Download dna day becca dillon

Becca Dillon
2nd Period
March 20, 2014
History of DNA
http://www.angelfire.com/ks3/deoxyribonucleicacid/history.html
1)
Gregor Mendel

Hypothesized that plants inherited 2 sets of information (not called genes yet) for one trait

He tested his hypothesis on pea plants
2)

Fredrick Griffith
1928

Trying to find a vaccine against streptococcus pneumonia, he did 4 experiments which he injected
strands of bacteria into mice

R was harmless, S was harmful

R into mice = alive

S into mice = dead

Killed S cells + R into mice = dead

Killed S cells into mice = dead

He called the discovery about heredity; hereditary transformation.
3)
Oswald Avery

Found a way to extract heat – killed carrying cells

(1944) DNA, not proteins, was hereditary substance.
4)
Erwin Chargaff

Biochemist first figured out bases of DNA

Adenine with Thymine; Cytosine with Guanine
5)
Maurice Wilkins and Rosalind Franklin

First to obtain very good x-ray of DNA fibers

At the time there was little known about DNA

They figured out DNA was long and thin
6)
James Watson and Francis Crick

1951

Watson & Crick examined DNA, discovered it snows an x-ray shape.

Characteristic of a helix

April of 1953 came up with double helix
Scientific breakthroughs developed due to knowledge of DNA structure
http://www.nobelprize.org/educational/medicine/dna_double_helix/readmore.html
1)
“ The scientist Linus Pauling was eager to solve the mystery of the shape of DNA. In
1954 he became a Nobel Laureate in Chemistry for his groundbreaking work on chemical bonds and the
structure of molecules and crystals. In early 1953 he had published a paper where he proposed a triplehelical structure for DNA. Watson and Crick had also previously worked out a three-helical model, in
1951. But their theory was wrong.”
2)
and Crick.
This discovery would not have happened without the past discoveries from Watson
3)
Scientists all work together and are “on the same team” to figure out as much
information about DNA as possible. Scientists put out their information that they have found and let
other people build on that. DNA would’ve gotten nowhere with out everyone hard work and
communication.
Explanation of DNA replication
http://www.sparknotes.com/biology/molecular/dnareplicationandrepair/section1.rhtml
1)
The first step is the separation of two DNA strands
2)
DNA helicase untwists the helix
3)
As the helicase moves down the DNA it is making the opposite pairs
(A with T; G with C).
4)
Once the helicase hits the certain enzyme it stops trying to math the pairs.
How mutations cause disease…
http://www.yourgenome.org/dgg/general/var/var_3.shtml

A change in DNA sequence. Mutations are relatively common in our DNA, but most have no
effect on us.

A and T have to go together, C and G have to go together – when they get swapped (T and C), it is
called a mutation.

It is possible to inherit the mutation from a parent or parents.
http://genetics.thetech.org/about-genetics/mutations-and-disease

These mutations can even be developed throughout ones lifetime. Carcinogens are things that can
make someone more likely to develop the mutation. (Examples: Smoking, UV light, Sun, Polluted air,
and many more things.)

Most are recessive mutations which in order for the mutation to show one would need two
recessive traits.
Disease that your model illustrates and the type of mutation that causes the disease
http://www.cancer.org/cancer/breastcancer/detailedguide/breast-cancer-what-causes

Breast Cancer

Someone could inherit the gene from his or her parent or parents.

Scientists and doctors are not quite sure what causes breast cancer but they have the research that
has proof that it has something to do with a hormone.

The hormone causes cells to die at the right time, are called tumor suppressor genes. The tumor
suppressor genes are supposed to kill the cancer cells when they “appear” but sometimes they don’t. Once
the cells start to replicate (1, 2, 4, 16, 32, etc.) it is really hard to stop them if there is too many. Soon
there starts to grow a tumor (a clump of cancer cells).

Cancer cells can not only replicate and replicate but they can invade unharmed cells to become
cancer cells.
http://www.ncbi.nlm.nih.gov/snp/?term=breast+cancer&SITE=NcbiHome&submit=Go

CTTCCACTCTCAAAGGGCTTCTGAT[G/T]TGCTACATTTGAATCTAATGGATCA