* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA and Protein Synthesis
DNA repair protein XRCC4 wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA profiling wikipedia , lookup
DNA replication wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA nanotechnology wikipedia , lookup
Microsatellite wikipedia , lookup
DNA and Protein Synthesis A Brief Tutorial Background DNA is the genetic material. Sometimes called “the blueprint of life.” Used to help build everything the organism needs to function. Must remain in the nucleus. Structure of DNA Nucleotide 5 carbon sugar + phosphate group + nitrogenous base DNA sugar = deoxyribose Nitrogenous Bases = adenine, thymine, cytosine, guanine Nucleotides are linked together into shape of double-helix. Twisted Ladder Analogy A DNA Sequence DNA is really a pattern of repeating nucleotides. LADDER ANALOGY Science Aid: DNA Structure and Replication scienceaid.co.uk/biology/genetics2/dna.html The DNA molecule needs to coil and foldup so that it can fit into the small nucleus. The Double Helix The Ladder Latest from the Labs: Cells and DNA info.cancerresearchuk.org/.../cellsanddna/ Complementary Base-Pairing DNA molecule is double-stranded and “complementary” Adenine always pairs with Thymine (A=T) Cytosine always pairs with Guanine (G =C) Backbone/rails = alternating sugar/phosphate molecules Practice DNA Strands ATCCGTGCT GCGTAGCTGACCGCGATGACA DNA Replication How DNA makes a copy of itself Semi-conservative Replication 2 New DNA molecules each with 1 old strand and 1 new strand DNA Ladder unzips, enzymes come in and add new base pairs…. 2 new molecules! ANIMATION! DNA, RNA, and Protein Main Idea: DNA codes for RNA, which helps build proteins. Central Dogma How does the information stored in DNA get expressed in genes? DNA RNA RNA Protein is able to take the information stored in DNA out of the nucleus and go to the ribosome to help build proteins! RNA 5 carbon sugar = ribose Nitrogenous bases = adenine, uracil, cytosine, and guanine Single (not double) stranded 3 different forms: mRNA – messenger RNA tRNA- transfer RNA rRNA- ribosomal RNA Transcription DNA mRNA Information in DNA gets transcribed (or rewritten) into RNA language. C pairs with G A pairs with U Sample Transcription: AGCGTGAACGT Next, mRNA shuttles its message to the ribosome Translation mRNA Protein At the ribosome, information stored in mRNA molecule gets translated into a chain of amino acids (protein) with the help of tRNA. Steps Break mRNA molecule into 3 bases = codon Use the codon chart to determine what amino acid the tRNA molecule would bring to the ribosome to help build the protein. Protein Synthesis DNA Strand: AGTACCGCGTCATT Transcription Product: Translation Product: ANIMATE! Mutations A permanent change in the DNA of a cell Missense mutation: change in DNA results in wrong amino acid placed in protein. (Might still be ok….) Nonsense mutation: change in DNA causes translation to stop early. (VERY BAD) Point mutation base substitution (C instead of G) Addition/Deletion “Frame shifts”… cause change the multiple of three codons Tandem Repeats excessive repeating of sequences. Multiple Choice (Scantron) Analogy