* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download dna day becca dillon
Zinc finger nuclease wikipedia , lookup
DNA replication wikipedia , lookup
DNA profiling wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
DNA nanotechnology wikipedia , lookup
Microsatellite wikipedia , lookup
Becca Dillon 2nd Period March 20, 2014 History of DNA http://www.angelfire.com/ks3/deoxyribonucleicacid/history.html 1) Gregor Mendel Hypothesized that plants inherited 2 sets of information (not called genes yet) for one trait He tested his hypothesis on pea plants 2) Fredrick Griffith 1928 Trying to find a vaccine against streptococcus pneumonia, he did 4 experiments which he injected strands of bacteria into mice R was harmless, S was harmful R into mice = alive S into mice = dead Killed S cells + R into mice = dead Killed S cells into mice = dead He called the discovery about heredity; hereditary transformation. 3) Oswald Avery Found a way to extract heat – killed carrying cells (1944) DNA, not proteins, was hereditary substance. 4) Erwin Chargaff Biochemist first figured out bases of DNA Adenine with Thymine; Cytosine with Guanine 5) Maurice Wilkins and Rosalind Franklin First to obtain very good x-ray of DNA fibers At the time there was little known about DNA They figured out DNA was long and thin 6) James Watson and Francis Crick 1951 Watson & Crick examined DNA, discovered it snows an x-ray shape. Characteristic of a helix April of 1953 came up with double helix Scientific breakthroughs developed due to knowledge of DNA structure http://www.nobelprize.org/educational/medicine/dna_double_helix/readmore.html 1) “ The scientist Linus Pauling was eager to solve the mystery of the shape of DNA. In 1954 he became a Nobel Laureate in Chemistry for his groundbreaking work on chemical bonds and the structure of molecules and crystals. In early 1953 he had published a paper where he proposed a triplehelical structure for DNA. Watson and Crick had also previously worked out a three-helical model, in 1951. But their theory was wrong.” 2) and Crick. This discovery would not have happened without the past discoveries from Watson 3) Scientists all work together and are “on the same team” to figure out as much information about DNA as possible. Scientists put out their information that they have found and let other people build on that. DNA would’ve gotten nowhere with out everyone hard work and communication. Explanation of DNA replication http://www.sparknotes.com/biology/molecular/dnareplicationandrepair/section1.rhtml 1) The first step is the separation of two DNA strands 2) DNA helicase untwists the helix 3) As the helicase moves down the DNA it is making the opposite pairs (A with T; G with C). 4) Once the helicase hits the certain enzyme it stops trying to math the pairs. How mutations cause disease… http://www.yourgenome.org/dgg/general/var/var_3.shtml A change in DNA sequence. Mutations are relatively common in our DNA, but most have no effect on us. A and T have to go together, C and G have to go together – when they get swapped (T and C), it is called a mutation. It is possible to inherit the mutation from a parent or parents. http://genetics.thetech.org/about-genetics/mutations-and-disease These mutations can even be developed throughout ones lifetime. Carcinogens are things that can make someone more likely to develop the mutation. (Examples: Smoking, UV light, Sun, Polluted air, and many more things.) Most are recessive mutations which in order for the mutation to show one would need two recessive traits. Disease that your model illustrates and the type of mutation that causes the disease http://www.cancer.org/cancer/breastcancer/detailedguide/breast-cancer-what-causes Breast Cancer Someone could inherit the gene from his or her parent or parents. Scientists and doctors are not quite sure what causes breast cancer but they have the research that has proof that it has something to do with a hormone. The hormone causes cells to die at the right time, are called tumor suppressor genes. The tumor suppressor genes are supposed to kill the cancer cells when they “appear” but sometimes they don’t. Once the cells start to replicate (1, 2, 4, 16, 32, etc.) it is really hard to stop them if there is too many. Soon there starts to grow a tumor (a clump of cancer cells). Cancer cells can not only replicate and replicate but they can invade unharmed cells to become cancer cells. http://www.ncbi.nlm.nih.gov/snp/?term=breast+cancer&SITE=NcbiHome&submit=Go CTTCCACTCTCAAAGGGCTTCTGAT[G/T]TGCTACATTTGAATCTAATGGATCA