* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Chapter 17.
Survey
Document related concepts
Transcript
From Gene to Protein How Genes Work AP Biology 2007-2008 What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA AP Biology proteins cells bodies The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? DNA AP Biology RNA protein trait 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum AP Biology "for their discovery that genes act by regulating definite chemical events" a a From gene to protein nucleus cytoplasm a a DNA mRNA a a a a a a a a a a a protein a a a a a a a trait AP Biology Transcription from DNA language to RNA language AP Biology 2007-2008 RNA ribose sugar N-bases ____________________ ____________________ ____________________ ____________________ lots of RNAs DNA AP Biology mRNA, tRNA, rRNA, siRNA… transcription RNA Transcription Making mRNA transcribed DNA strand = ___________________ enzyme __________________________ 5 C DNA G 3 A G T A T C T A 53 A G C A T C G T A C T 3 G C A U C G U C G T A G C A T T A C A G C T G A T A T 3 5 unwinding rewinding mRNA AP Biology build RNA G 5 RNA polymerase template strand Initiation ________________________ binding site before beginning of gene __________________________________ binding site for RNA polymerase AP Biology Elongation Match RNA bases to DNA bases on one of the DNA strands A G C A G G U U C A AG U C G A U A C 5' RNA A C C polymerase G A U 3' T G G T A C A G C T A G T C A T CG T A C CG T AP Biology U C Termination Eventually the RNA transcript is released and the polymerase detaches (complete mechanism still not fully known) AP Biology Eukaryotic genes have junk! Eukaryotic genes are not continuous ___________ = the real gene expressed / coding DNA ___________ = the junk inbetween sequence intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence AP Biology mRNA splicing Post-transcriptional processing eukaryotic mRNA needs work after transcription ______________________________ ______________________________ edit out introns ______________________________ intron = noncoding (inbetween) sequence ~10,000 base eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript AP Biology mature mRNA transcript ~1,000 base spliced mRNA Splicing must be accurate No room for mistakes! a single base added or lost throws off the _______________________ AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AP Biology AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP| RNA splicing enzymes snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' mature mRNA AP Biology exon 5' 3' exon 3' excised intron Alternative splicing _______________________________________ AP Biology when is an intron not an intron… different segments treated as exons More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the molecule ________________________________ ________________________________ 3' mRNA 5' AP Biology P G P P A a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome trait AP Biology