead seabream (Sparus aurata L.). Fish and Shellfish Immunology 2008;25:
433e8.
[9] Rodríguez I, Novoa B, Figueras A. Immune response of zebrafish (Danio rerio)
against a newly isolated bacterial pathogen Aeromonas hydrophila. Fish and
Shellfish Immunology 2008;25:239e49.
[10] Raida MK, Buchmann K. Development of adaptive immunity in rainbow trout,
Oncorhynchus mykiss (Walbaum) surviving an infection with Yersinia ruckeri.
Fish and Shellfish Immunology 2008;25:533e41.
[11] Popoff M. Aeromonas. In: Krieg NR, editor. Bergey’s manual of systematic
bacteriology. Baltimore, MD: Williams & Wilkins; 1984. p. 545e8.
[12] Vazquez-Juarez RC, Barrera-Saldana HA, Hernandez-Saavedra NY, GomezChiarri M, Ascencio F. Molecular cloning, sequencing and characterization of
omp48, the gene encoding for an antigenic outer membrane protein from
Aeromonas veronii. Journal of Applied Microbiology 2003;94:908e18.
[13] Esteban MA, Mulero V, Muñoz J, Meseguer J. Methodological aspects of
assessing phagocytosis of Vibrio anguillarum by leucocytes of gilthead seabream (Sparus aurata L.) by flow cytometry and electron microscopy. Cell &
Tissue Research 1998;293:133e41.
[14] Rodríguez A, Esteban MA, Meseguer J. Phagocytosis and peroxidase release by
seabream (Sparus aurata L.) leucocytes in response to yeast cells. Anatomical
Record 2003;272A:415e23.
[15] Bayne CJ, Levy S. Modulation of the oxidative burst in trout myeloid cells by
adrenocorticotropic hormone and catecholamines: mechanisms of action.
Journal of Leukocyte Biology 1991;50:554e60.
[16] Quade MJ, Roth JA. A rapid, direct assay to measure degranulation of bovine
neutrophil primary granules. Veterinary Immunology and Immunopathology
1997;58:239e48.
[17] Fang HM, Ling KC, Ge R, Sin YM. Enhancement of protective immunity in blue
gourami, Trichogaster trichopterus (Pallas), against Aeromonas hydrophila and
Vibrio anguillarum by A. hydrophila major adhesion. Journal of Fish Diseases
2000;23:137e45.
[18] Mohanty BR, Sahoo PK, Mahapatra KD, Saha JN. Innate immune responses in
families of Indian major carp, Labeo rohita deleting in their resistance to
Edwardsiella tarda infection. Current Science 2007;92:1270e4.
[19] Raida MK, Buchmann K. Innate immune response in rainbow trout (Oncorhynchus mykiss) against primary and secondary infections with Yersinia
ruckeri O1. Developmental and Comparative Immunology 2009;33:35e45.
[20] Mohanty BR, Sahoo PK. Immune responses and expression profiles of some
immune-related genes in Indian major carp, Labeo rohita to Edwardsiella tarda
infection. Fish and Shellfish Immunology 2010;28:613e21.
[21] Leclere V, Bechet M, Blondeau R. Functional significance of a periplasmic Mnsuperoxide dismutase from Aeromonas hydrophila. Journal of Applied Microbiology 2004;96:828e33.
[22] Hilbi H, Zychlinsky A, Sansonetti PJ. Macrophage apoptosis in microbial
infections. Parasitology 1997;115:S79e87.
[23] Henderson B, Wilson M, Wren B. Are bacterial exotoxins cytokine network
regulators? Trends in Microbiology 1997;5:454e8.
[24] Secombes CJ, Wang T, Hong S, Peddie S, Crampe M, Laing KJ. Cytokines and
innate immunity of fish. Developmental and Comparative Immunology 2001;
25:713e23.
[25] Ingerslev HC, Pettersen EF, Jakobsen RA, Petersen CB, Wergeland HI. Expression profiling and validation of reference gene candidates in immune relevant
tissues and cells from Atlantic salmon (Salmo salar L.). Molecular Immunology
2006;43:1194e201.
[26] Panigrahi A, Kiron V, Satoh S, Hirono I, Kobayashi T, Sugita H, et al. Immune
modulation and expression of cytokine genes in rainbow trout Oncorhynchus
mykiss upon probiotic feeding. Developmental and Comparative Immunology
2007;31:372e82.
[27] Shike H, Lauth X, Westerman ME, Ostland VE, Carlberg JM, Van Olst JC, et al.
Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge.
European Journal of Biochemistry 2002;269:2232e7.
[28] Shi J, Camus AC. Hepcidins in amphibians and fishes: antimicrobial peptides
or iron-regulatory hormones? Developmental and Comparative Immunology
2006;30:746e55.
[29] Lee P, Peng H, Gelbart T, Beutler E. The IL-6- and lipopolysaccharide-induced
transcription of hepcidin in HFE-, transferrin receptor 2-, and b2microglobulin- deficient hepatocytes. Proceedings of the National Academy
of Sciences of the United States of America 2004;101:9263e5.
[30] Lambris JD, Mavroidis M, Sunyer JO. In: Erdei A, editor. New aspects of
complement structure and function. Austin, TX: R. G. Landes; 1994. p. 15e34.
[31] Boshra H, Li J, Sunyer JO. Recent advances on the complement system of
teleost fish. Fish and Shellfish Immunology; 2006:239e62.
[32] Cuesta A, Esteban MA, Meseguer J. Molecular characterization of the nonspecific
cytotoxic cell receptor (NCCRP-1) demonstrates gilthead seabream NCC
heterogeneity. Developmental and Comparative Immunology 2005;29:637e50.
[33] Roca FJ, Sepulcre MP, López-Castejón G, Meseguer J, Mulero V. The colonystimulating factor-1 receptor is a specific marker of macrophages from the
bony fish gilthead seabream. Molecular Immunology 2006;43:1418e23.