Download Ch. 13: DNA, RNA and Proteins

DNA, RNA and Proteins
12-1: The Structure of DNA
What is genetic material composed of?
What experiments helped to identify the
role of DNA?
What is the shape of a DNA molecule?
How is information organized in a DNA
molecule?
What scientific investigations led to the
discovery of DNA’s structure?
Structure of DNA
• People have historically had an
interest in heredity
• Mendel suggested parents
physically gave traits to
offspring in early 1800’s
• Discovered mitosis and meiosis
in late 1800’s
• 1950’s knew chromosomes
where made of DNA
• DNA’s structure (and
importance) was discovered in
1953.
• Human genome work done in
2004.
DNA: The Genetic Material
• DNA is the primary material that causes
inherited traits.
• DNA is a fairly simple chemical compound
–
–
–
–
–
DNA stands for deoxyribonucleic acid
It contains ribose sugar, phosphate and 4 ‘bases’
Chromosomes are made of DNA and protein
DNA codes for how to make proteins
Proteins are responsible for the traits (growth
hormone for tallness and antigens for type A blood
are both proteins)
Discovery of DNA
• Three experiments suggested and proved that
DNA was the molecule that carried information
between cells
– Fredrick Griffith worked with bacteria in mice (1928)
• See page 294
• Griffith discovered Bacterial Transformation
– Oswald Avery worked with bacteria (1940’s)
• Transformation caused by DNA for specific
protein
– Alfred Hershey and Martha Chase worked with
bacteria and viruses called ‘phages’.(1952)
Summary of Experiments
• Griffith found that
– Bacteria can “trade information” and “learn how to
make new proteins”
• Avery found that
– It is the DNA that “tells” the bacteria cells how to make
the new proteins ( for the capsule that caused the
deadly form of bacteria)
• Hershey and Chase found that
– If you trace DNA from a virus it goes into the infected
bacteria cells. But the protein from the virus does not
enter the infected cell.
• DNA transmits the information about how to make a protein
• DNA can move between cells
Shape of DNA
• James Watson and Francis Crick discovered
• 1953, at Cambridge University
• Knowing structure allowed them to figure out how it does
its job
– Code is linear (along the length, “spelled” with 4 bases; ATCG)
– It can open up to make copies
• Shape is called a double helix
Part of the DNA strand
• Back bone of double helix is a sugar
(deoxyribose) and phosphate strand
– strong covalent bonds.
– S (sugar)-P-S-P-S-P…..
– P is phosphate; PO4 -3
• Nitrogenous bases make up the ‘rungs’ that hold
the ‘backbones’ of the helix together.
– Adenine(A), guanine(G), cytosine(C) and thymine (T)
– A bonds to T and C bonds to G using Hydrogen
bonds
– DNA splits open between bases during replication
Information on DNA
• The linear sequence of bases is THE
CODE
• Pattern of ATC and G along the length of
the double helix codes for how to make all
of the proteins needed to build and to run
cells (organisms)
• One side of the helix is the actual
information. The other side is
“complementary” - actually it’s the
opposite. (A-T and C-G)
What Watson and Crick Discovered
1.
Pattern
Used data from E. Chargaff to build model with A across from T and
C across from G
2. Technology
M. Wilkins and R. Franklin showed them how to take xray crystallography (pictures) of the DNA strand …coils
3. Model
built a 3-D model to help decide research/hypothesis
and noticed that the model was the answer.
4. Published famous paper
in journal called Nature in 1953
5. Received Nobel Prize
1962
13-2: Replication of DNA
• How does DNA replicate or make a copy
of itself?
• What are the roles of proteins in DNA
replication?
• How is DNA replication different in
prokaryotes and eukaryotes?
DNA Replication
• A dividing cell makes an exact copy of the
DNA information in its nucleus before it
divides
– Short version (during S portion of Interphase)
•
•
•
•
DNA double helix unzips
Right side makes a new left half
Left side makes a new right half
2 new, identical, complete copies
Semi-conservative Replication
•*See pic. on pg 301 * know this process *
•The detailed version 
1. Enzymes cause helix to unwind
Enzyme called helicase ( all enzymes end in –ase)
Split is called replication fork (Y shape)
Direction of copying is ‘antiparallel; one strand copies top to
bottom, other - from bottom toward top
2. Complementary bases are added to the exposed bases
A to T and C to G
Bases are available from diet, in the nucleoplasm
Spontaneous hydrogen bonds
3. As bases are added helix reseals and twists
Enzyme that adds bases is called DNA polymerase
4. Proof reading of DNA occurs using yet another enzyme
One mistake per billion nucleotides
5. These enzymes are proteins that were coded for by DNA!
Prokaryotes vs. Eukaryotes
• DNA is packaged into chromosomes
– Prokaryotes have 1
– Eukaryotes have many
– Regions of chromosomes that code for a protein are called genes
• Other
–
–
–
–
Smallest euk. chromo is 10x prok. Chromo
All human chromosome information stretch out = 2 meters
Bacteria would only be 0.25 cm
Human would take 33 days to copy starting at only one point.
• Prokaryotes
– Replication of the one chromosome starts at a single point.
• Eukaryotes
– DNA coiled around protein threads called histones
– Replication starts at many points and goes in both directions
– Occurs faster; since there’s so much more to copy (only 8 hrs.)
DNA
Transcription
RNA
Translation
Protein
synthesis
Actual
directions
chemical, found
in the nucleus;
can not leave
Making a copy
DNA  RNA
Edit to mRNA
Copy of the
directions, able to
go to ribosomes
Reading the
directions on
mRNA to make a
protein
Finishing protein
beyond putting aa
together, fold and
package
Cook book
Each recipe is a
gene, each
family has their
own versions
Copying recipe to
recipe card or
emailing to a
friend
Recipe on recipe
card/ email
arriving at
friends house
Following recipe
at a friends
house, from card
or email
Not just mixing
the cookie
dough, but
baking/cooling/p
utting in
bags/etc and
doing the dishes
Encyclopedia
set - that can
not leave
library; entire
wikipedia
information
Photocopy of one
entry
You, taking the
photocopy/print
out of library/
home
You use
information from
this print out to
put together
paragraphs for a
report
The actual
finished report
that you hand in
All the possible
soccer plays
known
The actual route
your team decides
to use to pass
The fact that the
players know
their positions
for the throwing
Completing the
throw in
Adding that
throw in to other
moves to score a
goal
Look up “fact”
Transcription
• Copying DNA information onto RNA
• DNA can not leave nucleus
• Proteins are made at ribosomes, out in the
cytoplasm; either free or attached to rER
• DNA opens and one side is ‘read’ and a
copy is made
• Can make multiple copies, send to lots of
ribosomes, make lots of protein at once
• RNA is edited and the final version, mRNA
leaves the nucleus, carrying the message
Translation
• mRNA is ‘decoded’ by the ribosome
• The right amino acids placed in the right order to
make a protein.
• Code is 300-400 bases long
• Read in groups of three called codons
• Codon = ‘piece of code’
• This equals 100+ amino acids
• Right amino acids bonded, using peptide bonds
= polypeptide = completed, folded polypeptide =
protein.
* Everything in your body is a protein or is
regulated and controlled by a protein! *
Protein synthesis
• Complete process
– Read DNA code
– Assemble amino acids in order
– Fold and process polypeptide
– Have a functional protein
– Transcription + Translation + Processing
Translate and transcribe the
following information into an amino
acid sequence
GAAAATATCATCTATGGTGGTGTTTAA