Download Human cytomegalovirus mediates cell cycle progression through G1

Journal
of General Virology (2000), 81, 1553–1565. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Human cytomegalovirus mediates cell cycle progression
through G1 into early S phase in terminally differentiated cells
John Sinclair,1 Joan Baillie,1 Linda Bryant1 and Richard Caswell2
1
2
Department of Medicine, University of Cambridge, Level 5, Addenbrookes Hospital, Hills Road, Cambridge CB2 2QQ, UK
Cardiff School of Biosciences, University of Cardiff, Cardiff, UK
Terminal differentiation of embryonal carcinoma cells and monocytes has been shown to be
important for their permissiveness for human cytomegalovirus (HCMV) infection, even though such
terminally differentiated cells have withdrawn from the cell cycle and are, essentially, in G0 arrest.
Recently, data from a number of laboratories have shown that productive infection with HCMV of
quiescent fibroblasts held reversibly in G0 of the cell cycle can result in cell cycle progression, which
results eventually in cycle arrest. In contrast to quiescent fibroblasts, the effect of HCMV on cells
that have withdrawn irreversibly from the cell cycle due to terminal differentiation has not, so far,
been addressed. Here, it is shown that, in cells that have arrested in G0 as a result of terminal
differentiation, HCMV is able to induce cell functions associated with progression of the cell
cycle through G1 into early S phase. This progression is correlated with a direct physical and
functional interaction between the HCMV 86 kDa major immediate-early protein (IE86) and the
cyclin-dependent kinase inhibitor p21Cip1.
Introduction
Human cytomegalovirus (HCMV) is a ubiquitous pathogen
that, like other members of the herpesvirus family, persists
after infection throughout the lifetime of the host. Although
primary infection of healthy individuals is usually asymptomatic, infection or reactivation in immunocompromised individuals can cause severe or fatal disease and CMV disease is in
fact a major cause of morbidity and mortality in such
individuals (Griffiths & Grundy, 1988). Following infection of
permissive cells, viral gene expression follows a regulated
cascade through three distinct phases, immediate-early (IE),
early and late, resulting in the release of infectious virions. The
most abundant IE transcripts arise from the major IE region in
the unique-long (UL) region of the genome : transcripts
undergo differential splicing to give two major IE proteins, the
72 kDa IE1 and the 86 kDa IE86 (Stenberg et al., 1989 ; Stinski
et al., 1983 ; Wathen et al., 1981). Studies from many
laboratories, including our own, have shown that these
proteins are transcriptional regulators that transactivate a
number of HCMV and cellular promoters, in addition to
their autoregulation of the major IE promoter–enhancer
(Cherrington et al., 1991 ; Cherrington & Mocarski, 1989 ;
Author for correspondence : John Sinclair.
Fax j44 1223 336846. e-mail js!mole.bio.cam.ac.uk
0001-6862 # 2000 SGM
Colberg-Poley et al., 1992 ; Hagemeier et al., 1992 a, b ; Pizzorno
et al., 1988, 1991 ; Stenberg et al., 1990). Many of the cellular
gene products up-regulated by HCMV infection are implicated
in control of cell proliferation, e.g. c-fos, c-myc, dihydrofolate
reductase and DNA polymerase α (Boldogh et al., 1990 ; Geist
& Dai, 1996 ; Hayhurst et al., 1995 ; Monick et al., 1992 ; Wade
et al., 1992), and it is now clear that HCMV infection can result
in perturbation of the normal cell cycle (Albrecht et al.,
1976 ; Bresnahan et al., 1996 ; Dittmer & Mocarski, 1997 ; Jault
et al., 1995 ; Lu & Shenk, 1996 ; Morin et al., 1996 ; Poma et al.,
1996), presumably in order to optimize the cellular environment for virus replication.
It was reported several years ago that HCMV infection
results in stimulation of cellular DNA synthesis (Albrecht et al.,
1976), implying overriding of normal cell cycle control. This
effect has been studied recently in greater detail in quiescent
fibroblast cells that have been withdrawn reversibly from the
cell cycle by serum deprivation or contact inhibition (Bresnahan
et al., 1996 ; Dittmer & Mocarski, 1997 ; Jault et al., 1995 ; Morin
et al., 1996 ; Poma et al., 1996). In these analyses, infection
resulted in cell cycle progression through G leading eventu"
ally to an arrest of the cell cycle in either late G or G \M
"
#
(Bresnahan et al., 1996 ; Dittmer & Mocarski, 1997 ; Jault et al.,
1995 ; Morin et al., 1996 ; Poma et al., 1996 ; Wiebusch &
Hagemeier, 1999). Also, in cycling cells, it has been reported
that HCMV may block the cell cycle at multiple points,
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 19:52:01
BFFD
J. Sinclair and others
depending on the stage of the cell cycle at which infection
occurred (Lu & Shenk, 1996 ; Salvant et al., 1998). To date, all
studies on the effects of HCMV infection on the cell cycle of
arrested cells have been carried out in quiescent primary
fibroblasts. However, in vitro and in vivo, there is good
evidence that permissiveness for HCMV infection in a number
of cell types is dependent on terminal differentiation (Sinclair &
Sissons, 1996 ; Soderberg-Naucler et al., 1997) and terminal
differentiation essentially blocks cells in the G \early G phase
!
"
of the cell cycle (el-Deiry et al., 1995). So far, there have been
no reports analysing the effect of HCMV infection on cells
withdrawn irreversibly from the cell cycle by differentiation, a
cell type that clearly plays an important role in vivo in HCMV
infection (Sinclair & Sissons, 1996 ; Soderberg-Naucler et al.,
1997).
Progression through the cell cycle is regulated by cyclins
and their associated cyclin-dependent kinases (Cdks). Cdks are
only active when complexed with their particular cyclin
partner (Cordon-Cardo, 1995 ; Pines, 1993 ; Sherr, 1993) and
progression through the cell cycle occurs as a result of
phosphorylation by Cdks of specific substrate molecules such
as the retinoblastoma-susceptibility protein Rb. This in turn
results in a specific sequence of cellular events related to the
particular stage of the cell cycle. However, although formation
of a cyclin–Cdk complex is a requirement, kinase activity does
not simply follow cyclin levels. Other regulatory steps are also
involved ; these include activation of the cyclin–Cdk complex
by phosphorylation and de-phosphorylation of specific sites
on Cdks or inhibition by interaction with so-called Cdk
inhibitors such as p21Cip", p16Ink% and p27Kip" (CordonCardo, 1995 ; Pines, 1993 ; Sherr, 1993). Generally, high levels
of Cdk activity are indicative of cell cycle progression, while
terminally differentiated or quiescent cells have low levels of
Cdk activity and elevated levels of mitotic inhibitors.
In recent years, it has become clear that many viral
oncoproteins act by targetting cell cycle regulatory factors
(DeCaprio et al., 1988 ; Whyte et al., 1988). For instance,
adenovirus E1A can induce cell cycle progression in G !
arrested cells that have withdrawn from the cell cycle as a
result of serum-deprivation or differentiation (Crescenzi et al.,
1995 ; Rao et al., 1992 ; Stein et al., 1990). In these arrested cells,
Rb is hypophosphorylated and, in this underphosphorylated
form, Rb binds and inactivates the cellular transcription factor
E2F. As E2F activates expression of a number of S phase genes,
Rb plays a major role in repressing gene expression associated
with the S phase of the cell cycle. Induction of cell cycle
progression by E1A is believed, in part, to be due to the fact
that E1A interacts physically with members of the Rb family of
proteins (Hu et al., 1990 ; Whyte et al., 1989). This results in a
release of functional E2F transcription factor, which would
normally be kept in an inactive form by interaction with Rb
family proteins during G . This release of E2F then results in
!
the expression of E2F-dependent S phase genes. More recently,
it has also been reported that, as well as targetting Rb directly
BFFE
to release active E2F, adenovirus E1A can interact directly with
Cdk inhibitors, such as p27Kip", resulting in p27Kip" inactivation and Rb phosphorylation, which can overcome TGFβ-mediated cell cycle arrest (Mal et al., 1996 b). Similarly,
human papillomavirus (HPV) E7 has been shown to prevent
inhibition of Cdk activity by both p21Cip" and p27Kip" (Funk
et al., 1997 ; Keblusek et al., 1999 ; Zerfass-Thome et al., 1996).
We and others have reported previously that E1A and IE86
have a number of properties in common. For instance, IE86 is
also known to interact physically and functionally with Rb and
p53 (Hagemeier et al., 1994 ; Muganda et al., 1994 ; Poma et al.,
1996 ; Sommer et al., 1994 ; Speir et al., 1994) in an manner
analogous to the known interaction of adenovirus E1A with
Rb. As discussed above, such interactions would be consistent
with inducing progression through G into early S phase.
"
Consequently, we have asked what effect HCMV infection has
on cells that have withdrawn irreversibly from the cell cycle
due to differentiation and, if HCMV does advance the cell
cycle in these cells, whether IE86 plays a similar role to E1A in
targetting inhibitors of Cdks. Here, we show that, in cells
arrested irreversibly in G as a result of terminal differentiation,
!
HCMV is able to induce cell functions associated with
progression of the cell cycle through G into early S phase and
"
that this is correlated with a direct physical and functional
interaction between the HCMV 86 kDa IE86 protein and the
Cdk inhibitor p21Cip".
Methods
Cell culture and virus infection. Cells of the human embryonal
carcinoma cell line NT2D1 (T2) were cultured in minimal essential
medium containing 10 % foetal calf serum (MEM-10) as described
previously (Kothari et al., 1991) and differentiated by addition of 10−' M
all-trans retinoic acid (RA) for 5 days. Primary human fibroblast cells
(MRC5) were cultured in MEM-10. Cells were infected with human
cytomegalovirus (AD169 strain) at an m.o.i. of 5 for 3 h. Virus was then
washed from infected cells and replaced with fresh medium. As controls,
cells were mock-infected with virus-conditioned control medium or
infected with UV-inactivated virus as described previously (Poma et al.,
1996).
Immunfluorescence. MRC5 or T2jRA cells were infected with
HCMV for 24, 48, 72 and 96 h. Cells were fixed in 4 % paraformaldehyde
for 15 min, permeabilized in 70 % ethanol at k20 mC and then stained
with mouse monoclonal antibodies to UL69 (Winkler et al., 1994), a
55 kDa viral late protein (Chemicon) or IE72 (Biosys). Antibodies were
detected by using anti-mouse FITC conjugate.
Analysis of DNA content. Infected or uninfected cells were fixed
in 70 % ice-cold ethanol, treated briefly with RNase and stained with
propidium iodide (PI) as described previously (Poma et al., 1996).
Infected or uninfected cells were also treated for 24 h with 10 µM 5bromo-2h-deoxyuridine (BrdU) at 24 h post-infection (p.i.). Cells were
then harvested and total DNA was isolated. DNA was restricted with
SmaI and separated on 0n6 % agarose gels and DNA fragments were
transferred to nitrocellulose by blotting. Blots were then probed with a
monoclonal antibody to BrdU (Harlan Sera Laboratories) and antibody
was detected by chemiluminescence with an ECL detection kit, as detailed
by the manufacturer (Amersham).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 19:52:01
Cytomegalovirus and the cell cycle
Western blotting. Infected or uninfected cells were harvested by
scraping, washed once in ice-cold PBS and resuspended in SDS–PAGE
sample buffer. Protein samples were separated on 10 or 15 % polyacrylamide gels, blotted onto nitrocellulose and probed with monoclonal
antibodies to Rb protein (Santa Cruz) or a monoclonal antibody that
recognizes exon 2 of the HCMV IE72 and IE86 proteins (Hayhurst et al.,
1995).
GST-fusion proteins. pGEX-3X.IE2, used to generate recombinant
IE86 protein, has been described previously (Caswell et al., 1993). pGSTp21, p-GST-p21N and pGST-p21C were gifts of A. Dutta and have also
been described previously (Chen et al., 1996). GST–p27kip" was a gift of
Tony Hunter (Mal et al., 1996 b). Recombinant GST or GST-fusion
proteins were purified by using glutathione–Sepharose beads and eluted
with glutathione (Smith & Johnson, 1988).
GST-fusion protein interaction assays. Protein–protein interaction assays were carried out exactly as described previously (Caswell
et al., 1993). Vectors to generate [$&S]methionine-labelled IE72, IE86,
gelsolin and E1A (13S) by coupled in vitro transcription\translation
(Promega) have also been described previously (Caswell et al., 1993).
Immunoprecipitations and histone H1 kinase assays. Total
cellular extracts were prepared from undifferentiated or differentiated
cells in EBC buffer as described previously (Hagemeier et al., 1994).
Extracts were immunoprecipitated for 2–3 h at 4 mC with anti-Cdk2, antiCdK4, anti-cyclin E or anti-cyclin A antibodies (Santa Cruz) followed by
incubation at 4 mC for 1 h with protein A–Sepharose (Pharmacia).
Immunoprecipitates were then assayed for their kinase activity by using
histone H1 as substrate, essentially as described previously (Mal et al.,
1996 b).
Yeast two-hybrid interaction assay. Experiments were carried
out using the Matchmaker yeast two-hybrid system (Clontech) with
expression vectors that had been modified in the multiple cloning site.
Plasmid pGAD424 was digested with EcoRI and BamHI and then ligated
with a double-stranded adaptor of sequence 5h AATTTGGGATCCCCGGGAATTC 3h (sense strand) and 5h GATCGAATTCCCGGGGATCCCA 3h (antisense strand). The recombinant plasmid, pGAD425, was
then digested with BamHI and EcoRI and ligated with a BamHI–EcoRI
IE2 cDNA fragment from pGEX3X-IE2 (Caswell et al., 1993) to generate
pGAD-IE2. Similarly, pGAD-IE1 was made by cloning the BamHI–EcoRI
IE1 cDNA fragment from pGEX3X-IE1 (Caswell et al., 1993) into
pGAD425. The GAL4 DNA-binding domain–p21 fusion was made by
digestion of pGST-p21 (Chen et al., 1996) with BamHI and SalI and
cloning of the p21 cDNA fragment into the BamHI and SalI sites of
pGBT10, which has been described previously (Caswell et al., 1996).
pGBT10-IE86 has also been described previously (Caswell et al., 1996).
Other plasmids used were supplied with the Matchmaker kit. Yeast
transformations and quantitative liquid β-galactosidase assays were
carried out in Saccharomyces cerevisiae strain SFY526 exactly as described
by the manufacturers of the kit.
Results
HCMV induces cellular DNA synthesis in differentiated
embryonal carcinoma cells
The human embryonal carcinoma cell line NT2D1 (T2)
represents a good model system for differentiation-dependent
permissiveness for HCMV infection. Undifferentiated T2 cells
are non-permissive for HCMV infection due to a blockage in
major IE expression. However, differentiation of T2 cells for 5
days with RA (T2jRA), to a neuronal phenotype, lifts this
repression and cells become fully permissive for IE expression
and productive infection, although viral DNA replication is
delayed (Gonczol et al., 1984 ; LaFemina & Hayward,
1986 ; Nelson & Groudine, 1986). Consistent with previous
observations (Maerz et al., 1998 ; Spinella et al., 1999),
differentiation of T2 cells with RA for 5 days resulted in their
arrest in the G \G phase of the cell cycle (Fig. 1 b). However,
! "
infection with HCMV resulted consistently in a substantial
increase in the population of cells with a greater than G \G
! "
content of DNA as early as 24 h p.i. (Fig. 1 c). No such increase
was observed in cells infected with UV-inactivated virus (Fig.
1 b, d, f, h).
Whilst as many as 80 % of the T2jRA cell population
expressed viral IE antigens (Fig. 1 j), we wanted to determine,
specifically, whether the cells that were advancing through the
G \G restriction point were cells expressing IE antigens or
! "
were just bystander, uninfected cells. Consequently, we carried
out the analysis with T2jRA cells infected at a lower m.o.i.,
such that only 10–20 % of the cell population were infected
with HCMV. Fig. 1 (k–m) clearly shows that, when these cells
were analysed for DNA content as well as their expression of
IE1 protein, it was specifically the cells expressing IE1 that had
the greater than G \G content of DNA (compare Fig. 1 l and
! "
m).
In order to rule out that this apparent increase in cells in S
phase was due to viral DNA replication, we examined the
extent of viral DNA replication directly in infected T2jRA
cells at 48 h p.i. Fig. 2 shows that primary fibroblast cells
(MRC5) infected for 48 h with HCMV and labelled with BrdU
gave rise to specific viral DNA restriction fragments when
analysed by Southern blot detection for BrdU-labelled DNA
with an anti-BrdU antibody. This confirms high levels of viral
DNA replication in these fibroblast cells, as expected. In
contrast, however, T2jRA cells showed no such viral DNA
replication at 24–48 h p.i., consistent with the known extended
virus life cycle in these cells (Gonczol et al., 1984). Consequently, the increase in DNA content of T2jRA cells upon
infection with HCMV at 48 h p.i. cannot be attributed to viral
DNA synthesis.
It has been suggested that HCMV may induce cellular
DNA synthesis only in cells that are abortively infected
(Bresnahan et al., 1996). Whilst it has already been shown that
differentiated T2jRA cells are fully permissive for HCMV
infection (Gonczol et al., 1984 ; LaFemina & Hayward, 1986),
we wanted to confirm that the infected T2jRA population we
analysed was indeed productively infected. Fig. 3 (a) shows
that, consistent with this cell population undergoing productive infection, viral DNA replication centres were present
extensively in these infected T2jRA cells at 72 h p.i., as
determined by the presence of UL69, a known DNA replication
accessory protein (Sarisky & Hayward, 1996). Note that,
compared with fibroblast cells, the presence of viral DNA
replication centres occurred in T2jRA cells at later times of
infection, consistent with the delay in viral DNA replication in
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 19:52:01
BFFF
J. Sinclair and others
Events
(a)
T2
FL2 – Area
(c)
Events
T2 + RA
UV HCMV 24 h
T2 + RA
HCMV 24 h
Events
(b)
FL2 – Area
FL2 – Area
(e)
Events
T2 + RA
UV HCMV 48 h
T2 + RA
HCMV 48 h
Events
(d)
FL2 – Area
FL2 – Area
(g)
Events
T2 + RA
UV HCMV 72 h
T2 + RA
HCMV 72 h
Events
(f)
FL2 – Area
FL2 – Area
(i)
T2 + RA
UV HCMV 96 h
Events
Events
(h)
T2 + RA
HCMV 96 h
FL2 – Area
FL2 – Area
Fig. 1. For legend see facing page.
these cells. Fig. 3 (b) also confirms that these cells were
productively infected, as shown by the presence of high levels
of true late viral gene products in the infected population.
HCMV induces Rb phosphorylation in arrested
differentiated T2MRA cells
The Rb protein plays a major role in controlling progression
through the cell cycle. Rb is known to be hypophosphorylated
BFFG
in the G and early G phases of the cell cycle and progression
!
"
through G into S phase is associated with increased Rb
"
phosphorylation (Buchkovich et al., 1989 ; Chen et al., 1989 ;
DeCaprio et al., 1992). Similarly, hypophosphorylated Rb
protein induces cell cycle arrest (Goodrich et al., 1991 ; Hinds et
al., 1992). Consequently, levels of Rb phosphorylation have
been suggested to play a pivotal role in cell cycle progression
through the G \S checkpoint. Consistent with the known
"
G \G arrest of T2 cells by RA (Maerz et al., 1998 ; Spinella et
! "
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 19:52:01
Cytomegalovirus and the cell cycle
128
128
( j)
Events
UV HCMV 96 h
Events
UV HCMV 24 h
0
10 0
0
10 –1 10 –2 10 –3 10 –4 10 0 10 –1 10 –2 10 –3 10 –4
FL1 – Height
FL1 – Height
128
128
HCMV 96 h
Events
Events
HCMV 24 h
65 %
0
10 0
10 4
0
10 –1 10 –2 10 –3 10 –4 10 0
FL1 – Height
Fig. 1. Cytomegalovirus infection induces cell cycle progression.
(a)–(i) Undifferentiated (T2) or differentiated (T2jRA) cells were
infected with virus or UV-inactivated virus (AD169) at an m.o.i. of 10, as
shown. Cells were stained with PI and their DNA content was analysed
by FACS. The proportions of cells in S phase were 31 % (a ; T2), 2 %
(b ; T2jRA, 24 h UV-HCMV infection), 16 % (c ; T2jRA, 24 h HCMV
infection), 19 % (e ; T2jRA, 48 h HCMV infection), 21 % (g ; T2jRA,
72 h HCMV infection) and 23 % (i ; T2jRA 96 h HCMV infection).
(j) T2jRA cells were infected at an m.o.i. of 10 with virus or UVinactivated virus for 24 or 96 h. Cells were fixed and then stained with
an anti-IE1/2 antibody and analysed by FACS. The numbers of cells
expressing IE antigens are shown as percentages of the total cell
population. (k)–(m) T2jRA cells infected for 48 h (as shown in e) at an
m.o.i. of 2 were doubly stained with PI and an antibody specific for
HCMV IE1/2 (IE). IE-expressing cells were sorted (k) and cells
expressing IE (gate 2) or not expressing IE (gate 1) were analysed for
their DNA content. The DNA profile of cells in gate 1 is shown in (l) and
the DNA profile of cells in gate 2 is shown in (m).
80 %
10 –1 10 –2 10 –3 10 –4
FL1 – Height
(k)
512 (l )
256
(m )
IE 10 2
Events
Events
10 3
10 1
10 0
0
1023
PI
T2 + RA
1
2
1023
1023
PI
PI
al., 1999), Fig. 4 (a ; lanes 1 and 3) shows that differentiated
T2jRA cells contained predominantly hypophosphorylated
Rb, consistent with their withdrawal from the cell cycle.
Infection of these cells with HCMV resulted in an increase in
the hyperphosphorylated form of Rb as early as 24 h p.i. (Fig.
4 a ; lane 2). Levels of HCMV infection of the T2jRA cells
were confirmed by Western blotting with an anti-IE72\IE86
antibody (Fig. 4 b).
MRC5
1
2
HCMV infection induces cyclin-associated kinase
activity in differentiated T2MRA cells
–
+
–
+
HCMV
48 h
48 h
Fig. 2. Cellular DNA synthesis is induced by HCMV. T2jRA cells or
MRC5 cells were mock infected (lanes 1) or infected with HCMV for 48 h
(lanes 2). Cells were labelled with BrdU for 24 h prior to harvest and then
DNA was isolated, cut with SmaI and analysed by Southern blot with an
anti-BrdU antibody as probe.
Rb phosphorylation and subsequent progression through
the cell cycle are dependent on functional Cdks. In cells
arrested in G \G , Cdk activity is low. Cdk4 associated with
! "
the D-type cyclins is believed to be essential for G
"
progression, whereas Cdk2 associated with cyclin E is believed
to be important for progression through the G \S phase
"
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 19:52:01
BFFH
J. Sinclair and others
(a) MRC5
T2 + RA
24 h
48 h
72 h
96 h
(b) MRC5
T2 + RA
48 h
72 h
Fig. 3. For legend see facing page.
BFFI
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 19:52:01
96 h
Cytomegalovirus and the cell cycle
(a)
(b)
anti-RB
anti-IE
97
66
46
30
1
2
3
4
1
2
3
(a)
4
Fig. 4. HCMV infection induces Rb
phosphorylation. Differentiated T2jRA
cells were mock-infected (lanes 1 and 3)
or infected with HCMV at an m.o.i. of 5
(lanes 2 and 4) for 24 h (lanes 1 and 2)
or 48 h (lanes 3 and 4). Total cellular
protein was analysed by Western blot
with antibodies specific for Rb (a) or the
HCMV major IE1/2 protein (b).
(b)
Cdk2
Cyclin E
1
2
3
4
5
(c)
1
2
3
4
5
(d)
Cdk4
Cyclin A
1
2
3
4
5
1
2
3
4
5
Fig. 5. HCMV infection induces Cdk activity in arrested cells. Undifferentiated T2 cells (lanes 1) or differentiated T2jRA cells
were mock infected for 48 h (lanes 2) or infected with HCMV at an m.o.i of 5 for 17, 48 or 72 h (lanes 3–5, respectively).
Cell extracts were immunoprecipitated with anti-Cdk2 (a), anti-cyclin E (b), anti-Cdk4 (c) or anti-cyclin A (d ) antibodies.
Immunoprecipitates were then analysed for kinase activity by standard histone H1 kinase assays.
checkpoint (Sherr, 1993). We therefore asked whether the
increase in phosphorylated Rb in T2jRA cells resulting from
HCMV infection was a result of increased Cdk activity in these
arrested cells.
Fig. 5 confirms the known reduction in cyclin-associated
kinases that occurs upon differentiation of T2 cells with RA
(Spinella et al., 1999 ; Maerz et al., 1998). As expected,
differentiation led to a decrease in Cdk2 activity, which is
consistent with the Go\G arrest of these cells (Fig. 5 a, lane 2).
"
Similarly, cyclin E-associated kinase activity (Fig. 5 b, lane 2) as
well as Cdk4 and cyclin A-associated kinase activity (Fig. 5 c
and d, respectively ; lanes 2) were also reduced in differentiated
T2jRA cells, as expected. However, infection with HCMV
resulted in a clear increase in functional Cdk2 and cyclin Eassociated kinase activity (Fig. 5 a and b, respectively ; lanes 3)
as early as 17 h p.i., consistent with cell cycle progression
through the G \S checkpoint. This high level of Cdk2 and
"
cyclin E-associated kinase activity was maintained through the
initial 48 h of virus infection.
Similarly, cyclin A-associated kinase activity (Fig. 5 d ) was
also induced by HCMV infection, but this induction was
delayed and first occurred at 48 h p.i.
Fig. 3. MRC5 or T2jRA cells were infected with HCMV at an m.o.i. of 10 as shown, fixed and stained with monoclonal
antibodies to UL69 (a) or a 55 kDa true late protein (b). Antibodies were detected by using an anti-mouse FITC second layer.
Arrows in (b) show staining consistent with virus production centres.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 19:52:01
BFFJ
J. Sinclair and others
(a)
Input
GST – p21
GST – p27
GST – IE1
97
66
46
30
21·5
1
2
(b)
3
1
4
2
Input
3
4
1
2
3
4
1
2
3
4
GST – p21
97
66
46
30
21·5
1
2
(c)
3
4
5
6
1
Input
2
3
4
5
6
GST – p21N
GST – p21C
97
66
46
30
21·5
1
2
3
4
1
2
3
4
1
2
3
4
Fig. 6. HCMV IE86 interacts directly with p21Cip1 in vitro. (a) GST fusions to p21Cip1 (GST–p21), p27Kip1 (GST–p27) and
HCMV IE72 (GST–IE1) were used as binding targets for in vitro transcribed and translated gelsolin (lanes 1), adenovirus 13S
E1A (2) , IE86 (3) and IE72 (4). Input proteins (input) represent one-fifth of the total protein used in each assay.
(b) GST–p21 was used as a target for binding of in vitro transcribed and translated gelsolin (lanes 1), adenovirus 13S E1A (2),
IE72 (3), full-length IE86 (4), IE86 amino acids 1–290 (5) or IE86 amino acids 290–579 (6). Input proteins (input) are
shown. (c) N-terminal (GST–p21N) or C-terminal (GST–p21C) p21–GST fusions were used as binding targets for in vitro
transcribed and translated gelsolin (lanes 1), adenovirus 13S E1A (2), IE86 (3) or IE72 (4). Input proteins (input) are shown.
As expected, we have observed that infection of T2jRA
cells with HCMV resulted in Cdk4-associated kinase activity
that phosphorylated a GST–Rb target as early as 17 h p.i. (data
not shown). Interestingly, an increase in Cdk4 activity
targetting histone H1 also appeared to be induced by HCMV
infection (Fig. 5 c), although this induction was only observed
at 48 h p.i. We are aware that Cdk4 is not normally associated
with H1 kinase activity. We do not know why the immunoprecipitated Cdk4 complex is able to phosphorylate histone
H1 at this time of infection. It is possible that a viral product or
virus-induced product is able to target Cdk4 during infection,
allowing this complex to re-target kinase activity.
BFGA
HCMV IE86 binds p21Cip1 in vitro
Two classes of inhibitors of cyclin–Cdks are present in
multicellular organisms, the INK family, which includes p15
and p16, and a second family of proteins that includes p21Cip"
and p27Kip". p27Kip" and p21Cip" inhibitors are known to
interact with and inhibit Cdk2, Cdk4 and Cdk6, whereas the
INK family of inhibitors has no effect on Cdk2 (Pines,
1993 ; Sherr, 1993).
Recently, it has been shown that TGF-β-mediated arrest of
mink lung cells in late G , which is due to inactivation of
"
cyclin–Cdk complexes by the p27Kip" inhibitor, can be
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 19:52:01
Cytomegalovirus and the cell cycle
β-Galactosidase activity
50
(a)
IE2
40
0
30
20
10
0
GBT/
GAD
GBT/
IE2
p21/
GAD
p21/ LamC/ IE1/
IE2
IE2
IE2
IE2/
IE2
Fig. 7. HCMV IE86 interacts directly with p21Cip1 in vivo. Fusions between
the GAL4 DNA-binding domain (GBT) and the GAL4 activation domain
(GAD) were tested for β-galactosidase expression in yeast. In all cases,
full-length p21 protein was fused to GBT and full-length IE72 (IE1) or
IE86 (IE2) was fused to GAD. Additional negative and positive controls
included human lamin C (LamC)/GBT or IE86/IE86 double
transformations, respectively. Assays were developed for 4 h.
reversed by adenovirus 12S E1A protein, resulting in cell cycle
progression (Mal et al., 1996 b). This reversal of Cdk inhibition
has been shown to be mediated by a direct interaction between
E1A and p27Kip" proteins, whereby E1A prevents p27Kip"
from inhibiting the cyclin–Cdk2 complex. As we and others
have shown a number of functional similarities between
adenovirus E1A and HCMV IE86, we asked whether IE86
could also interact physically with cyclin–Cdk inhibitors. We
carried out protein–protein interaction assays with GST–p21
fusion proteins as bait for [$&S]methionine-labelled proteins.
Fig. 6 (a) shows that, in contrast to adenovirus 12S E1A, which
has been shown to interact specifically with p27Kip" (Mal et al.,
1996 b), IE86 interacted specifically with GST–p21 (lane 3) but
not with GST–p27 or an additional negative control, GST–IE1.
In contrast, experiments using in vitro transcribed and translated cyclin A or Cdk2 showed clear specific binding to both
GST–p27 and GST–p21, as expected (data not shown). We
observed no such interaction between GST–p21 and a number
of negative-control proteins such as gelsolin or HCMV IE1
(lanes 1 and 4, respectively). Interestingly, in our experiments,
in which adenovirus 13S E1A protein was used as a positive
control, we observed a specific interaction between 13S E1A
and GST–p21, but not GST–p27 (lane 2). We observed no
interaction between IE86 and GST–p16 (data not shown).
We next determined which region of IE86 was responsible
for this interaction with GST–p21. Fig. 6 (b) shows that the Cterminal domain of IE86 (amino acids 290–579) was able to
bind efficiently to GST–p21 (lane 6). In contrast, the Nterminal domain of IE86 (amino acids 1–290) showed no
specific binding to GST–p21 (lane 5). Interestingly, this same
C-terminal domain of IE86 is also responsible for contacting
Rb, TATA box-binding protein and TFIIB (Caswell et al.,
1993 ; Hagemeier et al., 1994). Similar experiments were also
carried out to determine which region of the p21 protein was
contacted by IE86 (Fig. 6 c). GST–p21 N- and C-terminal
fusions were used as targets for binding in vitro transcribed and
1
2
3
4
5
(b)
IE2
0
–
+
1
2
+
+
3
p21
4
Fig. 8. IE86 recovers Cdk activity in arrested T2jRA cells and can
prevent p21-mediated inhibition of Cdk2 in cycling T2 cells. (a) Cellular
extracts from differentiated T2jRA cells were incubated with 0 (lane 1),
10 (2), 50 (3), 100 (4) or 200 (5) ng purified recombinant GST–IE86
fusion protein. In all cases, additions were made up to 200 ng total protein
with purified GST. Extracts were immunoprecipitated with anti-Cdk2
antibody and analysed for kinase activity by standard H1 kinase assays.
(b) Cellular extracts from undifferentiated T2 cells (lane 1) were incubated
with approximately 200 ng purified recombinant GST–p21 protein together
with 0 (lane 2), 10 (3) or 200 (4) ng purified recombinant GST–IE86
fusion protein. In all cases, additions were made up to 200 ng total protein
with purified GST. Extracts were immunoprecipitated with anti-Cdk2
antibody and analysed for kinase activity by standard H1 kinase assays.
translated IE86. Fig. 5 (c ; lane 3) shows that IE86 bound the Nterminal domain of p21 (amino acids 1–90), which is known to
contain both cyclin- and Cdk-binding domains of p21 (Chen et
al., 1996). Little or no binding of IE86 was observed to the Cterminal domain of p21 (amino acids 87–164).
IE86 interacts with p21Cip1 in vivo
In order to confirm that the physical interaction between
IE86 and p21Cip" that we observed in vitro also occurred in vivo
and that this did not depend upon any other mammalian
protein, we analysed the interaction between IE86 and p21Cip"
in a yeast two-hybrid assay. Fig. 7 shows that a two-hybrid
system in which full-length IE86 was fused to the GAL4
activation domain and full-length p21 was fused to the GAL4
DNA-binding domain (p21\IE2) resulted consistently in
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 19:52:01
BFGB
J. Sinclair and others
activated β-galactosidase expression. No such activation was
observed with a comprehensive panel of controls.
Purified IE86 protein recovers cyclin–Cdk2 activity in
differentiated T2MRA cells
Mal et al. (1996 b) have shown that purified E1A (12S)
protein is able to displace p27Kip" inhibitor from cyclin–Cdk2
complexes and recover kinase activity from arrested cell
extracts. Fig. 8 (a) shows that, as expected, differentiated
T2jRA cells contained low cyclin–Cdk2 activity (lane 1).
However, IE86 protein was able to recover cyclin–Cdk2
activity from these arrested T2jRA cells in a dose-dependent
manner (lanes 2–5). We also routinely observed a phosphorylated protein in these H1 kinase assays that migrated
at the same relative mobility as IE86 (data not shown).
Interestingly, Mal et al. (1996 a) have shown that Cdk2 is able
to phosphorylate adenovirus E1A protein in vitro and Harel &
Alwine (1998) have shown that IE86 is a target for extensive
phosphorylation during infection. Experiments are in progress
to confirm that the high molecular mass phosphorylated
protein that we observed is IE86 and to analyse any effect of
Cdk2-mediated IE86 phosphorylation on IE86 function.
Similarly, we next determined whether IE86 was able to
prevent inhibition by recombinant p21Cip" of cyclin–Cdk2
activity in cycling T2 cell extracts (Fig. 8 b). As expected,
cycling T2 cells contained high Cdk activity (lane 1) and
purified p21Cip" was able to inhibit cyclin–Cdk2 activity
specifically in dividing T2 cells (lane 2). However, recombinant
IE86 protein was able to prevent recombinant p21-mediated
inhibition of cyclin–Cdk2 kinase activity in undifferentiated T2
cells (lanes 3 and 4).
Discussion
HCMV encodes a number of genes (such as viral DNA
polymerase) that encode functions that permit viral DNA
replication to take place independently of the replication of
cellular DNA. However, it is clear that viral DNA replication
is linked extensively to cellular DNA replication and is also
likely to depend on the cellular functions that optimize the cell
for DNA synthesis in general. For this reason, HCMV has
evolved a number of functions that perturb normal cellular
controls in order to enhance its own replication. It has become
clear that terminally differentiated cells represent an important
cell type for HCMV infection in vivo (Sinclair & Sissons, 1996).
However, such cells have withdrawn irreversibly from the cell
cycle (el-Deiry et al., 1995) and are unlikely to represent an
optimal environment for viral DNA synthesis. Here, we have
asked what effect HCMV infection has on such arrested,
terminally differentiated cells in order to alter cellular conditions to allow productive virus infection.
HCMV infection of these irreversibly arrested cells induces
cell cycle progression through the G \S phase checkpoint, into
"
early S phase. This occurs as early as 48 h p.i. and is not
BFGC
attributable to viral DNA replication, as the virus life cycle is
extended in T2jRA cells and no viral DNA replication could
be detected at the time of this advance in cell cycle progression.
These T2jRA cells also underwent full productive infection,
as determined by the detection of viral DNA replication
centres and late viral gene expression.
We also confirmed that, at low m.o.i. at which only
10–20 % of the cell population was infected with HCMV,
induction through the G \G checkpoint correlated with IE
! "
expression. This also rules out that the induction occurs in
bystander cells as a result of, for instance, mitogen or cytokine
induction by virus.
We have analysed the increase in cellular DNA content
induced by HCMV infection solely by PI staining and FACS
analysis for specific reasons. Recently, Morin et al. (1996) have
shown that HCMV encodes functions that prevent cellular
thymidine salvage and that channel exogenous thymidine
exclusively into viral DNA. Consequently, the use of
thymidine incorporation to analyse cellular DNA synthesis
during virus infection is clearly problematic. Similarly, it is
established that virus-specific DNA synthesis inhibitors such as
gancyclovir and phosphonoformate do have discernible effects
on cellular DNA synthesis (Albert & Gudas, 1986 ; Ilsley et al.,
1995 ; Sabourin et al., 1978), and we have observed inhibition
of serum-induced S phase entry of serum-deprived fibroblasts
by gancyclovir at concentrations as low as 100 µg\ml (data
not shown). Consequently, it may be difficult to interpret
results when these drugs are used as a means of analysing
cellular DNA synthesis in the absence of viral DNA synthesis.
Instead, in our experiments, we have used a cell line in which
the HCMV life cycle is extended such that the induction of cell
cycle progression through the G \S phase checkpoint that we
"
observe is quite clearly separated in time from viral DNA
synthesis and cannot be attributed to an increase in viral DNA
in the cell.
Consistent with observations from experiments using
infection of reversibly arrested fibroblast cells (Bresnahan et al.,
1996 ; Jault et al., 1995), HCMV infection of irreversibly
arrested T2jRA cells resulted in increased Rb phosphorylation and the induction of Cdk2 and cyclin E-associated kinase
activity. However, in contrast to observations in infected
quiescent fibroblasts (Bresnahan et al., 1996), we did observe
clear induction of cyclin A-associated kinase activity by
HCMV, consistent with the induction of the start of cellular
DNA synthesis. All these observations are consistent with
HCMV inducing cell cycle progression of arrested T2jRA
cells through the G checkpoint into early S phase.
"
Interestingly, a small but reproducible transient induction of
Cdk4-associated kinase activity by HCMV was also observed.
The ability of adenovirus E1A to induce cell cycle
progression through the G \S phase checkpoint of the cell
"
cycle has been shown to be mediated by a direct physical
interaction between E1A and the Cdk inhibitor p27Kip". This
interaction prevents p27Kip"-mediated inhibition of cyclin-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 19:52:01
Cytomegalovirus and the cell cycle
associated kinases (Mal et al., 1996 b). Because of the many
functional similarities between HCMV IE86 and adenovirus
E1A, we were prompted to look at whether IE86 could also
interact physically with p27Kip". In contrast to E1A, we
observed no interaction between p27Kip" and IE86. However,
we did observe a strong physical interaction between IE86 and
the p21Cip" Cdk inhibitor. This interaction mapped to the Nterminal domain of p21Cip". Interestingly, the N-terminal
domain of p21Cip" is known to contain domains for binding
cyclins and Cdks (Chen et al., 1996). Consequently, the ability
of IE86 to contact p21Cip" via these cyclin-\Cdk-binding
domains would be consistent with the ability of IE86 to
prevent p21Cip" from interacting with cyclin–Cdk complexes.
Although it has been shown that the E7 protein of HPV-16 can
associate with p27Kip" and prevent p27Kip"-mediated inhibition of cyclin E-associated kinase activity (Zerfass-Thome
et al., 1996), a direct functional interaction between E7 and
p21Cip" has also been described more recently (Martin et al.,
1998). In this study, Martin et al. (1998) showed that the E7
protein of HPV-16 interacted directly with p21Cip" and
prevented p21Cip"-mediated inhibition of cyclin E-associated
kinase in cells arrested by DNA damage, so inducing the cell
cycle. In contrast to our observations for IE86, the interaction
between E7 and p21Cip" was mapped to the C-terminal PCNAbinding domain of p21Cip", which resulted in E7 preventing
p21Cip"-mediated inhibition of PCNA-dependent DNA replication (Martin et al., 1998). Consequently, whilst E7 and IE86
both appear to target p21Cip" in order to prevent Cdk
inhibition, the exact mechanisms by which they achieve this
appear not to be identical.
The domain of IE86 that interacts with p21Cip" was also
determined. Using GST–IE86 domain fusions, we mapped the
p21Cip" interaction domain of IE86 to the C terminus (amino
acids 290–579). This region of IE86 has already been shown to
be important for the interaction between IE86 and a number of
cellular proteins (Caswell et al., 1993 ; Hagemeier et al., 1994).
We confirmed a direct physical interaction between IE86
and p21Cip" by using a yeast two-hybrid system. This analysis
showed clearly that IE86 and p21Cip" interacted directly in vivo
and did not require interactions with any other mammalian
protein.
Finally, this physical interaction between IE86 and p21Cip"
was reflected in the ability of purified IE86 protein to recover
cyclin-associated kinase activity in arrested cells and to prevent
inhibition of cyclin-associated kinases by recombinant p21Cip".
In these experiments, differentiated T2jRA cells regained
cyclin–Cdk2 activity upon the addition of bacterially expressed
IE86 in a dose-dependent manner. Similarly, inhibition of
cyclin–Cdk2 activity resulting from addition of bacterially
expressed p21Cip" to extracts from cycling T2 cells was also
overcome by the addition of recombinant IE86.
Recently, Wiebusch & Hagemeier (1999) have shown that
IE86 is able to block the cell cycle in permissive osteosarcoma
cells in late G , which is at odds with the apparent effect of
"
virus-expressed IE86 in T2jRA cells. We have not tested the
effect of expression of IE86 in isolation in T2jRA cells
directly, as transient transfection of T2jRA cells by IE86
expression vectors in our hands results in substantial death of
both bystander cells and cells expressing IE86 (data not
shown).
Results from a number of laboratories have shown that
infection with HCMV of quiescent fibroblast cells that have
withdrawn reversibly from the cell cycle as a result of serum
starvation or contact inhibition can lead to the induction of cell
cycle progression, but that this progression appears to be
arrested at G . In contrast, we show here that, in cells that have
"
withdrawn irreversibly from the cell cycle as a result of
terminal differentiation, HCMV can overcome the known
G \S block in these cells. As HCMV infection of arrested cells
"
does not lead to an increase in cell proliferation (data not
shown), we presume that infected cells are blocked at a later
stage in their cell cycle, as has been suggested for fibroblasts
(Jault et al., 1995 ; Lu & Shenk, 1996). This is under
investigation.
Our experiments point to a possible role for the IE86
protein in this induction of S phase, which may involve a direct
physical and functional interaction between IE86 and the Cdk
inhibitor p21Cip". We presume that, in contrast to reversibly
arrested quiescent fibroblasts, in cells arrested irreversibly by
terminal differentiation, HCMV must target cellular functions
involved in restriction of G \S phase in order to optimize the
"
cell for high levels of viral DNA replication. Whether this
reflects a fundamental difference in the requirements of HCMV
infection of irreversibly arrested versus quiescent cells awaits
further analysis.
We are indebted to Drs A. Dutta, D. Beach and T. Hunter for
GST–p21Cip", p16 and GST–p27Kip", respectively. This work was
supported by the Medical Research Council, UK.
References
Albert, D. A. & Gudas, L. J. (1986). Selection and characterization of
mutant S49 T-lymphoma cell lines resistant to phosphonoformic acid :
evidence for inhibition of ribonucleotide reductase. Journal of Cellular
Physiology 127, 281–287.
Albrecht, T., Nachtigal, M., St Jeor, S. C. & Rapp, F. (1976). Induction
of cellular DNA synthesis and increased mitotic activity in Syrian
hamster embryo cells abortively infected with human cytomegalovirus.
Journal of General Virology 30, 167–177.
Boldogh, I., AbuBakar, S. & Albrecht, T. (1990). Activation of protooncogenes : an immediate early event in human cytomegalovirus
infection. Science 247, 561–564.
Bresnahan, W. A., Boldogh, I., Thompson, E. A. & Albrecht, T. (1996).
Human cytomegalovirus inhibits cellular DNA synthesis and arrests
productively infected cells in late G1. Virology 224, 150–160.
Buchkovich, K., Duffy, L. A. & Harlow, E. (1989). The retinoblastoma
protein is phosphorylated during specific phases of the cell cycle. Cell 58,
1097–1105.
Caswell, R., Hagemeier, C., Chiou, C.-J., Hayward, G., Kouzarides, T. &
Sinclair, J. (1993). The human cytomegalovirus 86K immediate early
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 19:52:01
BFGD
J. Sinclair and others
(IE) 2 protein requires the basic region of the TATA-box binding protein
(TBP) for binding, and interacts with TBP and transcription factor TFIIB
via regions of IE2 required for transcriptional regulation. Journal of
General Virology 74, 2691–2698.
Caswell, R., Bryant, L. & Sinclair, J. (1996). Human cytomegalovirus
immediate-early 2 (IE2) protein can transactivate the human hsp70
promoter by alleviation of Dr1-mediated repression. Journal of Virology
70, 4028–4037.
Griffiths, P. D. & Grundy, J. E. (1988). The status of CMV as a human
Chen, P. L., Scully, P., Shew, J. Y., Wang, J. Y. & Lee, W. H. (1989).
Phosphorylation of the retinoblastoma gene product is modulated during
the cell cycle and cellular differentiation. Cell 58, 1193–1198.
The 72K IE1 and 80K IE2 proteins of human cytomegalovirus
independently trans-activate the c-fos, c-myc and hsp70 promoters via
basal promoter elements. Journal of General Virology 73, 2385–2393.
Chen, J., Peters, R., Saha, P., Lee, P., Theodoras, A., Pagano, M.,
Wagner, G. & Dutta, A. (1996). A 39 amino acid fragment of the cell
Hagemeier, C., Caswell, R., Hayhurst, G., Sinclair, J. & Kouzarides, T.
(1994). Functional interaction between the HCMV IE2 transactivator
cycle regulator p21 is sufficient to bind PCNA and partially inhibit DNA
replication in vivo. Nucleic Acids Research 24, 1727–1733.
Cherrington, J. M. & Mocarski, E. S. (1989). Human cytomegalovirus
ie1 transactivates the alpha promoter-enhancer via an 18-base-pair repeat
element. Journal of Virology 63, 1435–1440.
Cherrington, J. M., Khoury, E. L. & Mocarski, E. S. (1991). Human
cytomegalovirus ie2 negatively regulates alpha gene expression via a
short target sequence near the transcription start site. Journal of Virology
65, 887–896.
and the retinoblastoma protein. EMBO Journal 13, 2897–2903.
Harel, N. Y. & Alwine, J. C. (1998). Phosphorylation of the human
cytomegalovirus 86-kilodalton immediate-early protein IE2. Journal of
Virology 72, 5481–5492.
human DNA polymerase alpha promoter by the human cytomegalovirus
72-kilodalton major immediate-early protein. Journal of Virology 69,
182–188.
Colberg-Poley, A. M., Santomenna, L. D., Harlow, P. P., Benfield, P. A.
& Tenney, D. J. (1992). Human cytomegalovirus US3 and UL36–38
Hinds, P. W., Mittnacht, S., Dulic, V., Arnold, A., Reed, S. I. & Weinberg,
R. A. (1992). Regulation of retinoblastoma protein functions by ectopic
immediate-early proteins regulate gene expression. Journal of Virology 66,
95–105.
Cordon-Cardo, C. (1995). Mutations of cell cycle regulators. Biological
and clinical implications for human neoplasia. American Journal of
Pathology 147, 545–560.
Crescenzi, M., Soddu, S. & Tato, F. (1995). Mitotic cycle reactivation
in terminally differentiated cells by adenovirus infection. Journal of
Cellular Physiology 162, 26–35.
DeCaprio, J. A., Ludlow, J. W., Figge, J., Shew, J. Y., Huang, C. M., Lee,
W. H., Marsilio, E., Paucha, E. & Livingston, D. M. (1988). SV40 large
tumor antigen forms a specific complex with the product of the
retinoblastoma susceptibility gene. Cell 54, 275–283.
DeCaprio, J. A., Furukawa, Y., Ajchenbaum, F., Griffin, J. D. &
Livingston, D. M. (1992). The retinoblastoma-susceptibility gene prod-
uct becomes phosphorylated in multiple stages during cell cycle entry
and progression. Proceedings of the National Academy of Sciences, USA 89,
1795–1798.
Dittmer, D. & Mocarski, E. S. (1997). Human cytomegalovirus infection
inhibits G1\S transition. Journal of Virology 71, 1629–1634.
el-Deiry, W. S., Tokino, T., Waldman, T., Oliner, J. D., Velculescu, V. E.,
Burrell, M., Hill, D. E., Healy, E., Rees, J. L., Hamilton, S. R. and others
(1995). Topological control of p21WAF1\CIP1 expression in normal
and neoplastic tissues. Cancer Research 55, 2910–2919.
Funk, J. O., Waga, S., Harry, J. B., Espling, E., Stillman, B. & Galloway,
D. A. (1997). Inhibition of CDK activity and PCNA-dependent DNA
replication by p21 is blocked by interaction with the HPV-16 E7
oncoprotein. Genes & Development 11, 2090–2100.
Geist, L. J. & Dai, L. Y. (1996). Cytomegalovirus modulates interleukin6 gene expression. Transplantation 62, 653–658.
Gonczol, E., Andrews, P. W. & Plotkin, S. A. (1984). Cytomegalovirus
replicates in differentiated but not in undifferentiated human embryonal
carcinoma cells. Science 224, 159–161.
Goodrich, D. W., Wang, N. P., Qian, Y. W., Lee, E. Y. & Lee, W. H.
(1991). The retinoblastoma gene product regulates progression through
the G1 phase of the cell cycle. Cell 67, 293–302.
BFGE
pathogen. Epidemiology and Infection 100, 1–15.
Hagemeier, C., Walker, S., Caswell, R., Kouzarides, T. & Sinclair, J.
(1992 a). The human cytomegalovirus 80-kilodalton but not the 72-
kilodalton immediate-early protein transactivates heterologous
promoters in a TATA box-dependent mechanism and interacts directly
with TFIID. Journal of Virology 66, 4452–4456.
Hagemeier, C., Walker, S. M., Sissons, P. J. G. & Sinclair, J. H. (1992 b).
Hayhurst, G. P., Bryant, L. A., Caswell, R. C., Walker, S. M. & Sinclair,
J. H. (1995). CCAAT box-dependent activation of the TATA-less
expression of human cyclins. Cell 70, 993–1006.
Hu, Q. J., Dyson, N. & Harlow, E. (1990). The regions of the
retinoblastoma protein needed for binding to adenovirus E1A or SV40
large T antigen are common sites for mutations. EMBO Journal 9,
1147–1155.
Ilsley, D. D., Lee, S. H., Miller, W. H. & Kuchta, R. D. (1995). Acyclic
guanosine analogs inhibit DNA polymerases alpha, delta, and epsilon
with very different potencies and have unique mechanisms of action.
Biochemistry 34, 2504–2510.
Jault, F. M., Jault, J. M., Ruchti, F., Fortunato, E. A., Clark, C., Corbeil,
J., Richman, D. D. & Spector, D. H. (1995). Cytomegalovirus infection
induces high levels of cyclins, phosphorylated Rb, and p53, leading to cell
cycle arrest. Journal of Virology 69, 6697–6704.
Keblusek, P., Dorsman, J. C., Teunisse, A. F. A. S., Teunissen, H., van
der Eb, A. J. & Zantema, A. (1999). The adenoviral E1A oncoproteins
interfere with the growth-inhibiting effect of the cdk-inhibitor
p21CIP"/WAF". Journal of General Virology 80, 381–390.
Kothari, S., Baillie, J., Sissons, J. G. & Sinclair, J. H. (1991). The 21 bp
repeat element of the human cytomegalovirus major immediate early
enhancer is a negative regulator of gene expression in undifferentiated
cells. Nucleic Acids Research 19, 1767–1771.
LaFemina, R. & Hayward, G. S. (1986). Constitutive and retinoic acidinducible expression of cytomegalovirus immediate-early genes in human
teratocarcinoma cells. Journal of Virology 58, 434–440.
Lu, M. & Shenk, T. (1996). Human cytomegalovirus infection inhibits
cell cycle progression at multiple points, including the transition from G1
to S. Journal of Virology 70, 8850–8857.
Maerz, W. J., Baselga, J., Reuter, V. E., Mellado, B., Myers, M. L., Bosl,
G. J., Spinella, M. J. & Dmitrovsky, E. (1998). FGF4 dissociates anti-
tumorigenic from differentiation signals of retinoic acid in human
embryonal carcinomas. Oncogene 17, 761–767.
Mal, A., Piotrkowski, A. & Harter, M. L. (1996 a). Cyclin-dependent
kinases phosphorylate the adenovirus E1A protein, enhancing its ability
to bind pRb and disrupt pRb–E2F complexes. Journal of Virology 70,
2911–2921.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 19:52:01
Cytomegalovirus and the cell cycle
Mal, A., Poon, R. Y., Howe, P. H., Toyoshima, H., Hunter, T. & Harter,
M. L. (1996 b). Inactivation of p27Kip1 by the viral E1A oncoprotein
in TGFβ-treated cells. Nature 380, 262–265.
Martin, L. G., Demers, G. W. & Galloway, D. A. (1998). Disruption of
the G1\S transition in human papillomavirus type 16 E7-expressing
human cells is associated with altered regulation of cyclin E. Journal of
Virology 72, 975–985.
Monick, M. M., Geist, L. J., Stinski, M. F. & Hunninghake, G. W. (1992).
The immediate early genes of human cytomegalovirus upregulate
expression of the cellular genes myc and fos. American Journal of
Respiratory Cell and Molecular Biology 7, 251–256.
Morin, J., Johann, S., O’Hara, B. & Gluzman, Y. (1996). Exogenous
thymidine is preferentially incorporated into human cytomegalovirus
DNA in infected human fibroblasts. Journal of Virology 70, 6402–6404.
Muganda, P., Mendoza, O., Hernandez, J. & Qian, Q. (1994). Human
cytomegalovirus elevates levels of the cellular protein p53 in infected
fibroblasts. Journal of Virology 68, 8028–8034.
Nelson, J. A. & Groudine, M. (1986). Transcriptional regulation of the
human cytomegalovirus major immediate-early gene is associated with
induction of DNase I-hypersensitive sites. Molecular and Cellular Biology
6, 452–461.
Pines, J. (1993). Cyclins and cyclin-dependent kinases : take your
partners. Trends in Biochemical Sciences 18, 195–197.
Pizzorno, M. C., O’Hare, P., Sha, L., LaFemina, R. L. & Hayward, G. S.
(1988). Trans-activation and autoregulation of gene expression by the
immediate-early region 2 gene products of human cytomegalovirus.
Journal of Virology 62, 1167–1179.
Pizzorno, M. C., Mullen, M. A., Chang, Y. N. & Hayward, G. S. (1991).
The functionally active IE2 immediate-early regulatory protein of human
cytomegalovirus is an 80-kilodalton polypeptide that contains two
distinct activator domains and a duplicated nuclear localization signal.
Journal of Virology 65, 3839–3852.
Poma, E. E., Kowalik, T. F., Zhu, L., Sinclair, J. H. & Huang, E. S.
(1996). The human cytomegalovirus IE1-72 protein interacts with the
cellular p107 protein and relieves p107-mediated transcriptional repression of an E2F-responsive promoter. Journal of Virology 70,
7867–7877.
Rao, L., Debbas, M., Sabbatini, P., Hockenbery, D., Korsmeyer, S. &
White, E. (1992). The adenovirus E1A proteins induce apoptosis, which
is inhibited by the E1B 19-kDa and Bcl-2 proteins. Proceedings of the
National Academy of Sciences, USA 89, 7742–7746.
Sabourin, C. L., Reno, J. M. & Boezi, J. A. (1978). Inhibition of
eucaryotic DNA polymerases by phosphonoacetate and phosphonoformate. Archives of Biochemistry and Biophysics 187, 96–101.
Salvant, B. S., Fortunato, E. A. & Spector, D. H. (1998). Cell cycle
dysregulation by human cytomegalovirus : influence of the cell cycle
phase at the time of infection and effects on cyclin transcription. Journal
of Virology 72, 3729–3741.
Sarisky, R. T. & Hayward, G. S. (1996). Evidence that the UL84 gene
product of human cytomegalovirus is essential for promoting oriLytdependent DNA replication and formation of replication compartments
in cotransfection assays. Journal of Virology 70, 7398–7413.
Sherr, C. J. (1993). Mammalian G1 cyclins. Cell 73, 1059–1065.
Sinclair, J. & Sissons, P. (1996). Latent and persistent infections of
monocytes and macrophages. Intervirology 39, 293–301.
Smith, D. B. & Johnson, K. S. (1988). Single-step purification of
polypeptides expressed in Escherichia coli as fusions with glutathione Stransferase. Gene 67, 31–40.
Soderberg-Naucler, C., Fish, K. N. & Nelson, J. A. (1997). Reactivation
of latent human cytomegalovirus by allogeneic stimulation of blood cells
from healthy donors. Cell 91, 119–126.
Sommer, M. H., Scully, A. L. & Spector, D. H. (1994). Transactivation
by the human cytomegalovirus IE2 86-kilodalton protein requires a
domain that binds to both the TATA box-binding protein and the
retinoblastoma protein. Journal of Virology 68, 6223–6231.
Speir, E., Modali, R., Huang, E. S., Leon, M. B., Shawl, F., Finkel, T. &
Epstein, S. E. (1994). Potential role of human cytomegalovirus and p53
interaction in coronary restenosis. Science 265, 391–394.
Spinella, M. J., Freemantle, S. J., Sekula, D., Chang, J. H., Christie,
A. J. & Dmitrovsky, E. (1999). Retinoic acid promotes ubiquitination
and proteolysis of cyclin D1 during induced tumor cell differentiation.
Journal of Biological Chemistry 274, 22013–22018.
Stein, R. W., Corrigan, M., Yaciuk, P., Whelan, J. & Moran, E. (1990).
Analysis of E1A-mediated growth regulation functions : binding of the
300-kilodalton cellular product correlates with E1A enhancer repression
function and DNA synthesis-inducing activity. Journal of Virology 64,
4421–4427.
Stenberg, R. M., Depto, A. S., Fortney, J. & Nelson, J. A. (1989).
Regulated expression of early and late RNAs and proteins from the
human cytomegalovirus immediate-early gene region. Journal of Virology
63, 2699–2708.
Stenberg, R. M., Fortney, J., Barlow, S. W., Magrane, B. P., Nelson,
J. A. & Ghazal, P. (1990). Promoter-specific trans activation and re-
pression by human cytomegalovirus immediate-early proteins involves
common and unique protein domains. Journal of Virology 64, 1556–1565.
Stinski, M. F., Thomsen, D. R., Stenberg, R. M. & Goldstein, L. C.
(1983). Organization and expression of the immediate early genes of
human cytomegalovirus. Journal of Virology 46, 1–14.
Wade, M., Kowalik, T. F., Mudryj, M., Huang, E. S. & Azizkhan, J. C.
(1992). E2F mediates dihydrofolate reductase promoter activation and
multiprotein complex formation in human cytomegalovirus infection.
Molecular and Cellular Biology 12, 4364–4374.
Wathen, M. W., Thomsen, D. R. & Stinski, M. F. (1981). Temporal
regulation of human cytomegalovirus transcription at immediate early
and early times after infection. Journal of Virology 38, 446–459.
Whyte, P., Buchkovich, K. J., Horowitz, J. M., Friend, S. H., Raybuck,
M., Weinberg, R. A. & Harlow, E. (1988). Association between an
oncogene and an anti-oncogene : the adenovirus E1A proteins bind to the
retinoblastoma gene product. Nature 334, 124–129.
Whyte, P., Williamson, N. M. & Harlow, E. (1989). Cellular targets for
transformation by the adenovirus E1A proteins. Cell 56, 67–75.
Wiebusch, L. & Hagemeier, C. (1999). Human cytomegalovirus 86kilodalton IE2 protein blocks cell cycle progression in G . Journal of
"
Virology 73, 9274–9283.
Winkler, M., Rice, S. A. & Stamminger, T. (1994). UL69 of human
cytomegalovirus, an open reading frame with homology to ICP27 of
herpes simplex virus, encodes a transactivator of gene expression. Journal
of Virology 68, 3943–3954.
Zerfass-Thome, K., Zwerschke, W., Mannhardt, B., Tindle, R., Botz,
J. W. & Jansen-Du$ rr, P. (1996). Inactivation of the cdk inhibitor
p27KIP1 by the human papillomavirus type 16 E7 oncoprotein. Oncogene
13, 2323–2330.
Received 3 December 1999 ; Accepted 11 February 2000
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 29 Apr 2017 19:52:01
BFGF