Download CAR

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Cannabinoid receptor antagonist wikipedia, lookup

Drug discovery wikipedia, lookup

Nicotinic agonist wikipedia, lookup

Discovery and development of proton pump inhibitors wikipedia, lookup

Drug interaction wikipedia, lookup

Drug design wikipedia, lookup

Discovery and development of angiotensin receptor blockers wikipedia, lookup

Discovery and development of antiandrogens wikipedia, lookup

Toxicodynamics wikipedia, lookup

Pharmacogenomics wikipedia, lookup

NK1 receptor antagonist wikipedia, lookup

Neuropharmacology wikipedia, lookup

Neuropsychopharmacology wikipedia, lookup

Transcript
ENVR 432/TOXC 442/BIOC442
Biochemical & Molecular Toxicology
Induction of Metabolism by Toxicants
Instructor:
Stephen S. Ferguson, Ph.D.
e-mail: [email protected]
Induction: Definitions and Principles
• The process of increasing the amount or the
activity of a protein.
• A homeostatic mechanism for regulating enzyme
production in a barrier organ, such as the liver,
intestine, kidney.
• In enzymology, an inducer usually combines with
and deactivates/activates a regulatory protein
which leads to increased gene expression.
P450 Enzyme Induction
• Induction can cause marked increases in P450
composition (>20-fold) and chemical clearance or
bioactivation.
• As a result, induction can increase tolerance to some
toxicants while enhancing the toxicity of others.
• Induction can decrease the therapeutic effect of drugs
by increasing the rate and pattern of metabolism.
• Xenobiotics are known to induce enzymes that play a
major or no role in their biotransformation (e.g.,
omeprazole vs. ethanol).
Why Is It Important to Assess Enzyme
Induction?
• Failure of therapy
(e.g. OC’s, epilepsy, HIV)
Inhibition-Induction
• Drug tolerance with auto-induction
Toxic / side-effect level
• Xenobiotic toxicity potentiated
Therapeutic Window
(drug efficacy)
Concentration
• Complicated dosing regimen
• Chemical carcinogenesis
potentiated
• Perturbation of endogenous
substrate metabolism/homeostasis
• Hepatomegaly & proliferation of
cellular ER & peroxisomes
Ineffective level
Time
6
Invitrogen Proprietary & Confide
Internal Exposure to Natural and
Man-made Chemicals
•
•
•
•
•
•
drugs
industrial chemicals
pesticides
pollutants
alkaloids
cigarette smoke
• cruciferous vegetables
(indole-3-carbinol)
• secondary plant
metabolites
• toxins produced by
molds, plants, and
animals
• pyrolysis products in
cooked food
Types of P450 Inducers
• Many “prototypical” inducers of specific families or
subfamilies of P450 enzymes
– CYP1A inducers: 3-MC, BNF, omeprazole, TCDD
– CYP3A inducers: rifampin, dexamethasone, troglitazone
– CYP2B inducers: phenobarbital, PCBs, phenytoin
– CYP4A inducers: fibrates
– CYP2E1 inducers: ethanol, isoniazid
• Some overlap in “specificities” of inducers
• An inducer for one family of enzymes may also suppress
another family (e.g., BNF)
Induction of Rat Liver P450 Enzymes by
Prototypical Inducers In Vivo
In Vivo Induction in Male Rats
P450 Enzyme
Inducer
Control Activity
Induced Activity
152  27
3,320  183
24  4
1,460  180
PCN
2,460  780
12,693  2,255
CLO
489  52
10,693  620
CYP1A
BNF
CYP2B
PB
CYP3A
CYP4A
CYP1A, EROD; CYP2B, PROD; CYP3A, testosterone 6b-hydroxylation;
CYP4A, lauric acid 12-hydroxylation.
Induction and Inhibition of P450 in Mice Treated
with PB or SKF525A: [14C-methyl]aminopyrine
Serrum triazolam (ng/ml)
Rifampin Effects on Triazolam Disposition
Villikka et al., Clin Pharmacol Ther 1997;61:8-14.
 Rifampin
 Placebo
Consequences of Cytochrome
P450 Enzyme Induction
• Increased toxic effect
– Acetaminophen
– Bromobenzene, CCl4
Alcohol, 3-MC
Phenobarbital
• Increased bioactivation
– Cyclophosphamide
Macrolides, pesticides
• Increased tumor formation
– Altered disposition of endogenous substrates
• Altered cellular and physiological function
– proliferation of peroxisomes and SER
– increased liver weight
– endocrine disruption
• Porphyria, chloracne
– PCDDs, azobenzenes, biphenyls (PCBs), naphthalene
Effects of Inducers on Rodent Liver
Physiology and Function
Acetaminophen Metabolism and Toxicity
HN
COCH 3
~60%
HN
O
COCH 3
O
OH
CO 2 H
OH
HO
~35%
CYP2E*
CYP1A
CYP3A
N
COCH 3
OH
HN
O
COCH 3
SO 3 H
*induced by ethanol, isoniazid,
phenobarbital
Protein adducts,
Oxidative stress,
Toxicity
O
NAPQI
N-acetyl-p-benzoquinone imine
Endocrine Disruption
Molecular Mechanisms of P450
Enzyme Induction
General Mechanisms of P450 Induction
• Receptor-mediated transcriptional
activation
– Receptor
• A macromolecule with which a
hormone, drug, or other chemical
interacts to produce a characteristic
effect.
– Two key features:
• chemical recognition
• signal transduction
– Ligand: A chemical that exhibits
specific binding to a receptor.
• mRNA stabilization
• Protein stabilization
Coordinates: Kumar R, Thompson EB (1999). "The structure
of the nuclear hormone receptors". Steroids 64 (5): 310–9
Enzyme Induction
General mechanism of hepatic enzyme induction
X
XR cytosol
XR nucleus
nucleus
Nuclear Receptor
cytoplasm
Gene transcription
mRNA
Phase1
Phase 2
transporters
protein
activity
Hepatocyte
NR’s and P450 Induction
PXR
CAR
Transcription
I SRC-1
RNA poly II
RXR NR
TFs
XREM
PBREM
Promoter
P450
mRNA
Translation
CYP450 gene
P450
Drug
DrugOH
Increased Drug
Metabolism
Complex Transcriptional Machinery
precursor mRNA
mature mRNA
mRNA degradation
micro RNA
protein translation
protein folding
protein degradation
Co-regulation of Target Genes by NR’s
• Complementary roles of NR’s in protection against
xenobiotic exposure.
• Increased expression of the hepatic genes involved in
drug metabolism and excretion (e.g., CYP’s, UGT’s,
GST’s, transporter proteins).
• These target genes represent redundant but distinct
layers of defense.
• There are overlapping similarities and distinct
differences in species’ response to activators of NR’s.
Receptors Involved in the Regulation of
CYP Gene Expression
Transcription
factor
Dimerization
partner
AHR
ARNT
CAR
Examples of ligands
Genes
Regulated
Dioxins, non-ortho PCBs, some PAHs,
bilirubin, etc.
CYP1A, CYP1B
GST, UGT, NQO
RXR
Phenobarbital (PB), TCPOBOP,
chlorinated pesticides, ortho-PCBs,
androstanol/ androstenol (inhibits)
CYP2B, CYP3A
GST, ABC transporters
PXR
(SXR)
RXR
CYP3A, CYP2B, CYP7A
PB, ortho-PCBs, organochlorine
(repression)
pesticides, dexamethasone,
pregnenalone, corticosterone, bile acids GST, ABC transporters
(lithocholic acid)
PPAR
RXR
Fibrate drugs, phthalate esters, linoleic
acid, arachidonic acid,
CYP4A, CYP7A (repression),
CYP8B, LXR, HMGCS2
LXR
RXR
Cholesterol; (24 S)- hydroxycholesterol
CYP7A, ABC transporters,
LXR
FXR
RXR
Bile acids, chenodeoxycholic acid
Represses CYP7A, BSEP
(ABCB11), CYP8B, CYP27A
ER
ER
Structurally diverse xenoestrogens
CYP19
Coordinate Regulation of P450’s, UGT’s and
Transporters by NR’s
UGT’s
MRP3
Modified from Kast, H. R. et al. J. Biol. Chem. 277:2908-2915, 2002
What is Relevant Induction?
Potency and Efficacy
Dose-Response
‘Window’
(Position → potency)
Emax
Magnitude of
Response
(Efficacy)
1. Efficacy (e.g. % of PC)
EC50
2. Potency (e.g. EC50)
PAH Inducers in Rat vs. Human
EC50 = 0.00767 +/- 0.00409
EC50 = 0.00767 +/- 0.00409
CYP1A1 mRNA Hu497
Rat TCDD 1A1 mRNA
EC50 = 0.0107 +/- 0.043
EC50 10X Difference
Relationship between In Vitro Potency and Induction In Vivo
EC50
Cmax
[Cmax]/EC50
Clinical
Relevance
Nifedione
8
0.008
0.001
No known
Lovastatin
1-6
0.008
0.008-0.002
No known
Rosiglitazone
5-10
0.3-1.2
0.05-0.12
No known
Simvastatin
0.14
0.024
0.17
No known
Troglitazone
3-6
7
2.3
Yes
Phenytoin
25
80
3.2
Yes
Avasimibe
0.2
1-6
5-30
Yes
Rifampicin
0.8
14
17.5
Yes
Carbamazepine
0.9
25
28
Yes
Clotrimazole
1-5
Topical
(Inhibition)
[Cmax]/EC50 < 0.1, induction not likely
1< [Cmax]/ EC50 < 0.1, induction possible
[Cmax]/ EC50 > 1, induction likely
Aryl Hydrocarbon Receptor
(AhR)
• Aryl hydrocarbon receptor (AHR) is a basic helixloop-helix (bHLH) protein belonging to the PerArnt-Sim (PAS) family of transcription factors
• It transcriptionally induces expression of hepatic
CYP1A1, CYP1A2, and CYP1B1 , as well as
several other genes, including some phase II
metabolizing enzymes
• AHR ligands include PAHs and TCDD
AhR Signaling Pathway
Nucleus
Cytoplasm
X
90
90
X
X
X
90
90
90
90
90
90
L
L
L
AhR
L or
L
Arnt
L
From: Anne Mullen, Advanced Pharmacology, McMaster University, Ontario, CA
AhR Signaling Pathway
AhR/Arnt
heterodimer
Increased expression
CYP1A1 protein
+
mRNA
Translation
IC
XRE promoter gene
(CYP1A1)
TNGCGTG
Increased expression of
other gene products
Nuclear Hormone Receptors
AF-1
DBD
LBD
AF-2
Carboxy
Amino
Modulators interact
with some cofactors
Binding to response
elements of target genes
LBD
5’
DBD
3’
Monomers
ROR
TLX
ERR
NGFI-B
5’
NR-LBD
RXR-LBD
DBD
DBD
Ligand and coactivator
binding pockets
3’
RXR Heterodimers
PXR
CAR
PPAR
LXR
FXR
RAR
5’
Translocase
activity
NR-LBD
NR-LBD
DBD
DBD
Homodimers
GR
ER
RXR
COUP-TF
HNF4
Rev-Erb
GCNF
3’
5’
3’
n
n
DRn
IRn
n
ERn
CYP2B Response elements
CYP3A Response elements
NR1s
DRs
CYP2B6
CYP2b10
CYP2B1
CYP2B2
TGTACT n=4 TGACCC
TGTACT n=4 TGACCT
TCTACT n=4 TGACCT
TGTACT n=5 TGACCT
CYP3A4
CYP3A2
CYP3A23
CYP3A2
NR2s
CYP2B6
CYP2b10
CYP2B1
CYP2B2
ERs
TGGACT n=4 TGAACC
TCAACT n=4 TGACAC
TCAACT n=4 TGACAC
TCAACT n=4 TGACAC
NR3
CYP2B6
TGAACT n=3 TGACCC
TGACCT n=3 TGAGCT
TGACCT n=4 TGAGTT
TGAACT n=3 TGAACT
CYP3A4
CYP3A4
CYP3A23
CYP3A5
CYP3A7
CYP3A7
TGAAAT n=6 GGTTCA
TGAACT n=6 AGGTCA
TTAACT n=6 AGGTCA
TGAACT n=6 AGGTAA
TTAACT n=6 AGGTCA
TGAAAT n=6 AGTTCA
MDR1
CYP2C9
TGAGAT n=6 AGTTCA
CAAACT n=4 TGACCT
TGGACT n=4 TGACCC
Other Genes
UGT1A1
rMRP2
TGAGTT n=4 TAACCT
TGAACT n=8 AGTTCA
Nuclear Receptor PXR
PB
RIF
?
PXR
translocation?
-mouse-yes
-human-no
cytoplasm
RXR
nucleus
XREM
Human
Rat
Mouse
Activator/Agonist
RIF
PCN
PCN
CYP3A
CYP Target
CYP3A4
CYP3A1/2
Cyp3a11
Nuclear Receptor CAR: PB Induction-Constitutively Active
PB
?
CAR
CCRP
CCRP
PP2A
cytoplasm
nucleus
PBREM
Human
Rat
Mouse
Activator/Agonist
CITCO, PB, DPH
PB, TCPOBOP
PB, TCPOBOP
CYP2B
Inhibitor/Antagonist
Clotrimazole?, Miclizine?
Androstenol
Androstenol
In cell lines
spontaneously
translocates to
the nucleus
CYP Target
CYP2B6
CYP2B1
Cyp2b10
Similar Binding of PXR and CAR
to Promoter Response Elements
Goodwin et al., Mol. Pharmacol., 2001
Differential Binding of PXR and
CAR to Other Promoter Regions
NR3-2B6
PXR
CAR
RXR
+
+
+
+
ER6-3A4
+
+
+
+
+
+
+
+
+
+
+
+
+
+ + +
+ + + +
PXR/RXR
CAR/RXR
GR/Dex Role in Basal & Induced P450
Expression via CAR/PXR (master regulator)
Role of CAR/PXR in lipid metabolism,
synthesis, and uptake
Moreau et al. 2007
Mol. Pharmaceutics
PXR & CAR role in Glucose Homeostasis
Molecular Basis for the Species
Differences in Enzyme Induction
10mM SR12813
10mM DTBA
5mM PCN
10mM Rifampicin
0.1% DMSO
Species Differences in the Regulation
of CYP3A Enzymes
CYP3A4
Human
CYP3A6
Rabbit
CYP3A23
Rat
Species Differences in CYP2B
Induction by Phenobarbital
Species Differences in CYP1A
Induction by Xenobiotics
Phenacetin O-Dealkylation (pmol/min/mg)
Treatment with Drug 'X'
1.2
300
200
100
1%
0.
(
l
tr o
DM
)
SO
M
3-
C
2µ
M
ug
Dr
2µ
0.
'
'X
M
ug
Dr
µ
'2
'X
ug
Dr
µ
'6
'X
ug
Dr
'2
'X
M
0µ
'X
'2
0µ
M
'X
'6
µM
ru
g
D
ru
g
'X
'2
µM
g
D
M
D
g
ru
D
M
ru
C
'X
'0
.6µ
M
2µ
M
SO
)
DM
Co
nt
ro
D
D
ru
g
ru
g
C
3M
DM
0.
1%
Co
nt
ro
l(
0.2
0.0
n
Co
400
0
'X
'0
.6
µM
1µ
M
0
0.4
500
l(
0.
1%
100
600
'X
'2
0µ
M
200
0.6
g
300
ru
400
0.8
D
500
'X
'6
µM
600
ru
g
700
1.0
D
800
'X
'2
µM
CYP1A2 Activity (nmol/min/mg)
900
3M
1000
SO
)
Phenacetin O-Dealkylation (pmol/min/mg)
CYP1A1/2 Activity in Rat Hepatocytes
a Function
CYP1A Activity
Dog Hepatocytes
as a Function of
CYP1A2asActivity
in Human Hepatocytes
as a inFunction
of
of Treatment with Drug 'X'
Treatment with Drug 'X'
Species Differences in CYP4A
Induction by Clofibric Acid
Rat Hepatocytes
Human Hepatocytes
Rat
40
30
20
50
Human
4
40
CYP4A11 Fold Induction
50
60
CYP4A11 Fold Induction
acid 12-hydroxylation
LauricCYP4A1
Fold Induction
60
30
20
3
2
1
0
10
10
CTL
1
10
100
500
1000
Clofibric Acid (µM)
0
0
CTL
1
10
100
500
Clofibric Acid (µM)
1000
CTL
1
10
100
500
Clofibric Acid (µM)
1000
Observations and Questions
• Significant species differences are observed
in response to inducers.
• All major subfamilies of inducible CYP’s
(CYP1A, CYP2B, CYP3A, CYP4A) exhibit
this behavior.
• What is the molecular basis of the speciesspecific responses?
• What is the significance of these differences
to predicting human toxicity?
Transfection Assay for P450
Enzyme Induction
CV-1
HuH7 cell
PXR
RXR
PXR Expression
Plasmid
RXR
PXR
PXRE
Reporter Gene
Reporter Plasmid
Drug
Differential Activation of Human, Rabbit,
and Rat PXR by CYP3A Inducers
O
H
CN
HO
AcO
PCN
HO
HO
OH O
OH
MeO
rifampicin
NH
N
O
N
HO
O
NMe
OH
O
O
O
H
O
O
H
lovastatin
Cl
N
N
clotrimazole
0
20
40
60
80
100
300
350
Normalized Reporter Activity
400
PXR Sequence Homology
1
41
141
1
41
Rabbit PXR1
107
141
38
104
138
96
Rat PXR1
1
38
1
104
37
Xenopus ONR1
138
102
24
431
76
136
69
1
431
76
96
Mouse PXR1
434
82
94
1
434
Ligand
DNA
Human PXR1
Human VDR
107
386
42
89 122
63
427
37
Variation in ligand
binding domain
consistent with in
vivo species differences in response
to inducers
Amino Acid Differences in the
Ligand Binding Domain of PXR
Val184 Val210
Glu263
Glu333
His260
Arg333
Thr414
rPXR
Asp178 Ser203
Phe184 Leu210
Asp263
Lys334
Tyr260
Arg333
Ser414
mPXR
Gly178 Arg203
Ser187 Leu213
Asp266
Glu337
Tyr263
His333
hPXR
Gly181 Leu206
Zhang et al., Arch. Biochem. Biophys., 1999
Ile417
Rat CYP4A1 Response Elements
-10kb
-2kb
+1 (gene)
Rat CYP4A1
-4850
-4466
DR1 (9/12)
384 bp
DR1 (9/12)
ATTTAAGGAAAgGGGTCAGACC------AACTAGGGTAaAGTTCAGTG
Element 1 not functional
Element 2 is a Functional PPRE
Proximal PPRE Identified by Aldridge et. al. Biochem. J. 306, 473-479, 1995
Analysis of the Human CYP4A11 Gene
Kawashima et. al., Archives of Biochemistry and Biophysics (2000) 378(2), 333-339
Sequenced -2251 bp upstream of gene, no PPRE identified.
DR1 (8/12)
AAAAGTGGGCAAAGGATATGCA
-7238
-10kb
-7217
-7kb
-5kb
-2kb
+1
Human CYP411
-4493
-4472
DR1 (8/12)
AAACAAGGGAATAGCCCAAAAG
Upstream analysis of the CYP4A11 gene located on chromosome 1
revealed two possible PPRE’s
Gel Shift Assay
Rat
PPARa + - .5
RXRa - + .5
PPRE/PPARa/RXR
Human -4.5 kb
1 2
1 2
+ - +
.5 1 2
.5 1 2
Human -7.5 kb
+ - +
.5 1 2
.5 1 2
Summary
• Induction of metabolism is caused by many
structurally unrelated xenobiotics.
• Induction occurs mainly by transcriptional
regulation of metabolizing enzymes and
transporter proteins.
• Nuclear receptors mediate the induction
response by most xenobiotics.
• Amino acid differences in the ligandbinding domain of the receptors are mainly
responsible for the species differences in the
induction of CYP450 enzymes.
Additional Reading
• Parkinson, A.: Biotransformation of xenobiotics. In: Casarett and
Doull’s Toxicology. The Basic Science of Poisons. Sixth edition
(edited by C.D. Klaassen). McGraw Hill, New York, 2001.
• Wang, H. and Negishi, M. (2003) Transcriptional regulation of
cytochrome p450 2B genes by nuclear receptors. Curr Drug Metab.
4(6):515-25.
• Bertilsson, G., Heidrich, J., Svensson, K., Asman, M., Jendeberg, L.,
Sydowbackman, M., Ohlsson, R., Postlind, H., Blomquist, P. and
Berkenstam, A. (1998) Identification of a human nuclear receptor
defines a new signaling pathway for CYP3A induction. Proc. Natl.
Acad. USA. 95:12208-12213.
• Blumberg, B., and Evans, R.M. (1998) Orphan nuclear receptors – new
ligands and new possibilities. Genes Dev. 12:3149-3155.
• Geick A., Eichelbaum M., and Burk O. (2001) Nuclear receptor
response elements mediate induction of intestinal MDR1 by rifampin. J
Biol Chem. 276(18):14581-14587.
Additional Reading
• Goodwin B., Hodgson E., and Liddle C. (1999) The orphan human
pregnane X receptor mediates the transcriptional activation of CYP3A4
by rifampicin through a distal enhancer module. Mol Pharmacol
56:1329-1339.
• Honkakoski P. and Negishi M. (1998) Regulatory DNA elements of
phenobarbital-responsive cytochrome P450 CYP2B genes. J Biochem
Mol Toxicol 12:3-9.
• Jones, S. A., Moore, L. B., Shenk, J. L., Wisely, G.B., Hamilton, G. A.,
McKee, D. D., Tomkinson, N. C. O., LeCluyse, E. L., Wilson, T. M.,
Kliewer, S. A. and Moore, J. T. 2000. The pregnane X receptor, a
promiscuous xenobiotic receptor that has diverged during evolution.
Mol. Endocrinol. 14: 27-39.
• Wang, H., and LeCluyse E. L. 2003. Role of orphan nuclear receptors in
the regulation of drug metabolising enzymes. Clin. Pharmacokinet. 42:
1331-1357.