Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download scope and use of bioinformatics in genomic and proteomic
Document related concepts
Transcript
The Swiss Institute of Bioinformatics Ernest Feytmans Director Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics SIB activities The SIB brings Swiss experts in bioinformatics together and provides high quality services to the national and international scientific community. The SIB is a privileged partner of Swiss Universities Members of the SIB include research groups in Geneva, Lausanne, Basel and Zurich. The SIB participates in Master’s degrees of partner universities and organises a doctoral school in Bioinformatics. Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics The SIB in Switzerland Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Group Leaders 12 membres Ron Appel, Proteome Informatics, UniGE Amos Bairoch, Swiss-Prot, UniGE Bastien Chopard, Computer simulations, UniGE Philipp Bucher, Computational Cancer Genomics, ISREC Mauro Delorenzi, Bioinformatics Core Facility, ISREC Félix Naef, Computational Sytems Biology, ISREC C. Victor Jongeneel, Vital-IT et Transcriptome Analysis, LICR Olivier Michielin, Molecular Modeling, UniL et LICR Michael Primig, Genome Bioinformatics, UniBas Torsten Schwede, Protein Structure Bioinformatics, UniBas Erik van Nimwegen, Genome Systems Biology, UniBas Mihaela Zavolan, RNA Regulatory Networks, UniBas Gaston Gonnet, EPFZ Joerg Stelling, EPFZ Evgeny Zdobnov, UniGE Bernard Moret, EPFL Marc Robinson-Rechavi, UniL Sven Bergmann, UniL Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Size of SIB groups SIB groups 80 80 40 190 20 17 33 5 5 3 SB FN 5 BM EMBnet 5 EZ 3 JS 3 GG 3 BC 6 MZ 7 MRR 10 VJ 8 Vital-IT 8 EVN 10 OM 11 PB 11 MP 11 TS RA 0 MD 12 AB number of members 60 groups Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics SIB collaborators Evolution of the number of collaborators (in FTE on SIB payroll) Administration Swiss-Prot PIG Lausanne Bâle 60.0 58.2 54.0 50.0 # collaborators (FTE) 44.8 40.0 37.7 28.4 30.0 19.4 20.0 16.2 1.0 0.5 6.3 4.9 4.4 2.3 4.4 3.3 0.7 11.6 9.9 9.7 10.0 15.0 14.1 12.4 12.2 7.7 6.9 6.6 7.9 7.5 8.1 8.0 4.7 1.5 0.8 0.0 1998 1999 2000 2001 2002 Year 2003 2004 2005 Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics SIB revenues Evolution of SIB revenues Produits de Services Confédération Recherche NIH Divers services 8.0 7.2 6.1 5.9 Subsidies (millions CHF) 6.0 5.7 5.0 4.1 4.0 3.1 3.1 2.6 2.0 2.0 2.6 2.2 2.0 1.5 1.6 1.1 1.1 0.9 0.8 0.3 1999 2000 2.0 1.5 1.4 0.3 1.9 1.8 1.1 0.7 1.2 0.6 0.1 0.0 1998 2001 2002 Year 2003 2004 2005 Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Swiss repartition (2006) 7% 16% 30% Basel Geneva Lausanne Zurich 47% Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics SIB activities The SIB has three missions: research & development, education and service. research and development activities related to the databases and Master’s degrees of partner universities and Swiss doctoral school in databases of international standing (Swiss-Prot, Prosite, EPD, Swiss- software developed within the Institute. Bioinformatics. 2Dpage, Human Chromosome 21, TrEST, TrGen, AGBD, Hits, Swiss Model Repository, GermOnline). software and services that can be accessed from the SIB web servers (Melanie, T-COFFEE, PFTOOLS, ESTScan, Dotlet, SEView, Snp_detect, Mmsearch, Swiss-Model, DeepView/Swiss-PdbViewer, MIMAS). services to the Swiss biomedical research community within the framework of EMBnet and NCCR Together with the Universities of Lausanne, Geneva and Basel, the Swiss Federal Institutes of Technology of Lausanne (EPFL) and Zurich (EPFZ), and three private partners, Hewlett-Packard Inc., Intel Corp. and Oracle, the SIB contributed to the creation of a high-performance informatics platform (Vital-IT) exclusively dedicated to life sciences. Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Scientific Council Seven members Peer Bork, European Molecular Biology Laboratory, Germany. Michael Dunn, Conway Institute of Biomolecular and Biomedical Research, University College Dublin, Ireland. Takashi Gojobori, National Institute of Genetics, Japan. Manolo Gouy, C.N.R.S., Université Claude Bernard-Lyon 1, France. Wilhelm Gruissem, Institute of Plant Sciences, ETH Zentrum, Zürich. Thomas Lengauer, Chairman, Max-Planck-Institut für Informatik, Germany. Christine Orengo, Dept. of Biochemistry & Molecular Biology, University College London, UK. Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics The Computational Biology Challenge "In principle, the string of genetic bits holds long-sought secrets of human development, physiology and medicine. In practice, our ability to transform such information into understanding remains woefully inadequate". The Genome International Sequencing Consortium, ”Initial sequencing and analysis of the human genome,” Nature 409: 860-921 (2001) [Emphasis added] Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Computational Biology Today Genome analysis – from raw sequence data to fully assembled and annotated genomes Proteome analysis – from mass spectra of complex protein mixtures to full identification of their components and analysis of their structure Expression profiling – microarrays, SAGE, MPSS, ESTs Comparative genomics – phylogeny, polymorphisms, fingerprinting Modelling of macromolecular systems – deducing properties from atomic interactions Modelling of complex systems – protein interactions, pathways, regulatory networks, whole organ models: “Systems Biology” Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Computational Biology needs HPC! Problems of scale Genomes with millions to billions of nucleotides Profiling experiments with tens of thousands of data points measured on hundreds or thousands of samples Thousands of protein mass spectra representing GigaBytes of data/experiment Problems of complexity Combinatorial: >3×104 interacting gene products can create more functions than there are atoms in the Universe Structural: >105 dynamically interacting atoms make up the smallest of molecular machines Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Life Science ICT Needs Problem Computing Speed Genome Assembly > 10 TFlops Protein Structure Prediction > 100 TFlops Classical Molecular Dynamics 100 TFlops Storage Network 300 TB 100 Mbps 1s PB 500 Mbps 10s PB 2 Gbps Per DNA-protein interaction First Principle Molecular Dynamics 1 PFlops 100s PB 10 Gbps Simulation of Biological Networks >1 PFlops 1000s PB ??? Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics The Vital-IT Center Joint venture between academic and industrial partners Universities of Lausanne, Geneva and Basel, Swiss Federal Inst. of Technology Lausanne, Ludwig Institute for Cancer Research Hewlett-Packard, Intel Corp. and Oracle Managed by the Swiss Institute of Bioinformatics An HPC center exclusively dedicated to life sciences Software development and optimization HPC resources for biology and medicine Consulting for the life science and health industries Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Scope of Vital-IT R&D projects Porting of existing code to Itanium® Optimisation of code for Itanium architecture Adaptation of software to cluster environment Ad hoc software development for technology platforms Infrastructure projects Compute engine behind Web interfaces Database engine for genomic/proteomic data Computational resource for bioinformatics research projects Providing resources to SwissBioGrid, SystemsX Transnational Resource for EU Countries Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Vital-IT in SwissBioGRID SwissBioGRID collaboration large-scale computational applications in bioinformatics, biosimulation, chemoinformatics and bio-medical sciences by utilizing distributed high-performance computing, high speed networks, massive data collections and archives CSCS manages GRID infrastructure Vital-IT has primary responsibility for providing bioinformatics Web services, validation and optimization Virtual Screening of Dengue Virus Target Proteins Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Vital-IT in SystemsX ETHZ, Uni ZH, UniBS (and others to come…) CHF 10 mio funding for 2006-07 Scientific Nodes Glue Projects (planned) Center of Biosystems Competence Center for Systems Physiology Center for Model Organism Proteomics Institute for Molecular Systems Biology Center for Information Sciences and Databases Center for Molecular Analysis and Bioinformatics Center for Cellular Nano Analytics Vital-IT will collaborate to provide core computing resources for SystemsX Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Thank you… THANK YOU http://www.isb-sib.ch Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics ExPASy server Expert Protein Analysis System http://www.expasy.org Access Statistics January 31, 2006 Total number of connections since August 1993: June 2006 (connections) 743’605’459 22’190’251 (approx. 9/sec) Mirror sites: USA, Canada, Australia, China, Brasil Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics access to ExPASy 24'000'000 connections 20'000'000 16'000'000 12'000'000 8'000'000 4'000'000 0 01.1993 01.1995 01.1997 01.1999 01.2001 01.2003 01.2005 year Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Country Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Peru Saudi Arabia Uruguay Iceland Lithuania Slovakia Estonia Romania Malaysia Colombia Croatia Chile Turkey Slovenia Thailand Hong Kong China Argentina Hungary New Zealand Ireland Portugal Russia Mexico Greece Czech Republic Norway India Korea (South) Singapore Poland Brazil Austria Finland Denmark Israel Belgium Taiwan Spain Australia Netherlands Sweden Italy Canada Japan France Switzerland United Kingdom Germany United States Connections ExPASy connections / country 1.0E+09 1.0E+08 1.0E+07 1.0E+06 1.0E+05 Country Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Aruba Tonga San Marino Cyprus Antigua and Barbuda Trinidad and Tobago Andorra Chile Slovakia Uruguay Malta Korea (South) Lithuania Poland Croatia Hong Kong Hungary Portugal Greece Luxembourg Japan Czech Republic Tuvalu Spain Estonia Italy Christmas Island Slovenia Taiwan New Zealand Ireland Australia France Norway Austria Germany Canada Belgium Netherlands United Kingdom Iceland Singapore United States Finland Israel Denmark Sweden Switzerland Niue Island Cocos (Keeling) Islands Connections / inhabitant ExPASy connections / country / inhab. 10.00 1.00 0.10 0.01 THANK YOU Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Thank you ! Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics The two components of bioinformatics macromolecular data banks Sequence data banks of DNA (EMBL/GenBank) or proteins (Swiss-Prot); genomes (FlyBase), 3D-structures (PDB), references (Medline), etc; software tools analysis of intrinsic properties of sequences comparison of sequences analysis and storage of gene expression data analysis and storage of proteomics data visualization and modeling of 3D-structures Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Genome analysis Signal search analysis (SSA) a method to discover and characterize sequence motifs that occur at a constrained distance from a physiological site, for instance a transcription initiation site. The Eukaryotic Promoter Database (EPD) Philipp Bucher a database of experimentally characterized eukaryotic promoters (transcription initiation site). CleanEx: a database of heterogeneous gene expression data, based on a consistent gene nomenclature. Provides access to public gene expression data via unique gene names. Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Genome Analysis Erik van Nimwegen – Biozentrum U.Basel Genome-wide predictions of regulons in bacterial genomes, using comparative genomics. Identification and prediction of putative transcription factor binding sites on a genome-wide scale, using significantly conserved fragments between promoter regions of orthologous genes in related bacterial species. Scaling-laws in functional gene-content Comparison of the number of genes in different functional classes across genomes, ranging from the simplest bacteria to human. the number of genes in a given functional class is related to the total number of genes in the genome for a large number of highlevel functional classes. Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Regulation of gene expression Mihaela Zavolan – Biozentrum, U.Basel development of computational methods for genome-wide annotation of transcription factor binding sites in mammalian genomes analysis of the functionality of alternative splice forms. analyzing mouse, human and rat transcriptomes annotation of small RNA sequences obtained through largescale cloning, discovery of novel regulatory RNAs characterization of the downstream targets of miRNAs. Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics the Universal Protein Resource: UniProtKB The past 2 decades have seen the creation of Swiss-Prot and TrEMBL operated by researchers from the Swiss Institute of Bioinformatics (SIB) and the European Bioinformatics Institute (EBI), as well as the Protein Information Resource operated by the National Biomedical Research Foundation (NBRF). These groups are combining the strengths of each of their databases into a central public resource: the Universal Protein Resource or UniProtKB; Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Central Dogma of Molecular Biology: high-throughput data production (Genotype) Alternative Splicing DNA (Genome) ATTTTATTAATATAATTCTTAATAATTATAAAAAAAAAAAAAAAAAAACAACCAAAATATTATATTATTTTTTG TAAATATAAATTAAAAAAATGAAATTCCAACATACATTTATTGCATTATTATCACTATTAACATATGCAAATGC ATATGATTATTTCACAACAACATTGGCCAATCAAAATCCAGTTTGTGCTTCAGTAGATGTCATACAAAATGTTT GTACTGAGGTTTGTGGTAGATTTGTCCGTTACATTCCTGATGCTACCAATACAAATCAATTCACTTTTGCCGAA TATACTACAAACCAATGTACTGTTCAAGTAACACCAGCTGTAACAAATACATTTACTTGCGCTGATCAAACTTC TTCACATGCACTCGGTTCTGATTGGAGTGGAGTTTGTAAAATCACTGCCACACCCGCACCAACAGTTACACCAA CAGTTACACCAACAGTTACACCAACAGTAACACCAACACCAACAAATACACCAAATCCAACCCCGTCCCAAACA TCAACAACAACTGGTTCTGCTTCAACTGTTGTTGCAAGTTTATCACTCATTATTTTCTCAATGATTCTTTCCCT TTGTTAATTTTAAAAATAACAAATGGTAAAAATTATTTGGCATTTTCAAGTACAATTTTAAATTTTTCAAAAAA AAATAAAATTAAATAAATAATTAAATAAATTAATTAATAAAAAAAATAAAATTAAAACTTTTTTAATTTA Transcription RNA (Transcriptome) Post-translational modifications DNA sequencing microarrays AUUUUAUUAAUAUAAUUCUUAAUAAUUAUAAAAAAAAAAAAAAAAAAACAACCAAAAUAUUAUAUUAUUUUUUG UAAAUAUAAAUUAAAAAAAUGAAAUUCCAACAUACAUUUAUUGCAUUAUUAUCACUAUUAACAUAUGCAAAUGC AUAUGAUUAUUUCACAACAACAUUGGCCAAUCAAAAUCCAGUUUGUGCUUCAGUAGAUGUCAUACAAAAUGUUU GUACUGAGGUUUGUGGUAGAUUUGUCCGUUACAUUCCUGAUGCUACCAAUACAAAUCAAUUCACUUUUGCCGAA UAUACUACAAACCAAUGUACUGUUCAAGUAACACCAGCUGUAACAAAUACAUUUACUUGCGCUGAUCAAACUUC Translation Protein (Proteome) mass spectrometry MetLysPheGlnHisThrPheIleAlaLeuLeuSerLeuLeuThrTyrAlaAsnAla TyrAspTyrPheThrThrThrLeuAlaAsnGlnAsnProValCysAlaSerValAsp ValIleGlnAsnValCysThrGluValCysGlyArgPheValArgTyrIleProAsp AlaThrAsnThrAsnGlnPheThrPheAlaGluTyrThrThrAsnGlnCysThrVal GlnValThrProAlaValThrAsnThrPheThrCysAlaAspGlnThrSerSerHis AlaLeuGlySerAspTrpSerGlyValCysLysIleThrAlaThrProAlaProThr ValThrProThrValThrProThrValThrProThrValThrProThrProThrAsn ThrProAsnProThrProSerGlnThrSerThrThrThrGlySerAlaSerThrVal ValAlaSerLeuSerLeuIleIlePheSerMetIleLeuSerLeuCysEnd (Phenotype) Structure & “Function” Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Genome studies Signal search analysis (SSA) (P. Bucher) Eukaryotic Promoter Database (EPD) (P. Bucher) CleanEx: a database of heterogeneous gene expression data, based on a consistent gene nomenclature. (P. Bucher) Genome-wide predictions of regulons in bacterial genomes, using comparative genomics. (E. van Nimwegen) Scaling-laws in functional gene-content: Comparison of the number of genes in different functional classes across genomes, ranging from the simplest bacteria to human. (E. van Nimwegen) Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Regulation of gene expression (M. Zavolan) development of computational methods for genome-wide annotation of transcription factor binding sites in mammalian genomes analysis of the functionality of alternative splice forms. analyzing mouse, human and rat transcriptomes annotation of small RNA sequences obtained through largescale cloning, discovery of novel regulatory RNAs characterization of the downstream targets of miRNAs. Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Gene expression Storage and analysis of microarray data (M. Delorenzi) Discrimination and gene selection methods for cancer diagnosis (M. Recognition and prediction of genetic aberrations in gene expression data based on a hidden Markov model (M. Delorenzi) Development of knowledgebases and microarray data management/analysis solutions. (M. Primig) Delorenzi) Expression profiling of gametogenesis in yeast and mammals Identification of candidate genes for the regulation of fertility in mammals by large-scale expression profiling Development of a novel cross-species and subject-oriented approach to genome annotation and microarray data management. Microarray Data Management and Analysis System (MIMAS) Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Computational Systems Biology (F. Naef) Multi-dimensional functional data, i.e. from expression arrays, open the door to a systems level understanding of biological complexity. theoretical and computational methodologies for studying functional properties and design principles of genetic networks, relevant to cancer biology. Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Protein Identification using Mass Spectrometry protein from gel/ PVDF/LC fraction tryptic digestion & peptide extraction 1-DE, 2-DE, LC PMF identification Mass spectrometry, peptide mass fingerprints MS/MS identification TYGGAAR EHICLLGK GANK PSTTGVEMFR unmodified and modified peptides MS Fragmentation Mass spectrometry, peptide MS fragments Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Protein 3D-structure prediction by homology Homology modeling = Comparative protein modeling = Knowledge-based modeling Using experimental 3D-structures of related family members (templates), calculate a model for a new sequence (target): Swiss-Model Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics Free energy calculations Cytotoxic T Lymphocyte (CTL) activity against tumor cells TCR Peptide MHC X-ray structure of the T cell receptor (TCR) bound to a peptide – MHC complex Institut Suisse de Bioinformatique Schweizerisches Institut für Bioinformatik Swiss Institute of Bioinformatics
