* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download RNA
DNA repair protein XRCC4 wikipedia , lookup
DNA sequencing wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA profiling wikipedia , lookup
DNA replication wikipedia , lookup
Microsatellite wikipedia , lookup
DNA nanotechnology wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA/RNA DNA RNA Watson & Crick Maurice Wilkins & Rosalind Franklin Rosalind Franklin Chargaff’s Rule of Ratios From analytic studies Edwin Chargaff (1952) determined that the: Amount of Adenine always equals the amount of Thymine Amount of Cytosine always equals the amount of Guanine The amount of A-T is independent of the amount of C-G Erwin Chargaff, an American biochemist DNA: replication and protein synthesis Where have we seen DNA being replicated? MITOSIS AND MEIOSIS Building blocks of DNA: Nucleotides The sugar Deoxyribose The phosphate The nitrogenous bases The Purines Why are these called nitrogenous bases? The nitrogenous bases The Pyrimidines How are the pyrimidines different from the purines? Four different Nucleotides BASIC STRUCTURE DNA is a polymer formed by base pairing: Base pairing rule The Double Helix A. The overall shape of DNA is described as a double helix (a twisted ladder). B. What force holds the two strands together? DNA Nucleotides Section 12-1 Purines Adenine Guanine Phosphate group Pyrimidines Cytosine Thymine Deoxyribose DNA Replication ANIMATION ANIMATION DETAILED Enzymes involved in DNA replication Helicase – opens the double helix to allow for replication DNA polymerase – reads the original DNA strand and lays down complementary bases Ligase – glues the newly formed DNA together DNA replication practice You are DNA polymerase. Helicase has opened the DNA strand – read each side and produce the complementary copies. __________________________________ AGGTAACCGGTTACGATTAT TCCATTGGCCAATGCTAATA AGGTAACCGGTTACGATTAT TCCATTGGCCAATGCTAATA 12.2 (part 2) - The Structure of DNA Solving the Structure of DNA Three scientists who worked to solve the structure of DNA were Rosalind Franklin, James Watson, and Francis Crick. Franklin found clues. These clues helped Watson and Crick explain the structure and properties of DNA. 12.2 (part 2) - The Structure of DNA A Venn diagram is made up of overlapping circles. It is a useful tool for comparing two or even three topics. In the space where the circles overlap, write the features that the topics share. In the space where the circles do not overlap, write the features that are unique to each topic. built a three-dimensional model of DNA helped determine the shape of a DNA molecule photographed DNA using X-ray diffraction showed that DNA is a double helix studied DNA’s structure and properties 12.2 (part 2) - The Structure of DNA Complete the Venn diagram using phrases from the word box. photographed DNA using X-ray diffraction - studied DNA’s structure and properties helped determine the shape of a DNA molecule showed that DNA is a double helix built a threedimensional model of DNA How are DNA and RNA similar? DNA is composed of nucleotides and RNA is composed of nucleotides IN YOUR NOTES TO PRACTICE BASE PAIRING RULES AGAIN __________________________________ A G T C C G T T A G T T C A G G C A A T C A Let’s Review DNA Structure is a _____ ______ DNA is composed of __________ What are four that make up DNA? A T C G How are DNA and RNA different? DNA… Nucleotides = deoxyribose sugar Double helix structure Stays inside nucleus RNA… Nuleotides = ribose sugar Single-strand structure Located both inside and outside of nucleus Uracil instead of thymine How are DNA and RNA different? Transcription mRNA – stands for messenger RNA it is the copy of the DNA message for making a protein Occurs in the nucleus Promoter region on DNA marks where transcription should start and terminator region marks where it should stop mRNA Transcribes DNA message and carries it to ribosome RNA polymerse is the enzyme that produces it CLICK ON PICTURE FOR ANIMATION ON TRANSCRIPTION mRNA No T (thymine) so when it reads the nucleotide A on DNA it matches it with ____? Protein Synthesis= transcription and translation DNA contains all the information for your traits – the genes These genes are blueprints and need to remain safe – kept inside the nucleus Copies can be made though – a messenger Genotype Phenotype DNA mRNA tRNA PROTEIN Transcription Translation tRNA Once mRNA is made it attaches to a ribosome tRNA = transfer RNA and they carry amino acids Amino acids are the building blocks of proteins (remember?) Translation Ribosomes are the site of protein synthesis Click here to see mRNA and tRNA work together at that ribosome to build a protein Codon = mRNA Anti-codon = tRNA Comparing RNA & DNA DNA Nucleotide Deoxyribose RNA X X Ribose X Single-stranded Double-stranded Nitrogenous bases X X X X X Comparing RNA & DNA DNA Thymine RNA X Uracil Template for synthesis of nucleic acid Double helix Replication Transcription X X X X X X Comparing RNA & DNA DNA RNA Exact Copy X Messenger More Than 1 Form Found in Nucleus X X X Leaves Nucleus X X Does not Leave X Figure 12–7 Structure of DNA Section 12-1 Nucleotide Hydrogen bonds Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Figure 12–14 Transcription Section 12-3 Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) RNA polymerase DNA RNA Do Now Begin - RNA Concept Map can be also called which functions to from also called to which functions to to make up also called which functions to RNA Concept Map RNA can be mRNA rRNA also called which functions to Messenger RNA Carry instructions from DNA also called Ribosomal RNA tRNA which functions to also called which functions to Combine with protein Transfer RNA Brings amino acids to the ribosome to to make up Ribosomes Ribosomes Chromosomal Mutations Deletion Duplication Inversion Translocation