* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA to Protein
Zinc finger nuclease wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
DNA nanotechnology wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA replication wikipedia , lookup
Microsatellite wikipedia , lookup
DNA to Protein AP Biology Monday, Dec. 9th • Objective: Students will learn the sequence and importance of the various experiments that lead to the discovery of the structure and function of DNA. – Go Over Test – Morgan’s Flies Debate DNA vs. Protein – The Answer • • • • • Griffith’s Experiment Oswald Avery Hershey, Chase Chargaff Rosalind Franklin; Watson and Crick • Recycled DNA Model Nucleotide • Polynucleotide? • “We are machines built by DNA whose purpose is to make more copies of the same DNA...This is exactly what we are for. We are machines for propagating DNA, and the propagation of DNA is a self-sustaining process. It is every living object's sole reason for living.” -Richard Dawkins, The Selfish Gene Watson and Crick • “It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material” Tuesday, Dec. 10th • Objective: Students will understand the structure of DNA and the preliminaries of DNA replication. – Complete Recycled Model of DNA (Due at the end of the period) • • • • • • • Nucleotide built correctly Correct sequence in the backbone Base pairing correctly identified Double helix structure 5’ and 3’ ends correctly orientated in antiparallel directions Highlight a nucleotide 5 rungs of the ladder Wednesday, Dec. 11th • Objective: Students will understand the process of DNA replication. – Discussion • Explain the experiment that revealed how the original strand of DNA was used in the replication of DNA. Figure 13.10 Parent cell (a) Conservative model (b) Semiconservative model (c) Dispersive model First replication Second replication Figure 13.9-3 A T A T A T A T C G C G C G C G T A T A T A T A A T A T A T A T G C G C G C G C (a) Parental molecule (b) Separation of parental strands into templates (c) Formation of new strands complementary to template strands • Describe the structure of a nucleoside triphosphate and determine the only way that it can be added to a growing strand (See Diagram). Name the type of enzyme that completes this addition. • http://www.youtube.com/watch?v=OnuspQG 0Jd0 • Compare and Contrast the Leading strand with the lagging strand. • Create a diagram to describe the process of DNA Replication. Use in your diagram the following structures: – – – – – – – – Origins of Replication Replication Fork DNA Polymerase DNA Ligase Primase Helicase Topoisomerase Single-strand binding protein Figure 13.16b-1 3 1 Primase makes RNA primer. 5 Template strand 3 5 Figure 13.16b-2 3 1 Primase makes RNA primer. 5 Template strand 3 3 5 RNA primer for fragment 1 2 DNA pol III makes Okazaki fragment 1. 5 3 5 Figure 13.16b-3 1 Primase makes 3 RNA primer. 5 Template strand 3 3 5 RNA primer for fragment 1 2 DNA pol III makes Okazaki fragment 1. 5 3 5 3 3 DNA pol III detaches. 5 Okazaki fragment 1 3 5 Figure 13.16c-1 5 3 RNA primer for fragment 2 Okazaki 4 DNA pol III fragment 2 makes Okazaki fragment 2. 3 5 Figure 13.16c-2 5 3 RNA primer for fragment 2 Okazaki 4 DNA pol III fragment 2 makes Okazaki fragment 2. 3 5 5 3 5 DNA pol I replaces RNA with DNA. 3 5 Figure 13.16c-3 5 3 RNA primer for fragment 2 Okazaki 4 DNA pol III fragment 2 makes Okazaki fragment 2. 3 5 5 5 DNA pol I 3 replaces RNA with DNA. 3 5 6 DNA ligase forms 5 3 bonds between DNA fragments. 3 5 Overall direction of replication Figure 13.17 Leading strand template Single-strand binding proteins Leading strand Helicase Overview Origin of replication Lagging Leading strand strand Lagging strand Leading strand Overall directions of replication DNA pol III 5 3 3 Parental DNA Lagging strand template Primer 5 3 Primase 5 DNA pol III 3 5 Lagging strand DNA pol I DNA ligase 3 5 DNA Replication • http://www.youtube.com/watch?v=teV62zrm 2P0 Thursday, Dec. 12th • Objective: Students will understand the organization of DNA and chromosomes and the modern use of DNA Technology. – Bring Textbook and Reading guide Tomorrow. – Label Flies – GRRRRRRRRRRRR! – Discussion • How has the process of DNA replication, in eukaryotic cells, been linked to aging? • Is DNA replication always perfect? How are mistakes fixed? Figure 13.19-3 5 3 3 5 Nuclease 5 3 3 5 DNA polymerase 5 3 3 5 DNA ligase 5 3 3 5 On the White Board • Diagram how DNA is packed into a Chromosome. Label your diagram using the following terms: – – – – – – – – – – DNA Chromatin Heterochromatin Euchromatin Histones Nucleosome Linker DNA Chromosome Positive Charge Negative Charge Figure 13.21 Chromatid (700 nm) DNA double helix (2 nm in diameter) Nucleosome (10 nm in diameter) 30-nm fiber Loops H1 Histones Histone tail Scaffold 300-nm fiber Replicated chromosome (1,400 nm) How is this structure different in a prokaryotic cell? • Would you eat food that has been genetically modified (GMO)? • Define Genetic Engineering, Gene Cloning, Recombinant DNA. • Identify possible uses for this technology Figure 13.22 Bacterium 1 Gene inserted into plasmid Bacterial chromosome Cell containing gene of interest DNA of chromosome (“foreign” DNA) Plasmid Recombinant DNA (plasmid) Gene of interest 2 Plasmid put into bacterial cell Recombinant bacterium 3 Host cell grown in culture to form a clone of cells containing the “cloned” gene of interest Gene of interest Protein expressed from gene of interest Copies of gene Protein harvested 4 Basic Gene for pest resistance inserted into plants Gene used to alter bacteria for cleaning up toxic waste research and various applications Human growth hormone treats stunted growth Protein dissolves blood clots in heart attack therapy • In five steps, layout the framework for creating recombinant DNA and placing that recombined DNA into a bacterial cell. Use all relevant vocabulary. Figure 13.23-1 Restriction site 5 3 GA AT TC C T TA AG DNA 3 5 1 Restriction enzyme cuts the sugar-phosphate backbones. 5 3 5 3 G C 5 3 G 3 Sticky end 5 Figure 13.23-2 Restriction site 5 3 GA AT TC C T TA AG DNA 3 5 1 Restriction enzyme cuts the sugar-phosphate backbones. 5 5 3 G C 3 G 5 3 3 Sticky end 5 5 3 2 DNA fragment added G from another molecule cut by same enzyme. Base pairing occurs. 5 3 3 5 3 5 3 5 G A AT T C C T TA A G G A AT T C C T TA A G 5 3 5 3 3 One possible combination 5 Figure 13.23-3 Restriction site 5 3 GA AT TC C T TA AG DNA 3 5 1 Restriction enzyme cuts the sugar-phosphate backbones. 5 5 3 G C 3 G 5 3 3 Sticky end 5 5 3 2 DNA fragment added G from another molecule cut by same enzyme. Base pairing occurs. 5 3 3 5 3 5 3 5 G A AT T C C T TA A G G A AT T C C T TA A G 5 3 5 3 3 5 One possible combination 3 DNA ligase seals the strands. 3 5 3 Recombinant DNA molecule 5 Gel Electrophoresis and PCR Figure 13.24 Mixture of DNA molecules of different sizes Power source Cathode Anode Wells Gel (a) Negatively charged DNA molecules will move toward the positive electrode. Restriction fragments (b) Shorter molecules are impeded less than longer ones, so they move faster through the gel. Figure 13.24a Mixture of DNA molecules of different sizes Power source Cathode Anode Wells Gel (a) Negatively charged DNA molecules will move toward the positive electrode. Figure 13.25 Technique 5 3 Target sequence Genomic DNA 1 Denaturation 3 5 5 3 3 5 2 Annealing Cycle 1 yields 2 molecules Primers 3 Extension New nucleotides Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence • What if we could bring the passenger pigeon or the woolly mamoth back from extinction, should we? Monday, Dec. 16th • Objective: Students will understand the connection of genes and proteins, and the physical process of creating genes from proteins. – Discussion DNA RNA Protein Phenotype • Label each cell as prokaryotic or Eukaryotic. • Label each structure and each process – processes are in the boxes. Figure 14.4 Nuclear envelope TRANSCRIPTION RNA PROCESSING DNA Pre-mRNA mRNA DNA TRANSCRIPTION mRNA Ribosome TRANSLATION Ribosome TRANSLATION Polypeptide Polypeptide (a) Bacterial cell (b) Eukaryotic cell Figure 14.5 DNA template strand 3 5 A C C A A A C C G A G T T G G T T T G G C T C A 5 3 TRANSCRIPTION U G mRNA G U U U G G C U C 3 5 Codon TRANSLATION Protein A Trp Amino acid Phe Gly Ser Second mRNA base A C U UUU U UUC First mRNA base (5 end of codon) UUA C Leu UAU UCC UCA UAC Ser UGU Tyr UGC U Cys C UAA Stop UGA Stop A UCG UAG Stop UGG Trp G CUU CCU CAU U CUC Leu CCC CCA Pro CAC CAA CUG CCG CAG AUU ACU AAU AUC IIe ACC AUA ACA AUG Met or start GUU G UCU UUG CUA A Phe G GUC GUA GUG AAC Thr ACG AAG GCU GAU GCC Val AAA GCA GCG GAC Ala GAA GAG CGU His Gln CGC CGA C Arg CGG AGU Asn Lys Asp Glu AGC AGA A G Ser Arg U C A AGG G GGU U C GGC GGA GGG Gly A G Third mRNA base (3 end of codon) Figure 14.6 3’-ATCGTATATTTTATGTACCATCAGTTTTGCATGCAATGCTTTATTTTTTTTTT-5’ Coding Segment: 5’(cap) GAUGGUAGACAAAACGUACGUUACGAAAUAAAAAAAAAA -3’ Figure 14.13 Small RNAs Spliceosome 5 Pre-mRNA Exon 2 Exon 1 Intron Spliceosome components mRNA 5 Exon 1 Exon 2 Cut-out intron Tuesday, Dec. 17th • Objective: Students will understand the how the yolk becomes a chicken in an egg. – Discussion • Write the following DNA sequence on your white board: – 3’-ATCGTATATTTTATGTACCATCAGTTTTGCATGCAATGCTTTATTTTTTTTTT-5’ • Initiation: On your DNA strand recreate the transcription initiation complex. Include transcription factors, promoter region, start point, TATA Box, RNA polymerase. • Elongation: Transcribe your DNA Strand • Termination: How is transcription terminated? • Now that you have a piece of pre mRNA on your white board, process the pre mRNA so that it is ready to leave the nucleus. 5’ cap, 3’ tail, Introns, Exons, UTR, Splicesome. • What is the evolutionary significance of RNA processing.? • • DNA 3’-ATCGTATATTTTATGTACCATCAGTTTTGCATGCAATGCTTTATTTTTTTTTT-5’ • http://www.youtube.com/watch?v=u9dhO0iC Lww What would happen to the reading frame if the following occurred: Base is substituted Missense vs. Nonsense Base inserted or deleted Frameshift mutation Wednesday, Dec. 18th •Count Flies 1. 2. 3. 4. Total Number Expected offspring Count and categorize Data Analysis and write up tomorrow. Thursday, Dec. 19th • Objective: Students will understand how to statistically analyze their fly data. – Discussion – Work Time • Chi Square Test Dihybrid Crosses have 4 possible phenotypes 4 – 1 = 3 degrees of freedom If the calculated chi square value is less than 7.82 you except your hypothesis (normal dihybrid cross) unlinked autosomal. Null hypothesis accepted your data meets the expected. If the calculated chi square value is greater than 7.82 you must reject your hypothesis. Probability 0.05 Degrees of Freedom 1 2 3.84 5.99 3 7.82 4 5 9.49 11.1 13.2 15.1 18.5 20.5 (= or less than) 0.01 6.64 9.21 .001 10.8 13.8 11.3 16.3 Thursday, Jan. 10th • Objective: Students will understand the steps I protein synthesis – Task Card – Discussion Friday, Jan. 11th • Objective: Students will understand the process of protein synthesis. – Discussion – Video. Translation: Give the function of the following terms in translation: Codon, tRNA, anticodon, aminoacyl-tRNA synthetase, ribosome, a site, p site, e site, Translocation, Using your mRNA Strand diagram the process of Translation. What would happen to the reading frame if the following occurred: Base is substituted Missense vs. Nonsense Base inserted or deleted Frameshift mutation 5’(cap) CAUGGUAGACAAAACGUACGUUACGAAAUAAAAAAAAAA -3’ Monday, Jan. 14th • Objective: Students will understand the process of protein synthesis. – 4 square – Video Translation 4 square • Define Transcription. – Name 1 Enzymes involved in transcription and its functions. – Use the following terms in a sentence: • Promoter, transcription factors, RNA polymerase, terminator • What is meant by the term RNA processing? – What is the difference between an intron and a exon? – What is the evolutionary significance of RNA processing? 4 square • Write a haiku that describes the process of translation. (57-5). • Draw a ribosome. Label: Large subunit, Small subunit, Asite, P-site, E-Site – What is the function of a ribosome • Draw a model of tRNA. Label anticodon, and amino acid. – How did the amino acid and tRNA molecule come together. • Draw and mRNA molecule attached to a ribosome include the following: – Growing polypeptide that is 4 amino acids long. – tRNA in the A site matching your mRNA with an amino acid. – What the tRNA would look like in the E site. • Write 2 sentences that describe the process of translation. Mutations What would happen to the reading frame if the following occurred: Base is substituted Missense vs. Nonsense Base inserted or deleted Frameshift mutation Wednesday , Jan. 8th • Objective: Students will understand the fundamental differences in gene regulation in Prokaryotes vs. Eukaryotes. – Fly Lab Due: Monday Jan. 13th – No Quiz this Friday – Next Test – Final Exam – Adding chapter on viruses. – Go Over Quiz – Discussion: Prokaryotes vs. Eukaryotes. Thursday , Jan. 9th • Objective: Students will understand the fundamental differences in gene regulation in Prokaryotes vs. Eukaryotes. – Fly Lab Due: Monday Jan. 13th – Discussion: Prokaryotes vs. Eukaryotes. Friday, Jan. 10th • Objective: Students will understand how eukaryotic cells regulate protein synthesis and connect this understanding to developmental biology. – Discussion • Review the steps in protein synthesis • Where can we regulate gene expression? • Can you make a hypothesis on how each step could be regulated? • Define chromatin, histones, and nucleosomes. • How could DNA packaging relate to gene regulation? • Histone Acetylation (COCH3) – Nuetralizes charges on histones tails.. – Releases nucleosome binding. – Makes the DNA available for transcription • Alternate histone acetylation • Methylation – opposite affect • Alternate patterns are passed on in a way that is not coded in nucleotide sequence (Epigenetic inheritance) • General Transcription factors – common to most genes • Turn on and Off: Control elements up stream from coding DNA (gene) • Enhancers: Non: Coding regions of DNA that initiate transcription when activated. • Activators: Proteins that bind to enhancers to activate gene expression • Repressors: Opposite activators. Compare the roles of general and specific transcription factors in regulating gene expression. Suppose you compared the nucleotide sequences of the distal control elements in the enhancers of three genes that are expressed only in muscle cells. What would you expect to find? Why? DNA sequences can act as “tape measures of evolution”. Scientist analyzing the human genome sequence were surprised to find that some of the regions of the human genome that are most highly conserved (similar to comparable regions in other species) don’t code for proteins. Propose a possible explanation for this observation. • http://www.youtube.com/watch?v=vizWoobt_Q Coordinated Control Alternate RNA Splicing • mRNA degradation – Enzymatic Shortening of Poly-A-tail (length) – Initiates removal of 5’ cap – Nuclease enzymes degrade mRNA • miRNA – will bind to mRNA and degrade molecule. Initiation of Translation • Regulatory proteins bind to specific sequences within the 5’ UTR’s • Activation or inactivation of protein factors needed for initiation complex. Protein Activation and Degradation • Protein Must be activated – generally phosphorylated. • Degradation: Marked with Ubiquitin and the taken apart by proteasome • Why would activation control of certain proteins be important? Monday, January 13th • Objective: Students will understand the connection of stems cells to embryonic development to gene regulation. – Collect Fly Lab – Assignment: Read Chapter on Viruses: Chapter 17 – Reading: The Great Debate Over Stem Cell Research • • • • What was the debate? What are the two sides? What do we need to know to be fully informed? Preliminary opinion. Where do Embryonic Stem Cells Come From? • http://www.youtube.com/watch?v=UgT5rUQ 9EmQ How does this information inform the debate on stem cells? Adult Stem Cells • Stems Cells = Pluripotent – Can give rise to all specialized cells within an organism. – Why stem cells? What hasn’t happened yet? – How do the cells know what to become? Cytoplasmic Determinants: Not homogenous (What are they?) Induction • Cells are influenced by signals received by nearby cells. How cells differentiate Using what we already know. Example of Cell Differentiation in Muscle Cells. Figure: 16.4 (pg. 314) Discuss and explain. Figure 16.4-1 Nucleus Master regulatory gene myoD Other muscle-specific genes DNA Embryonic precursor cell OFF OFF Figure 16.4-2 Nucleus Master regulatory gene myoD Other muscle-specific genes DNA Embryonic precursor cell Myoblast (determined) OFF OFF mRNA OFF MyoD protein (transcription factor) Figure 16.4-3 Nucleus Master regulatory gene myoD Other muscle-specific genes DNA Embryonic precursor cell Myoblast (determined) OFF OFF mRNA OFF MyoD protein (transcription factor) mRNA MyoD Part of a muscle fiber (fully differentiated cell) mRNA Another transcription factor mRNA mRNA Myosin, other muscle proteins, and cell cycle– blocking proteins The potential of Cloning Dolly the sheep. • What have been the problems? Why? • How would this ability change the debate on stem cell research? • Do we use embryonic stem cells or not? Cancer • Based on what you know, what do you think needs to happen to initiate cancerous growth in cells. – Make 2 specific hypothesis. Cancer and Viruses • What we know: – – – – Viruses play a role in approx. 15% of cancers Tumor Viruses – viral DNA into host DNA Viral DNA initiates tumor growth (oncogenes) In terms of viral survival why would a virus want to do this? – Viruses linked to: Lymphoma’s, cervical cancers, leukemia • Proto-oncogenes – code for proteins that stimulate normal cell growth and division. • How do proto–oncogenes become oncogenes? Proto-oncogene to a oncogene? Increase amount or activity (Promote) – – – – Translocation to a new more active promoter Gene Amplification Mutation in promoter or enhacer Mutation that changes protein activity • Tumor Suppressor Genes: – Mutations that decrease normal activity – contribute to cancer. • Prevent accumulation of cancer causing mutations • Control of adhesion of cells to each other • Cell Signaling pathway that inhibit cell cycle. • Two Examples: – Ras proto-oncogene: 30% of human cancers – Normal function vs. Mutation • p53 tumor supressing gene – Normal Vs. Mutation? • http://www.youtube.com/watch?v=2jCYocd13 Lw • Sequence of events in colon cancer: – Multiple mutations and steps to develop cancerous cells – Telemorase? Tuesday, Jan 15th • Objective: Students will relate the processes of DNA replication and Protein synthesis to viruses and viral reproduction. – Task Card – Discussion 27 deaths in Minnesota FLU • • • • What is it? What is its Structure? How does it work? http://www.youtube.com/watch?v=cE0qdqoB Fa8 Viruses • Draw a typical virus label its structures? – DNA or RNA – Capsid, protein coat – Animal - Viral envelopes derived from cell membrane of host • Diagram and explain a simplified reproductive cycle of a virus. • How is a virus different than a cell? Is a virus alive? Wednesday, Jan 16th • Objective: Students will be able to describe the life cycle of various viruses – Discussion – Read • Compare and Contrast the lytic and lysogenic life cycle of bateriophages? • In evolutionary terms which is the more advantagous cycle? • How is the viral envelope created in animal viruses? • HIV is a retrovirus, why do they call it a retrovirus? Why are retroviruses so hard to cure? Monday, Jan. 21st • Objective: Students will understand basic mutations that occur in the process of protein synthesis and investigate gene technology. – Understand basic principles: • DNA Cloning • Polymerase Chain Reaction • Gel Electrophoresis – Test Monday, Nov. 28th • Objective: Students will understand the importance, purpose, and process of DNA Replication. – Check Flies – Partner Q & A to the Group Q & A DNA Replication 1. Describe the structure of a nucleoside triphosphate and determine the only way that it can be added to a growing strand (See Diagram). Name the type of enzyme that completes this addition. Q & A DNA Replication 4. Compare and Contrast the Leading strand with the lagging strand. 5. Use the diagram to describe the process of DNA Replication. Use in your description the following structures or terms: • • • • • • • • Origins of Replication Replication Fork DNA Polymerase DNA Ligase Primase Helicase Topoisomerase Single-strand binding protein Q&A • How does DNA replication possibly contribute to the aging process? Tuesday, Nov. 29th • Objective: Students will understand the process of transcription and RNA processing. • What is happening here? Stop, Think, Label, Describe. Wednesday, Nov. 30th • Objective: Students will understand the process of RNA Splicing and Translation. – Task Card – Discussion What happens next? Build a working model of the translation process. • Must include: – Ribosome • Large and small subunit • A, P and E site – Outcome must be a polypeptide 6 amino acid long. – Appropriate tRNA and Amino Acids – Read mRNA 5’ to 3’ – Codons and Antiocodons – Moveable parts. – What did I miss? Thursday, Dec. 1st • Objective: Students will understand basic mutations that occur in the process of protein synthesis and investigate gene technology. – Present working model of translation – Review: • Point Mutations • Base-pair substitutions – Missense vs. Nonsense • Frameshift Mutations – Insertions vs. Deletions – Investigate and Understand basic principles: • DNA Cloning • Polymerase Chain Reaction • Gel Electrophoresis Test Starts Tomorrow Wednesday, Dec. 10th • Objective complete the fly lab. – Count flies and complete lab. Fruit Flies – Wild Type • Red Eyes • Brown Body color • Regular Wings Male vs. Female Male Female P – Vestigal Females X Sepia Males Apterous Females x Wild Males Apterous Female x Sepia Male White Eyed Females X Wild Males Vestigial Female X Ebony Male Vestigial Female X Sepia Male