* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download restriction enzymes restriction enzymes
DNA sequencing wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
DNA replication wikipedia , lookup
DNA profiling wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA nanotechnology wikipedia , lookup
Microsatellite wikipedia , lookup
DNA Digestion & Ligation Lab The Double helix: double-stranded Deoxyribo-Nucleic Acid RESTRICTION ENZYMES (dsDNA) • Bacteria produce special enzymes to chop up viral DNA. • Biotechnologist use these “restriction enzymes” to cut DNA in specific places (restriction sites). • Many restriction enzymes cut the DNA polymer in a staggered pattern that produce “sticky” single-stranded ends to the DNA fragments. Eco RI bound to DNA RESTRICTION ENZYMES • Since a particular restriction enzyme only cuts DNA at a specific DNA sequence (restriction site): • Any DNA cut by that enzyme will have the same “sticky ends”. Restriction Sites HinDIII EcoRI TAAGCTTGTCAAATGAATTCTCTAC ATTCGAACAGTTTACTTAAGAGATG Homodimer. Pink circles are manganese ions. Restriction Digests with HinDIII TA ATTCGA AGCTTGTCAAATGAATTCTCTAC ACAGTTTACTTAAGAGATG with EcoRI TAAGCTTGTCAAATG ATTCGAACAGTTTACTTAA with both TA ATTCGA Heyer TAAGCTTGTCAAATGAATTCTCTAC ATTCGAACAGTTTACTTAAGAGATG AATTCTCTAC GAGATG HinDIII & EcoRI AGCTTGTCAAATG ACAGTTTACTTAA AATTCTCTAC GAGATG 1 DNA Digestion & Ligation Lab Restriction digest and Ligation DNALC • Mechanism-of-Recombination 3D-animation Stock Reagents for DNA Digest & Ligation Lab Agarose gel electrophoresis for DNA • • • • Lambda DNA: 250 ng/ul [nanograms per microliter] Eco RI: 20 Units/ul Hin DIII: 20,000 Units/ml Ligase: 3 Units/ul • Subject to verification before use. • Use the above to calculate your working volumes, concentrations and dilutions. • Pay attention to the units! • Keep all solutions cold (on ice). Heyer 1