Download DNA notes 2014

DNA, Mutations, and Cell Division
Functions of DNA
• Controls cellular activities by an organism by coding for
1. _______________________
2. _______________________
Nucleic Acids
• DNA
–
–
–
–
–
Deoxyribonucleic Acid
Genetic material
Can self-replicate
Made up of ___________________
Shape = double helix
• A twisted rope ladder
Nucleotides
•
Nucleotides are composed of
– A 5-carbon ____________
•
Deoxyribose
– A ___________________
•
PO4-
– One of 4 nitrogen bases
•
•
•
•
•
Adenine [___]
Thymine [___]
Cytosine [___]
Guanine [___]
The two strands of DNA are _______________
• Adenine will only bond with __________________
• Guanine will only bond with __________________
Practice with bonding rules: write the complimentary strand below.
DNA REPLICATION
- DNA must have the ability to create an __________ duplicate of itself
- The sequence in one strand determines precisely what the sequence of
_____________ in the other strand will be. (A-T, G-C)
1. The _______________ bonds holding the two complimentary strands
together break
2. DNA strands _________________
3. Free floating (floating around the nucleus) __________________
nucleotides match up with nucleotides on the __________ DNA
strand (main enzyme: ______________________________)
4. New _________________________strands are formed.
- Semi-conservative
o The _______________ strands are made up of one half old
strand and one half new strand
- The DNA unzips due to the hydrogen bonds between the __________
being broken (DNA _____________)
- These exposed bases attract free floating bases, which are
______________ to the chain by DNA polymerase.
Practice Questions
Pg 666 #3, 4, 7
DNA replication animation worksheet (link on PowerSchool)
Hand in all of the above questions for a formative mark in week 6.
DNA vs RNA
DNA
• _________ stranded
• Nitrogen bases
– Cytosine
– Guanine
– Adenine
– Thymine
– One type of DNA
RNA
• __________ stranded
• Nitrogen bases
– Cytosine
– Guanine
– Adenine
– Uracil [______]
• Many types of RNA
– _____________ RNA
(mRNA)
– _____________ RNA
(tRNA)
– Ribosomal RNA (rRNA)
– Mostly in __________
• Mostly found in ___________
Genes and Proteins
• A ____________is a section of DNA
–Carries the information of the synthesis of a _____________
• __________codes for ___________
Proteins in the Body

_________________________________________________________

_________________________________________________________

_________________________________________________________

_________________________________________________________

_________________________________________________________

_________________________________________________________

_________________________________________________________
Composition of Proteins





Made up of 20 different ____________________________________
Sequence of a.a.’s identifies protein
Sequence of ______________ in DNA determines Sequence of a.a.’s
_________________ = _________________________
Protein Synthesis relies on 3 types of RNA
1. __________________
2. __________________
3. __________________
Types of RNA
Ribosomal RNA (rRNA)
 Makes up the __________________________
Messenger RNA (mRNA)
 Involved in ______________________________ (first stage of
protein synthesis)
 Carries message from ___________ in nucleus to _______________
in cytoplasm
Transfer RNA (tRNA)

carries _________________________ to mRNA
tRNA & rRNA: in ______________________ only
mRNA: in ___________________ & _________________
All RNA produced in nucleolus (inside nucleus)
Protein Synthesis

Occurs primarily in ____________________________

Instructions for protein contained in ______________

Message must get from ____________________ to
___________________ (DNA to ribosome)

Process occurs in 2 steps
o Transcription
o Translation
Protein Synthesis summary
Transcription (RNA copy of DNA)
1. mRNA is made using DNA template
2. mRNA exits nucleus
Translation (reading RNA to code for proteins)
3. tRNA picks up aa’s
4. tRNA anticodon bonds to mRNA codon
5. Peptide bond forms between aa’s
6. Protein used by cell or packaged & exported
7. mRNA breaks into free nucleotides
8. tRNA’s free to pick up more aa’s
Transcription




In ____________________
mRNA made using DNA as a template
If the DNA base sequence is A A T T C C G G A (3 triplets)
The mRNA molecule manufactured would be U U A A G G C C U
(3 triplets)
 Each triplet is a ______________
Codons




Code for ___________________________
May code for _______________ (initiator codon)
May code for _______________ (terminator codon)
___________ is an initiator codon but also codes for the amino acid
methioine
 If code AUG is in middle it must code for methionine

The link for the data booklet and the actual table is on PowerSchool. Your
book has one with abbreviations pg 670-671
Translation


mRNA arrives at ____________________
________________ molecules with a.a.’s are attracted to this mRNA
o Complimentary rule (A attracts U etc….)
 20 a.a.’s therefore, 20 different tRNA’s
Review Questions

mRNA codon for AAT DNA triplet =

DNA triplet for CCG mRNA codon =

tRNA anticodon for GCA DNA triplet =

mRNA codon for GAU tRNA =

tRNA anticodon for UUA mRNA codon =

DNA triplet for CUA anticodon =

codon for UAG anticodon =

anticodon for CTA DNA triplet =
BIOLOGY 30
DNA, RNA, PROTEIN SYNTHESIS EXERCISE
1. Given the sequence of a portion of a non-coding DNA molecule is as follows, fill in the
required information below:
non-coding DNA:
ATG TCT CCG AGA TGG AAA GAC TAA
(a) coding DNA sequence:
_____ _____ _____ _____ _____ _____ _____ _____
(b) mRNA codons:
_____ _____ _____ _____ _____ _____ _____ _____
(c) tRNA anticodons:
_____ _____ _____ _____ _____ _____ _____ _____
(d) amino acid sequence:
(use abbreviations)
_____ _____ _____ _____ _____ _____ _____ _____
2. What is the function of each of the following in protein synthesis?
(a) messenger RNA
(b) transfer RNA
(c) the ribosome
3. How does DNA control your characteristics?
4. Explain why proteins are unique in individual organisms (except identical twins).
Nucleic Acids Worksheet
Given the following piece of messenger RNA (mRNA):
mRNA =
CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC . . .
Answer the following questions.
1. List the DNA strand sequence from which it was transcribed.
2. List the complementary non-coding DNA sequence.
3. List the amino acid sequence of the protein coded for.** Have to start with a start codon**
4. Mutations (in the coding DNA strand)
a. What would be the effect of changing base 14 to a G (begin counting at the beginning)?
b. What would be the effect of changing base 15 to a G (begin counting at the beginning)?
c. What would be the effect of changing base 16 to a G (begin counting at the beginning)?
d. What would be the effect of deleting base 17 (begin counting at the beginning)?
5. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data
sheet to find the sequence of the amino acids coded for.
Coding - T A C C A T G A G A A T T G T G G T C A C C T T T T T
Non-Coding - A T G G T A C T C T T A A C A C C A G T G G A A A A A
6. If the nucleotide at position 23 in the DNA codon is changed to “A”, what effect would this have on the
protein produced?
7. The following is the amino acid sequence for a small section of a protein.
methionine
phenylalanine
cysteine
glutamine
valine
tryptophan
isoleucine
proline
aspartate
serine
asparagine
Answer the following questions using the first codon in your data sheet for all amino acids. Any one of the
three mRNA triplets not listed in the table are chain terminators. Include one at the end of the mRNA and
DNA molecules.
a. Find the mRNA triplets which code for this sequence.
b. Use the mRNA to determine the DNA codon strand.
c. Construct a complete double stranded DNA molecule for this small protein.
Mutations
• Changes in the ____________ of bases in DNA
• Caused by
– _________ , cosmic rays, ___________ …
• Mutagens can affect a ___________in the DNA or it can affect
__________.
– Result = the _______________ that the DNA codes for will be altered.
•
3 types of mutations.
– _____________
– An extra nucleotide is inserted into the DNA
– Causes a _______________
– _____________
– A nucleotide is deleted from the DNA
– Causes a _______________
– _____________
– One nucleotide is substituted for another
Using DNA to explain Evolution
• Species that are closely related will share very ______________
___________________________________________________
• Scientists use mitochondrial DNA (mtDNA) to study the relationship
______________________________________
• Used to explain variety of ethnic groups found throughout the world
(all from African descendents)
Using SINEs and LINEs
• ____________ and ___________ are repeated DNA sequences that
don’t code for anything, but show an evolutionary relationship
• Finding a SINE or LINE in two species and not in other species,
signifies that the first two species must be __________________
_________________________________________ to each other than
to the other species
Genetic Engineering
• A desired _________ can be isolated and millions of copies made
• These copies can then be analyzed to determine the gene’s
_______________ sequence
• This nucleotide sequence can be decoded to find the sequence of
__________________ in the corresponding protein
• Functioning genes can be ___________________ or bacteria, yeasts,
plants, animals
Recombinant DNA
• To recombine DNA
– Gene segments from different sources are recombined _________ and
transferred into cells (usually E. coli) to see what happens.
•
•
•
The desired gene is isolated and cut out of the DNA
• A “_____________________” does this
Isolated gene is inserted into a bacterial plasmid using a
______________________
• Ligase is an enzyme which normally repairs breaks in the
___________________________
• New DNA now called recombinant DNA
The plasmid is absorbed by a ________________
• Reproduces asexually to produce many clones containing the
•
•
•
•
recombinant DNA
Bacterial cells ______________________________
_______________________________
• Desired protein can be _____________ and purified from the culture.
Examples of recombinant DNA technology…
• Interferon
• Human growth hormone
• Human insulin
• ________________
• Agriculture
Gene Therapy
– Replacement of defective _______ with normal healthy _______
• e.g. Cystic fibrosis, hemophilia, sickle-cell anemia, immunedeficiencies
• OBSTACLES today include …
– How to fit genes into the body cells
– How to ________________ the introduced genes
Agriculture
– Introduction of genes for resistance to ________, drought, ______,
increased protein production, larger _________…
DNA Fingerprinting
•
•
•
Used in forensic studies…
Small quantities of _________, ___________, or other tissue can be
tested for the DNA base sequence
A technology called RFLP auto-radiography is used to display selected
DNA fragments as bands
Practice Questions (hand in for Week 7 Formative)
Pg 676 #4,5,6,10
Pg 694 #1,5,6
Pg 702 # 3,4,6,7, 16 (also draw the DNA strand)