* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Nucleic Acids bio
DNA repair protein XRCC4 wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA profiling wikipedia , lookup
DNA replication wikipedia , lookup
Microsatellite wikipedia , lookup
DNA nanotechnology wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA to PROTEIN CHAPTER 12  DEOXYRIBONUCLEIC ACID DNA: replication and protein synthesis Where have we seen DNA being replicated? MITOSIS AND MEIOSIS Building blocks of DNA: Nucleotides The sugar Deoxyribose The phosphate The nitrogenous bases The Purines Why are these called nitrogenous bases? The nitrogenous bases The Pyrimidines How are the pyrimidines different from the purines? Four different Nucleotides BASIC STRUCTURE DNA is a polymer formed by base pairing: Base pairing rule The Double Helix A. The overall shape of DNA is described as a double helix (a twisted ladder). B. What force holds the two strands together? How are DNA and RNA similar?  DNA is composed of nucleotides and RNA is composed of nucleotides How are DNA and RNA different? How are DNA and RNA different?  DNA…  Nucleotides = deoxyribose sugar  Double helix structure  Stays inside nucleus  RNA…  Nuleotides = ribose sugar  Single-strand structure  Located both inside and outside of nucleus  Uracil instead of thymine DNA Replication  Set up your DNA by applying the base pair rules Strand 1 A T C G G Complementary Strand 2 Enzymes involved in DNA replication  Helicase – opens the double helix to allow for replication  DNA polymerase – reads the original DNA strand and lays down complementary bases  Ligase – glues the newly formed DNA together DNA replication practice  You are DNA polymerase. Helicase has opened the DNA strand – read each side and produce the complementary copies. __________________________________ AGGTAACCGGTTACGATTAT TCCATTGGCCAATGCTAATA AGGTAACCGGTTACGATTAT TCCATTGGCCAATGCTAATA PARTNER PRACTICE  Person one uses their nucleotides as free nucleotides  Person two works with partner to replicate their original strand  Discuss the enzymes as you model the process Do # 9 IN YOUR NOTES TO PRACTICE BASE PAIRING RULES AGAIN __________________________________ A G T C C G T T A G T T C A G G C A A T C A Figure 12–7 Structure of DNA Section 12-1 Nucleotide Hydrogen bonds Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Use your text to complete the diagram and provide written details for the process shown Homework  Complete labeling of notes cover  Complete DNA replication labeling and details  Complete Section 10-1 Review – accuracy! Protein Synthesis= transcription and translation  DNA contains all the information for your traits – the genes  These genes are blueprints and need to remain safe – kept inside the nucleus  Copies can be made though – a messenger Genotype  Phenotype DNA mRNA tRNA PROTEIN Transcription (DNA to mRNA) Translation (mRNA – tRNA to protein) Concept Map Section 12-3 RNA can be Messenger RNA also called Ribosomal RNA which functions to mRNA Carry instructions also called which functions to rRNA Combine with proteins from to to make up DNA Ribosome Ribosomes Transfer RNA also called which functions to tRNA Bring amino acids to ribosome Transcription  #8 RNA polymerase reads one of the DNA strands and makes a complementary mRNA  #10 transcription details    Occurs in the nucleus The gene sequence on DNA gets transcribed Promoter region on DNA marks where transcription should start and terminator region marks where it should stop mRNA  RNA polymerase – key enzyme  mRNA is a “copy” of the gene sequence and can leave the nucleus  mRNA finds its way to a ribosme and the next step in making a protein can occur TRANSLATION CLICK ON PICTURE FOR ANIMATION ON TRANSCRIPTION mRNA  No T (thymine) so when it reads the nucleotide A on DNA it matches it with ____?  Do #11 in notes #12 – TRANSLATION and tRNA  Once mRNA is made it attaches to a ribosome  tRNA = transfer RNA and they carry amino acids  Amino acids are the building blocks of proteins (remember?) Translation  Ribosomes are the site of protein synthesis  Click here to see mRNA and tRNA work together at that ribosome to build a protein Codon = mRNA Anti-codon = tRNA Copy down this DNA sequence CAG GTG AAT TGG GGC CTC CAC TTT  This is the template strand of DNA, complete the complementary strand sequence below the template.  TRANSCRIPTION: read the template DNA strand and write the complementary mRNA  TRANSLATION: based on your mRNA, determine the proper amino acid sequence Copy this DNA sequence down CAG GTG AAT TGG GGC CAC CAC TTT REPEAT ALL THE STEPS AND DETERMINE THE AMINO ACID SEQUENCE FOR THIS GENE! COMPARE: what is the mistake?  CAG GTG AAT TGG GGC CTC CAC TTT  CAG GTG AAT TGG GGC CAC CAC TTT One incorrect amino acid GENOTYPE to PHENOTYPE Figure 12–20 Chromosomal Mutations Section 12-4 Deletion Duplication Inversion Translocation Let’s Review  DNA Structure is a _____ ______  DNA is composed of __________ What are four that make up DNA?     A T C G Figure 12–5 DNA Nucleotides Section 12-1 Purines Adenine Guanine Phosphate group Pyrimidines Cytosine Thymine Deoxyribose Figure 12–7 Structure of DNA Section 12-1 Nucleotide Hydrogen bonds Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Use your text to complete the diagram and provide written details for the process shown Concept Map Section 12-3 RNA can be Messenger RNA also called Ribosomal RNA which functions to mRNA Carry instructions also called which functions to rRNA Combine with proteins from to to make up DNA Ribosome Ribosomes Transfer RNA also called which functions to tRNA Bring amino acids to ribosome Figure 12–14 Transcription Section 12-3 Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) RNA polymerase DNA RNA
 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                            