Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
From Gene to Protein How Genes Work AP Biology 2007-2008 What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA AP Biology proteins cells bodies The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? DNA AP Biology RNA protein trait 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum AP Biology "for their discovery that genes act by regulating definite chemical events" a a From gene to protein nucleus cytoplasm a a DNA mRNA a a a a a a a a a a a protein a a a a a a a trait AP Biology Transcription from DNA language to RNA language AP Biology 2007-2008 RNA ribose sugar N-bases ____________________ ____________________ ____________________ ____________________ lots of RNAs DNA AP Biology mRNA, tRNA, rRNA, siRNA… transcription RNA Transcription Making mRNA transcribed DNA strand = ___________________ enzyme __________________________ 5 C DNA G 3 A G T A T C T A 53 A G C A T C G T A C T 3 G C A U C G U C G T A G C A T T A C A G C T G A T A T 3 5 unwinding rewinding mRNA AP Biology build RNA G 5 RNA polymerase template strand Initiation ________________________ binding site before beginning of gene __________________________________ binding site for RNA polymerase AP Biology Elongation Match RNA bases to DNA bases on one of the DNA strands A G C A G G U U C A AG U C G A U A C 5' RNA A C C polymerase G A U 3' T G G T A C A G C T A G T C A T CG T A C CG T AP Biology U C Termination Eventually the RNA transcript is released and the polymerase detaches (complete mechanism still not fully known) AP Biology Eukaryotic genes have junk! Eukaryotic genes are not continuous ___________ = the real gene expressed / coding DNA ___________ = the junk inbetween sequence intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence AP Biology mRNA splicing Post-transcriptional processing eukaryotic mRNA needs work after transcription ______________________________ ______________________________ edit out introns ______________________________ intron = noncoding (inbetween) sequence ~10,000 base eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript AP Biology mature mRNA transcript ~1,000 base spliced mRNA Splicing must be accurate No room for mistakes! a single base added or lost throws off the _______________________ AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AP Biology AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP| RNA splicing enzymes snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' mature mRNA AP Biology exon 5' 3' exon 3' excised intron Alternative splicing _______________________________________ AP Biology when is an intron not an intron… different segments treated as exons More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the molecule ________________________________ ________________________________ 3' mRNA 5' AP Biology P G P P A a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome trait AP Biology