Download DNA & Protein Synthesis

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

DNA repair protein XRCC4 wikipedia , lookup

Homologous recombination wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

Helicase wikipedia , lookup

DNA polymerase wikipedia , lookup

DNA replication wikipedia , lookup

Microsatellite wikipedia , lookup

DNA nanotechnology wikipedia , lookup

Helitron (biology) wikipedia , lookup

Replisome wikipedia , lookup

Transcript
DNA & Protein Synthesis
Gene to Protein
Nucleic Acids and Protein
Synthesis
• All functions of a cell are directed from
some central form of information.
• This "biological program" is called the
Genetic Code. - The way cell store
information regarding it's structure and
function.
History
• For years the source of heredity was
unknown. This was resolved after
numerous studies and experimental
research by the following researchers:
• Fredrick Griffith
– He was studying effects of 2 strains of an
infectious bacteria, the "smooth" strain was
found to cause pneumonia & death in mice.
The "rough" strain did not. He conducted the
following experiment
Griffith Experiment
Bacteria Strain injected into
mouse
Result
Smooth Strain
Mouse dies
Rough strain
Mouse Lives
Heat-Killed Smooth strain
Mouse lives
Rough Strain & Heat killed smooth
strain
*MOUSE
DIES*
•The last condition was unusual, as
he predicted that the mouse should
live
•Concluded that some unknown
substance was Transforming the
rough strain into the smooth one
Avery, McCarty & MacLeod
•Tried to determine
the nature of this
transforming agent.
Eg. Was it protein
or DNA?
•Degraded
chromosomes with
enzymes which
destroyed proteins
or DNA
•Samples with
Proteins destroyed
would still cause
transformation in
bacteria indicating
genetic material
was DNA
Hershey-Chase
• 1 virus was "tagged" with
32P on it's DNA
• The other was "tagged"
35S on it's protein coat.
• Researchers found the
radioactive P in the
bacteria, indicating it is
DNA, not protein being
injected into bacteria.
Watson & Crick
• The constituents of DNA had
long been known. Structure of
DNA, however was not.
• In 1953, Watson & Crick
published findings based on Xray analysis and other data
that DNA was in the form of a
"Double Helix".
• Their findings show us the
basic structure of DNA which is
as follows.
DNA Structure
• DNA is Formed of in a "Double Helix" - like a spiral staircase
Nucleotides
•
•
DNA is formed by
Nucleotides
These are made
from 3 components
1. A 5-Carbon Sugar
2. A Nitrogenous base
3. A Phosphate group
Nucleotide types:
•
For DNA There are 4 different Nucleotides categorized as either
Purines or Pyramidines. These are usually represented by a
letter. These Are:
1.
2.
3.
4.
Adenine (A)
Cytosine (C)
Guanine (G)
Thymine (T)
Base Pairing
• Each "Rung" of the DNA "staircase" is formed by the linking of 2
Nucleotides through Hydrogen Bonds.
• These Hydrogen bonds form only between specific Nucleotides.
This is known as Base Pairing. The rules are as follows:
– Adenine (A) will ONLY bond to Thymine (T) (by 2 hydrogen bonds)
– Cytosine (C) will ONLY bond to Guanine (G) (by 3 hydrogen
bonds)
Central dogma of genetics
• Central Dogma holds that genetic information is
expressed in a specific order. This order is as follows
There are some apparent exceptions to this.
Retroviruses (eg. HIV) are able to synthesize DNA from RNA
DNA Replication
•
•
•
•
•
•
•
•
•
•
•
•
DNA has unique ability to make copies of itself
This is a major "driving force" of living things.
Does so through the process of DNA Replication.
Complex process
DNA "Unzips itself" forming two strands with an exposed Nucleotide.
An nucleotide which forms the appropriate Base-pair bonds with the
exposed nucleotide. This is facilitated by the enzyme DNA Polymerase.
The process moves down the DNA molecule, and once complete, results in
two identical DNA strands.
Transcription proceeds continuously along the 5'3' direction (This is called
the leading strand)
Proceeds in fragments in the other direction (called the lagging strand) in
the following way
RNA primer attached to a segment of the strand by enzyme primase.
Transcription now continues in the 5'3' direction forming an okazaki
fragment. Until it reaches the next fragment.
The two fragments are joined by DNA ligase
DNA Replication
RNA Transcription
•
•
•
•
•
The cell does not directly use
DNA to control the function of the
cell.
DNA is too precious and must be
kept protected within the nucleus.
The Cell makes a working
"Photocopy" of itself to do the
actual work of making proteins.
This copy is called Ribonucleic
Acid or RNA.
RNA differs from DNA in several
important ways.
1. It is much smaller
2. It is single-stranded
3. It does NOT contain Thymine,
but rather a new nucleotide called
Uracil which will bind to Adenine.
RNA Transcription
•
•
•
•
RNA is produced through a process called RNA Transcription.
Similar to DNA Replication.
Small area of DNA "Unzips" exposing Nucleotides
This area is acted on by an enzyme called RNA Polymerase, which
binds nucleotides (using uracil) to their complimentary base pair.
• This releases a long strand of Messenger RNA (mRNA) which is an
important component of protein synthesis.
Protein Synthesis & The Genetic
Code
• The Sequence of nucleotides in an mRNA
strand determine the sequence of amino
acids in a protein
• Process requires mRNA, tRNA &
ribosomes
mRNA
• Each three
Nucleotide
sequence in an
mRNA strand is
called a "Codon"
Each Codon codes
for a particular
amino acid.
• The codon
sequence codes for
an amino acid using
specific rules.
These specific
codon/amino acid
pairings is called
the Genetic Code.
tRNA
•There is a special form of
RNA called Transfer RNA or
tRNA.
•Each tRNA has a 3
Nucleotide sequence on one
end which is known as the
"Anitcodon"
•This Anticodon sequence is
complimentary to the Codon
sequence found on the strand
of mRNA
•Each tRNA can bind
specifically with a particular
amino acid.
Ribosome
• Consists of two
subunits
– Large subunit
– Small subunit
• Serves as a template
or "work station"
where protein
synthesis can occur.
Protein Synthesis
•
Protein synthesis is a complex, many
step process, it is as follows.
–
An mRNA strand binds to the large &
small subunits of a ribosome in the
cytoplasm of the cell
•
–
A tRNA molecule with an attached
amino acid binds to the mRNA strand.
•
–
–
–
–
–
This occurs at the AUG (initiation)
codon of the strand.
Note: This occurs with complimentary
codons & anti-codons.
Another tRNA binds to the adjacent
codon of the mRNA
A peptide bond is formed between the
amino acids
The first tRNA is released, and another
tRNA binds next to the second, another
peptide bond is formed.
This process continues until a stop
codon is reached.
The completed polypeptide is then
released.
Replication Problem
• Given a DNA strand with the following nucleotide
sequence, what is the sequence of its complimentary
strand?
• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’
Answer
• Given a DNA strand with the following nucleotide
sequence, what is the sequence of its complimentary
strand?
• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’
• 5’- ATGGTGCACCTGACTCCTGAGGAGAAGTCT -3’
RNA Transcription Problem
• Given a DNA strand with the following nucleotide
sequence, what is the sequence of its complimentary
mRNA strand?
• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’
ANSWER
• Given a DNA strand with the following nucleotide
sequence, what is the sequence of its complimentary
mRNA strand?
• 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’
• 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’
Codon / Anticodon
• Given a mRNa strand with the following
nucleotide sequence, what are the sequence
(anticodons) of its complimentary tRNA strands?
• 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’
Answer
Given a mRNA strand with the following nucleotide
sequence, what are the sequence (anticodons)
of its complimentary tRNA strands?
3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’
Protein Translation
• Given the following
sequence of mRNA,
what is the amino
acid sequence of the
resultant
polypeptide?
• AUGGUGCACCUGA
CUCCUGAGGAGAA
GUCU
Protein Translation / Answer
• Given the following
sequence of mRNA,
what is the amino
acid sequence of the
resultant
polypeptide?
• AUGGUGCACCUGA
CUCCUGAGGAGAA
GUCU
Met-val-his-leu-thr-pro-glu-glu-lys-ser