* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Down syndrome
DNA vaccination wikipedia , lookup
Genomic library wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Epigenetics of human development wikipedia , lookup
History of genetic engineering wikipedia , lookup
Genome (book) wikipedia , lookup
Designer baby wikipedia , lookup
Primary transcript wikipedia , lookup
Mir-92 microRNA precursor family wikipedia , lookup
Point mutation wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Microevolution wikipedia , lookup
Y chromosome wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
X-inactivation wikipedia , lookup
Baby Doe v. The Prenatal Clinic Norris Armstrong University of Georgia-Athens 1 Baby Doe v. The Prenatal Clinic John looked at the baby squirming in his arms. He and his wife, Jane, had been trying to have kids for a couple of years and had finally been successful. The pregnancy was uneventful and, though the delivery took longer they either of them would have liked, everyone seemed to be doing fine. This was a new experience for John. Everything about the child he was holding seemed so small and delicate. Even so, some things seemed unusual. For example, the baby looked a little cross-eyed, and its face seemed a little flat when he looked the baby from the side. Also, the baby’s hands and feet were even smaller than he would have expected, and the hands had a strong crease that ran across the middle of the palms. John realized he was probably imagining things. After all, though he had a younger brother, he was definitely no expert on newborn babies. 2 One week later… But one week later John and Jane sat in the clinic’s conference room in stunned silence. “I had to run some tests to be certain,” said their doctor. “However, the results confirmed what I suspected. Your child has Down syndrome. I am afraid there is no cure. However, early intervention can improve the outcome you can expect. I can give you the names and numbers for several organizations that can give you well more information and advice. There are other resources you can try as ………………” John and Jane did not hear much of what the doctor said after the diagnosis. The only thought that kept running through their minds was, “How could this have happened?” 3 The Case You’ve been hired by a law firm to serve as an expert witness for John and Jane’s case. To help your client and to appropriately inform the court, you will need to explain what actually causes Down syndrome to the jury. You will also need to explain whether or not the clinic could have done anything that contributed to the baby’s condition. Since it was likely to have been many years since most of the jurors had studied biology, one of the things you probably have to do is give them a crash course on some basic biology. For starters, what exactly is Down syndrome? 4 CQ#1: What is Down syndrome? A. A condition caused when the mother drinks alcohol while pregnant. B. A form of childhood cancer. C. A birth defect resulting in a split upper lip and speech problems. D. A condition caused when the baby has too many copies of a chromosome. E. A form of brain damage that results when the baby receives too little oxygen during birth. 5 Down syndrome • A chromosomal disorder resulting from a partial or complete extra copy of chromosome 21. • Multiple developmental and health effects including: • Short stature, distinct facial features. • Mild to moderate physical and cognitive impairment. • Increased risk of problems involving heart, respiratory, digestive, hearing, vision, and/or thyroid glands. • Trisomy 21 (95% of all cases): three complete copies in all cells. • Mosaicism (1-2% of cases): three copies in some but not all cells. • Translocation (3-4% of cases): partial copy of chromosome 21 attached to another chromosome. 6 What are chromosomes? 7 What are chromosomes? •Human cell = >6 billion nucleotide base pairs (~2 meters) •Wrapped around protein = chromatin •DNA/protein = chromosome 8 How many chromosomes do humans have? • Humans are diploid (2n) • Two of each chromosome, one from each parent. • n = 23 unique chromosomes (haploid #) Curly hair allele • 2(n) = 46 total chromosomes Strait hair allele • The two copies of each chromosome in human cells are homologous • Different versions - same genes in same locations but different DNA sequence. • Different versions (alleles) of a gene may promote different traits (e.g. hair type). 9 CQ#2: The diploid chromosome number in standard laboratory mice (genus Mus) is 40. What is n for this organism? 10 Getting Ready The first court date for John and Jane’s case is coming up and it is time to start organizing your testimony. You need to help the jury determine whether the doctors at the clinic may have done something to cause the baby to have the incorrect number of chromosomes. A good place to start might be to describe how cells get the right number of chromosomes in the first place. 11 How do cells get the right number of chromosomes? DNA DNA DNA DNA DNA DNA DNA Cell Division 1. Duplicate cell components • Organelles • Cytoplasm • Chromosomes 2. Separate the material into two daughter cells 12 Cell Cycle •Interphase •Cell division M G2 S G1 13 DNA Packaging 14 Interphase Mitosis •Prophase •Metaphase •Anaphase •Telophase 15 CQ#3: If you investigated cells from a lab mouse with 40 chromosomes you would find a total of __ sister chromatids first after the ___ stage. A. B. C. D. 10: G1 20: G2 40: M 80: S 16 Insert photos of celebrity families here 17 Families: similar yet different. Why? Asexual Reproduction •Single parent •Offspring identical to each other and parent Sexual Reproduction •Two parents •Offspring are unique •Offspring are similar to each other and parents •Combine DNA from two individuals •Combines characteristics of both individuals 18 Why do diploid organisms need to have specialized sex cells? • Sex cells (gametes: sperm or egg) allow traits to be combined from two organisms 2n (46) + 2n (46) 4n = 92 too many 19 Sexual Reproduction • Gametes have only one of each chromosome • Requires special cell division: Meiosis •Diploid cells (2n) Gametes (n) •Takes place in gonads (testis, ovary) n (23) + n (23) 2n = 46 20 How is Meiosis different from Mitosis? Mitosis Cells divide 1x Meiosis Cells divide 2x 2n 2n 2n 2n n n Diploid Cells n n n n Haploid Cells 21 Mitosis Identical cells Meiosis Different cells 22 Mitosis Cell division is over Meiosis Cells divide again; sister chromatids line up Done 23 How many unique gametes can a cell with two pairs of chromosomes make? 24 Why bother? •For humans with 23 pairs of chromosomes? •(2)23 > 8 million different possible gametes •For a couple •possible unique offspring •(8 million) x (8 million) = (64,000,000,000,000) But wait! There’s more! 25 Crossing over enables even greater variety • Exchange of equivalent sections between homologous chromosomes. • Occurs at random locations along chromosome. • Creates new versions of chromosomes. 26 CQ#4: The cell to the right shows a diploid organism with two chromosomes (2n=2). The pictures below show some of the steps this cell may go through during mitosis or meiosis. A. D. B. E. F. C. G. H. Place the appropriate steps in order for a cell going through mitosis. (Note: you may use just some or all of the steps.) 27 CQ#5: The cell to the right shows a diploid organism with two chromosomes (2n=2). The pictures below show some of the steps this cell may go through during mitosis or meiosis. A. D. B. E. F. C. G. H. Place the appropriate steps in order for a cell going through meiosis. (Note: you may use just some or all of the steps.) 28 Parent #2 Parent #1 CQ#6: The different copies of chromosome 21 in John and Jane are shown to the right. Which of the following is a normal gamete that might be produced by either John or Jane? A B C D E 29 What went wrong? Now that you’ve explained to the jury how cells normally receive the correct number of chromosomes, you need to explain whether this did not happen with John and Jane’s baby because of something the clinic doctor’s may have done. What can cause a cell to inherit the incorrect number of chromosomes? 30 CQ#7: How can a cell end up with an incorrect number of chromosomes? A. The chromosomes do not separate correctly during mitosis or meiosis. B. The chromosomes are copied incorrectly during mitosis or meiosis. C. Cells divide too many times. D. The chromosomes become damaged when they are being copied. E. Cells eliminate chromosomes they don’t need. Sometimes this doesn’t happen. 31 Normal Meiosis Non-Disjunction 32 Parent #1 Parent #2 Down syndrome The different copies of chromosome 21 for John, Jane, and their baby are shown here. Child 33 CQ#8:The different copies of chromosome 21 for John, Jane, and their baby are shown here. Parent #1 Parent #2 When and where did the mistake occur? A. B. C. D. E. Meiosis I of parent #1 Meiosis I of parent #2 Meiosis II of parent #1 Meiosis II of parent #2 Either Meiosis I or II of parent #1 Child 34 What’s wrong with having 3 copies of a chromosome? • Three copies of a chromosome means three alleles for each gene. • Genes contain DNA • DNA is the instructions for making proteins 35 Protein Synthesis • Gene – DNA segment that carries a blueprint for building one protein • Proteins have many functions – Building materials for cells – Act as enzymes (biological catalysts) • RNA is essential for protein synthesis Role of RNA • Transfer RNA (tRNA) – Transfers appropriate amino acids to the ribosome for building the protein • Ribosomal RNA (rRNA) – Helps form the ribosomes where proteins are built • Messenger RNA – Carries the instructions for building a protein from the nucleus to the ribosome Transcription and Translation • Transcription – Transfer of information from DNA’s base sequence to the complimentary base sequence of mRNA • Translation – Base sequence of nucleic acid is translated to an amino acid sequence – Amino acids are the building blocks of proteins Protein Synthesis Figure 3.16 Figure 17.4 The dictionary of the genetic code Figure 17.7 The initiation of transcription at a eukaryotic promoter Transcription factors control the expression of a gene. They must be present for a gene to be on. Figure 17.9 RNA processing: RNA splicing Figure 17.17 The initiation of translation Figure 17.18 The elongation cycle of translation Figure 17.19 The termination of translation So why is having three copies of a gene so bad? • Since genes direct the construction of proteins, having an extra one means 50% more protein is made. • Many genes on chromosome 21 code for transcription factors. Making extra transcription factors means many genes will be “overexpressed”. • Why this causes Down’s Syndrome is unkown. 46 47 Human Down Syndrome Cell Adhesion Molecule Gene TATTATAATATAATTATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAC tata/promoter/start TGACTGAGGCCGGAGCACGGCAAAGATGAGCCTGCCCGCCCGCCTGCTGCCTGGATGCGGAGGGTGAGGG CTGGCGCACGGGAGGCCGCTGGCTGCGCATTCTGGGCGCCGAGTGCCCGGGATGAGCTCACGCCCGCGTC TGCGGCTCTCTCCACCTGCCGACCTGCCGGGGGCCCACTGAGCTGACGGCGCACCTGGGCTCCGGCCGCA GCGTGGGGCGCGGCGCCCGGGAGCAGGTGTGCAGGAGCGCAGCGCGCGGCGAGCGCAGCCCTCGCTCCGG AGCCCGGCCGCGCCGCGTGCCCGGGCGGCTAGGCAGCGGCGGCGGCGGCGGCGGGCGGCGGGCGGGCGGC Intron?? GGCCCCCGGGCAGGTGCCGAGCGGCGAGCGGAGCCGGGCCGGGCGGAGCGCGGGGGGCGAGGCCGGCGCG TCGCTCGCGGGAGGCCGGGGAGCGGCAGGGGCATGTGGATACTGGCTCTCTCCTTGTTCCAGAGCTTCGC GAATGTTTTCAGTGAAGACCTACACTCCAGCCTCTACTTTGTCAATGCATCTCTGCAAGAGGTAGTGTTT GCCAGCACCACGGGGACTCTGGTGCCCTGCCCCGCAGCAGGCATCCCTCCTGTGACTCTCAGATGGTACC TAGCCACGGGCGAGGAGATCTACGATGTCCCCGGGATCCGCCACGTCCACCCCAACGGCACTCTCCAAAT TTTCCCCTTCCCTCCTTCAAGCTTCAGTACCTTAATCCATGATAATACTTATTATTGCACAGCTGAAAAT CCTTCAGGGAAAATTAGAAGTCAGGATGTCCACATCAAGGCTGTTTTACGGGAGCCCTATACAGTCCGTG TGGAGGACCAGAAAACCATGAGAGGCAATGTTGCGGTCTTCAAGTGCATTATCCCCTCCTCGGTGGAGGC GTACATCACTGTCGTCTCATGGGAGAAAGACACTGTTTCACTTGTCTCAGGATCTAGATTTCTCATCACA TCCACGGGAGCCTTGTATATTAAAGATGTACAGAATGAAGATGGATTGTATAACTACCGCTGCATCACGC GGCATCGATACACCGGAGAGACGAGGCAGAGCAACAGCGCCAGACTTTTTGTATCAGACCCAGCGAACTC AGCCCCATCCATACTGGATGGGTTTGACCATCGCAAAGCCATGGCTGGGCAGCGTGTGGAGCTGCCTTGC CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC intron (fiction) AAAGCGCTCGGGCACCCTGAGCCAGATTACCGCTGGCTGAAGGACAACATGCCCCTGGAACTTTCAGGGA GGTTCCAGAAGACCGTGACGGGGCTGCTCATTGAGAACATTCGCCCCTCGGACTCAGGCAGCTATGTTTG TGAAGTGTCCAACAGATACGGAACTGCTAAGGTGATAGGCCGCCTGTACGTGAAACAGCCACTGAAAGCC ACCATCAGTCCCAGGAAGGTTAAAAGCAGCGTGGGTAGCCAAGTTTCCTTGTCCTGCAGCGTGACAGGAA CTGAGGACCAGGAACTCTCCTGGTACCGCAATGGTGAAATCCTCAACCCTGGAAAAAATGTGAGGATCAC AGGGATCAACCACGAAAACCTTATAATGGATCACATGGTCAAAAGTGACGGGGGCGCATACCAGTGCTTT…ATT stop! 48 CQ#9: If you were on the jury for the malpractice trial of the doctor, what would you decide? A. The doctor must have done something wrong to cause cell division to have malfunctioned. B. The doctor could not have done anything to cause the problem. C. It is impossible to tell if the doctor could be at fault. 49 Case closed? You’ve presented pretty conclusive evidence that the clinic was not responsible for causing Down syndrome in John and Jane’s baby. However, now comes the trickiest part of the trial. Should the clinic have alerted the couple that something might be wrong before the baby was delivered? How could the doctors have known that the baby might have be born with Down syndrome? 50 How is Down syndrome detected? Karyotyping •Isolate chromosomes during fetal cell division. •Arrange in pairs according to size. 51 CQ#10: When would the best time be to isolate chromosomes for a karyotype? A. B. C. D. E. F. G. G1 S-phase G2 Prophase Metaphase Anaphase Telophase Why would this time be best? 52 CQ#11: Does this person have Down syndrome? A. Yes B. No 53 A karyotype can be performed by collecting cells from the developing embryo in the first trimester using one of two procedures. Techniques for doing this slightly increase the risk of miscarriage (0.5-1.0%). Jane’s family had no history of Down syndrome, but John had a cousin with the disorder. A chart showing Jane’s age (red line) and the risk of having a Down syndrome child is shown below. 54 CQ#12: Is the clinic liable for not testing for Down syndrome? A. Yes, the clinic should have tested the baby for Down syndrome. B. It is liable only if the clinic failed to follow suggested guidelines for when to perform the test. C. Yes, it doesn’t matter if the clinic was at fault or not. D. No, the clinic should not be held at fault for something beyond its control. 55 In 2001, France's high court of appeals ruled that the parents of a boy who has Down syndrome should be compensated because the situation was not detected by the doctor during the pregnancy. In 2004, the Utah Supreme Court ruled that the parents of a 4-year-old girl with Down syndrome cannot sue a doctor for misreading prenatal tests designed to identify the disability. In 2007, a California court awarded a 34-year-old woman damages because the medical center failed to offer her the opportunity to undergo amniocentesis and Chorionic Villus Sampling early in the course of her pregnancy. 56 Historically, women over age 35 or who are at risk of having a child with Down syndrome are encouraged to have amniocentesis and CVS to test for this abnormality. However, because most pregnancies occur in younger couples, 80% of Down syndrome cases occur with women under age 35. Down syndrome occurs in one out of every 800-1000 live births. In 2007, the American College of Obstetricians and Gynecologists recommended that every pregnant woman, regardless of age, be offered a choice of tests for this common birth defect. 57 Image Credits Unless specifically indicated otherwise below, all illustrations appearing in this case study were created by the author, Norris Armstrong. Slide 1 Description: Baby feet. Author: Doreen Dotto ©2006, Doreen Dotto Fine Portrait Photography, Toronto, Ontario, Canada. www.doreendotto.com Link: Wikimedia Commons, http://commons.wikimedia.org/wiki/Image:Baby_feet.jpg Clearance: Licensed in accordance with Creative Commons Attribution-Share Alike 3.0 Unported. Slide 7 Description: An E. coli bacterium was attached to an EM supporting grid and then gently broken open. The DNA in its native form has spilled out including a small circular plasmid. Source: Jack Griffith, University of North Carolina. Clearance: Used with permission. Slide 8—Left Description: Metaphase chromosomes. Author: Steffen Dietzel Source: Wikimedia Commons, http://commons.wikimedia.org/wiki/File:HumanChromosomesChromomycinA3.jpg Clearance: Licensed in accordance with Creative Commons Attribution-Share Alike 3.0 Unported. Slide 8—Right Description: DNA and chromosome structure. Source: National Human Genome Research Institute Link: http://www.genome.gov//Pages/Hyperion//DIR/VIP/Glossary/Illustration/chromosome.cfm Clearance: Public domain. Slide 12—Right top Description: Fluorescently stained dividing cell. Author: Conly Rieder Source: National Human Genome Research Institute Link: http://publications.nigms.nih.gov/moleculestomeds/biology.html Clearance: This image is a work of the National Institutes of Health, part of the United States Department of Health and Human Services. As a work of the U.S. federal government, the image is in the public domain. Slide 14 Description: Replicated chromosome. Source: Derived from images at Wikimedia Commons: http://commons.wikimedia.org/wiki/File:DNA_replication_split.svg (Madprime) and http://commons.wikimedia.org/wiki/Image:Chromatin_chromosome.png (Magnus Manske) Clearance: Licensed in accordance with Creative Commons Attribution-Share Alike 3.0 Unported. Slide 15 Description: Cell cycle stages. Source: Wikimedia Commons Link: http://commons.wikimedia.org/wiki/File:Gray2.png Clearance: Public domain. Slide 19 and Slide 20 Description: Human male and female figures. Source: Wikimedia Commons Link: http://commons.wikimedia.org/wiki/File:Human.svg Clearance: Public domain. Slide 37 Description: Spectral karyotype (SKY). Source: National Human Genome Research Institute Link: http://www.genome.gov//Pages/Hyperion//DIR/VIP/Glossary/Illustration/sky.cfm Clearance: Public domain. Slide 38 Description: Normal karyotype. Source: National Cancer Institute Link: http://visualsonline.cancer.gov/details.cfm?imageid=2721 Clearance: Public domain. Slide 39 Description: Down syndrome karyotype. Author: Christa Lese Martin, Department of Human Genetics, Emory University School of Medicine Source: Emory Genetics Laboratory Clearance: Used with permission.