Download Patent ductus arteriosus in mice with smooth muscle

RESEARCH ARTICLE 4191
Development 137, 4191-4199 (2010) doi:10.1242/dev.052043
© 2010. Published by The Company of Biologists Ltd
Patent ductus arteriosus in mice with smooth muscle-specific
Jag1 deletion
Xuesong Feng*, Luke T. Krebs* and Thomas Gridley†,‡
SUMMARY
The ductus arteriosus is an arterial vessel that shunts blood flow away from the lungs during fetal life, but normally occludes
after birth to establish the adult circulation pattern. Failure of the ductus arteriosus to close after birth is termed patent ductus
arteriosus and is one of the most common congenital heart defects. Mice with smooth muscle cell-specific deletion of Jag1, which
encodes a Notch ligand, die postnatally from patent ductus arteriosus. These mice exhibit defects in contractile smooth muscle
cell differentiation in the vascular wall of the ductus arteriosus and adjacent descending aorta. These defects arise through an
inability to propagate the JAG1-Notch signal via lateral induction throughout the width of the vascular wall. Both heterotypic
endothelial smooth muscle cell interactions and homotypic vascular smooth muscle cell interactions are required for normal
patterning and differentiation of the ductus arteriosus and adjacent descending aorta. This new model for a common congenital
heart defect provides novel insights into the genetic programs that underlie ductus arteriosus development and closure.
KEY WORDS: Congenital heart defects, Notch signaling pathway, Vascular smooth muscle differentiation, Mouse
an arterial blood vessel that connects the pulmonary artery and
the descending aorta during fetal life. After birth, the ductus
arteriosus is normally rapidly and permanently occluded,
separating the pulmonary and systemic circulations to establish
the normal adult circulatory pattern. Failure of the ductus
arteriosus to close after birth is termed PDA and is one of the
most common human congenital heart defects. PDA patients are
at increased risk of pulmonary and cardiac problems such as
pulmonary hemorrhage, congestive heart failure, chronic lung
disease, sepsis and necrotizing enterocolitis (Clyman, 2006;
Forsey et al., 2009; Schneider and Moore, 2006). Mice with
smooth muscle-specific deletion of Jag1 exhibit defects in
contractile smooth muscle cell differentiation in the vascular
wall of the ductus arteriosus and adjacent descending aorta.
These defects appear to arise through an inability to propagate
the JAG1-Notch signal by lateral induction throughout the
vascular wall of these vessels. Our novel model for this common
congenital heart defect provides new insights into the genetic
programs that underlie ductus arteriosus development and
closure.
MATERIALS AND METHODS
Mice
We described previously the Jag1 null allele (Xue et al., 1999) and Jag1
conditional allele (Jag1flox) (Kiernan et al., 2006). SM22a-Cre (official
name Tagln-Cre) (Holtwick et al., 2002) and Tek-Cre (also known as Tie2Cre) (Koni et al., 2001) mice were obtained from the Jackson Laboratory.
Animal protocols were approved by the Jackson Laboratory Animal Care
and Use Committee.
Intracardiac injections
The Jackson Laboratory, Bar Harbor, ME 04609, USA.
*These authors contributed equally to this work
†
Present address: Center for Molecular Medicine, Maine Medical Center Research
Institute, Scarborough, ME 04074, USA
‡
Author for correspondence ([email protected])
Accepted 18 October 2010
To better visualize the outflow tract and ductus arteriosus, hearts of SM22aCre/+; Jag1flox/– mutant and control littermate mice were injected with
Microfil silicone rubber injection compound (MV-122; Flow Tech). Pups
were isolated at E18.5 by caesarean section, and were euthanized 7 hours
post-surgery. The chest cavities were opened and fixed in 10% neutral
buffered formalin. After fixing for 1 hour, neonates were rinsed and
Microfil compound was injected into the left ventricle using a 27 gauge
needle.
DEVELOPMENT
INTRODUCTION
The evolutionarily conserved Notch signaling pathway plays a major
role in vascular development in mammals and other vertebrates
(Gridley, 2010; Hofmann and Iruela-Arispe, 2007; Phng and
Gerhardt, 2009; Roca and Adams, 2007). Among the developmental
decisions regulated by the Notch pathway during embryonic vascular
development are arterial-venous specification, endothelial tip cell
differentiation, and vascular smooth muscle cell differentiation.
Whereas most Notch signaling pathway components are expressed
in endothelial cells, Jag1 (which encodes a ligand for Notch pathway
receptors) is unusual in that it is expressed in both endothelial cells
and vascular smooth muscle cells (Villa et al., 2001). Mice
homozygous for a Jag1 null mutation die from hemorrhage early
during embryogenesis, exhibiting defects in remodeling of the
embryonic and yolk sac vasculature (Xue et al., 1999). Endothelial
cell-specific deletion of Jag1 with a Cre deleter that is highly
expressed during embryogenesis also results in early embryonic
lethality owing to vascular defects resulting from the defective
development of vascular smooth muscle (High et al., 2008).
Similarly, endothelial cell-specific deletion of Jag1 using an
inducible Cre deleter line results in reduced coverage of retinal
arteries by vascular smooth muscle cells (Benedito et al., 2009).
However, it has not been established whether Jag1 plays an essential,
cell-autonomous role in the vascular smooth muscle cell lineage.
We report here the phenotype of embryos and mice with
smooth muscle-specific Jag1 deletion. These mice die in the
early postnatal period from patent ductus arteriosus (PDA), a
defect of the outflow tract of the heart. The ductus arteriosus is
Indomethacin treatment
To determine whether postnatal indomethacin administration could rescue
closure of the ductus arteriosus of SM22a-Cre/+; Jag1flox/– neonatal mice,
newly born pups were injected subcutaneously with indomethacin (6 mg/kg
body weight) within 12 hours of birth. Pups were euthanized 6 hours after
injection, the chest cavities were opened and closure of the ductus
arteriosus was scored visually. In some treated mice, outflow tracts were
visualized by Microfil injection.
Histology and immunofluorescence
Embryos were fixed in Dent’s (20% DMSO, 80% methanol) and/or 4%
paraformaldehyde. Chest cavities were embedded in paraffin, sectioned and
stained with Hematoxylin and Eosin. For immunohistochemistry, the sections
were de-waxed in a standard xylene and ethanol series, then rehydrated with
phosphate-buffered saline (PBS). An antigen-retrieval step was performed in
boiling 10 mM sodium citrate (pH 6.0) for 10 minutes for antibodies except
anti-PECAM1 (0.01% trypsin for 15 minutes at 37°C) and anti-phosphohistone H3 (10 mg/ml proteinase K for 5 minutes). Slides were then blocked
in 5% goat serum and 2% BSA in PBST (PBS + 0.1% Tween-20) for 2 hours
at room temperature before being incubated with diluted primary antibodies
at 4°C overnight. Tyramide-amplified immunofluorescent staining for the
NOTCH1 Val1744 epitope was performed as described (Del Monte et al.,
2007). Primary antibodies used in this study include: anti-PECAM1 (BD
Biosciences Pharmingen; 1:100; only works for Dent’s-fixed embryos);
polyclonal anti-smooth muscle 22a protein (Abcam; 1:400); polyclonal antismooth muscle alpha actin (Abcam; 1:200); polyclonal anti-smooth muscle
myosin heavy chain (Biomedical Technologies; 1:200); anti-phospho-histone
H3 (Upstate Biotechnology; 1:100); polyclonal anti-JAG1 (Santa Cruz, H114; 1:50); polyclonal anti-cleaved NOTCH1 (Val1744; Cell Signaling); and
polyclonal anti-NOTCH3 (Abcam ab23426; 1:250). Alexa Fluor fluorescent
secondary antibodies (Molecular Probes), which included goat anti-rabbit
Alexa Fluor 488 and 555, goat anti-rat Alexa Fluor 488 and 555, were
applied for 2 hours at room temperature or at 4°C overnight. All slides were
mounted using Vectashield mounting medium with DAPI (Vector
Laboratories).
Microscopy
For transmission electron microscopy, chest cavities of E18.5 and P0 mice
were fixed in 2% glutaraldehyde with 0.1 M sodium cacodylate (pH 7.2)
overnight at 4°C. The ductus arteriosus was carefully dissected out and
embedded in resin at 70°C for 48 hours. Sections (90 nm) were collected on
a 300-mesh copper grid and stained with 2% uranyl acetate and Reynold’s
lead, then viewed on a JEOL 1230 JM transmission electron microscope. For
light microscopy, histological and immunofluorescent images were taken
with a Zeiss Axioplan microscope or a Leica SP5 confocal microscope.
Quantitative (q) RT-PCR
The ductus arteriosus and ascending aorta from P0 neonates and E18.5
embryos were microdissected and immersed in RNAlater (Ambion).
Genotypes were identified by allele-specific PCR. We combined two to
five ductus arteriosi or ascending aortas of the same genotype to increase
the RNA extraction yield. RNA was prepared using the Qiagen Mini
mRNA Extraction Kit. RNA (100 ng of each sample) was reverse
transcribed with random hexamers (Ambion). qRT-PCR was performed
with the Super SYBR Master Mix Kit (Applied Biosystems). For each
gene tested we performed three experimental repeats and three biological
repeats. Expression levels were normalized to Gapdh expression. The study
was performed on the ABI 7500 platform using SDS software. The primers
used were designed by Primer Bank (Spandidos et al., 2008) (forward and
reverse; 5⬘ to 3⬘): smooth muscle 22a, CAACAAGGGTCCATCCTACGG
and ATCTGGGCGGCCTACATCA; smoothelin, ATGGCAGACGAGGCTTTAGC and AGTGTAGCCAGTTCTCCTTGTT; smooth muscle
actin a2, GTCCCAGACATCAGGGAGTAA and TCGGATACTTCAGCGTCAGGA; smooth muscle actin 2, CCGCCCTAGACATCAGGGT and TCTTCTGGTGCTACTCGAAGC; smooth muscle
myosin heavy chain, AAGCTGCGGCTAGAGGTCA and CCCTCCCTTTGATGGCTGAG; calponin, AGAACCGGCTCCTGTCCAA and
GTGTGCATAGGATAACCCCATC; Gapdh, AGGTCGGTGTGAACGGATTTG and TGTAGACCATGTAGTTGAGGTCA.
Development 137 (24)
RESULTS
Mouse embryos with endothelial cell-specific
deletion of the Jag1 gene phenocopy Jag1 null
mutants
To assess whether Jag1 function is required in both endothelial and
vascular smooth muscle cells, we performed tissue-specific Jag1
gene deletions. Endothelial-specific Jag1 deletion has been
reported previously (High et al., 2008) using an independently
generated Jag1 conditional allele. Endothelial cell-specific deletion
of our Jag1 conditional allele (Kiernan et al., 2006) yielded results
identical to those published previously (High et al., 2008).
Endothelial cell-specific Jag1 mutant embryos phenocopied
constitutive Jag1 null mutant embryos (Xue et al., 1999).
Endothelial cell-specific Jag1 mutant embryos died at
approximately embryonic day (E) 10.5, exhibiting yolk sac
vascular remodeling defects (see Fig. S1 in the supplementary
material), hemorrhages (see Fig. S1 in the supplementary material)
and non-cell-autonomous defects in vascular smooth muscle cell
differentiation (see Fig. S2 in the supplementary material). These
results demonstrate that the early lethality of Jag1 null embryos is
due to Jag1 function in endothelial cells, and that Jag1 expression
in endothelial cells is required for the differentiation of adjacent
mural cells into vascular smooth muscle.
Mice with smooth muscle-specific deletion of Jag1
die postnatally due to patent ductus arteriosus
To assess whether Jag1 function is also required in vascular smooth
muscle cells, we performed smooth muscle-specific deletion using
SM22a-Cre (also known as Tagln-Cre) mice (Holtwick et al.,
2002). SM22a-Cre/+; Jag1flox/– (hereafter referred to as Jag1SMcko, for Jag1 smooth muscle conditional knockout) mice were
generated by crossing SM22a-Cre/+; Jag1+/– males with
Jag1flox/flox female mice. Unlike embryos with endothelial cellspecific Jag1 deletion, Jag1-SMcko mice were found alive and in
the expected Mendelian ratios at postnatal day (P) 0, the day of
birth. However, ~50% of the Jag1-SMcko neonates died by P1, and
no Jag1-SMcko mice survived past P2 (Table 1). Jag1-SMcko mice
in the early postnatal period could be identified by their cyanotic
appearance, which suggested the possibility of cardiovascular
defects. We therefore assessed the morphology of the heart and
cardiac outflow tract in Jag1-SMcko and control littermate mice
from E18.5 through P2. This analysis revealed that 95% (53/56) of
Jag1-SMcko mice born exhibited PDA (Fig. 1B,C,G; Table 2; see
Fig. S3 in the supplementary material). In addition to PDA, a
subset of Jag1-SMcko mice also exhibited another outflow tract
defect termed retroesophageal right subclavian artery (Fig. 1C;
Table 2).
Jag1-SMcko mice exhibit defects in vascular
smooth muscle differentiation in the ductus
arteriosus and the adjacent descending aorta
Ductus arteriosus closure postnatally requires differentiated
vascular smooth muscle cells to contract in response to a drop in
circulating prostaglandin levels and a rise in oxygen tension that
occur after birth. We assessed vascular smooth muscle cell
differentiation in the walls of the outflow tract vessels by
immunofluorescent staining for several smooth muscle contractile
proteins. Using an antibody against smooth muscle 22a protein
(SM22a) at P0 we found that, in contrast to the control littermate
ductus arteriosus, which has multiple layers of differentiated
smooth muscle cells occupying almost the entire width of the
ductus arteriosus wall (Fig. 1E,F), the Jag1-SMcko ductus
DEVELOPMENT
4192 RESEARCH ARTICLE
Jag1 in vascular development
RESEARCH ARTICLE 4193
Fig. 1. Jag1-SMcko mice exhibit patent ductus arteriosus.
(A-C)Outflow tracts of P0 mice. In the control littermate (CT) outflow
tract (A), the ductus arteriosus (arrowhead) has closed. The ductus
arteriosus in Jag1-SMcko mice (B,C, arrowhead) is not closed and blood
can be observed flowing through the still-patent ductus. The Jag1SMcko mouse shown in B represents the most common Jag1-SMcko
mutant phenotype. These mice have a normally patterned outflow
tract, but exhibit patent ductus arteriosus (PDA). The mouse shown in C
represents a subset of Jag1-SMcko mice that displays both PDA and
retroesophageal right subclavian artery (arrow). (D,G)Histological
analysis confirmed PDA in P0 Jag1-SMcko (G) versus control (D) mice.
(E,F,H,I) Fluorescent immunostaining using markers for smooth muscle
cells (orange, anti-SM22a antibody) and endothelial cells (green, antiPECAM1 antibody) revealed reduced vascular smooth muscle cell
differentiation in the ductus arteriosus and adjacent descending aorta
of Jag1-SMcko (H,I) versus control (E,F) mice. F and I are higher
magnification views of the descending aorta vessel wall shown in E and
H, respectively. All sections are counterstained with DAPI to highlight
cell nuclei (blue). aAo, ascending aorta; dAo, descending aorta; DA,
ductus arteriosus; PT, pulmonary artery trunk; RCA, right common
carotid artery; LCA, left common carotid artery; RSA, right subclavian
artery. Scale bars: 1 mm in A-C; 200m in D,E,G,H.
cell surface (Fig. 5A), the nonfunctional JAG1 protein generated
after deletion of the Jag1flox allele appeared to localize to the
cytoplasm (Fig. 5B). Using this assay, we compared Jag1 gene
deletion in Jag1-SMcko and control littermate embryos at E13.5.
This analysis revealed equivalent Jag1 gene deletion in the
embryonic ascending aorta (Fig. 5H), which does not exhibit the
differentiation defect, and embryonic ductus arteriosus and
descending aorta (Fig. 5F). These data demonstrate that regional
Table 1. Survival of Jag1-SMcko embryos and mice
Age
E18.5
P0
P1
P2
Weaning
Jag1-SMcko
All other genotypes
3 (3)
24 (24)
29 (15)
0
0
19
76
80
29
52
Shown is the number of littermates of Jag1-SMcko (with the number surviving in
parentheses) versus all other genotypes.
Table 2. Phenotypes of Jag1-SMcko embryos and mice
Phenotype
PDA
RRSA
Jag1-SMcko
All other genotypes
53/56 (95%)
14/56 (25%)
7/204 (3.4%)
1/204 (0.5%)
Shown is the occurrence of patent ductus arteriosus (PDA) and retroesophageal
right subclavian artery (RRSA) among total littermates of Jag1-SMcko versus all other
genotypes.
DEVELOPMENT
arteriosus has a much thinner region of SM22a-expressing cells
adjacent to the endothelial cell layer (Fig. 1H,I). Reduced numbers
of SM22a-expressing cells were also observed in the medial wall
of the connecting descending aorta (Fig. 1H,I). Analyzing
additional contractile smooth muscle cell markers, such as smooth
muscle a-actin (SMA; also known as ACTA2) and smooth muscle
myosin heavy chain (SMMHC; also known as MYH11), defects in
vascular smooth muscle cell differentiation in the ductus arteriosus
and descending aorta of Jag1-SMcko embryos could be observed
at E17.5 (Fig. 2A-C versus 2A⬘-C⬘), when the ductus arteriosus in
both the Jag1-SMcko and littermate control embryos is still patent.
Surprisingly, we found that vascular smooth muscle cell
differentiation defects in Jag1-SMcko mice were restricted to the
region of the ductus arteriosus and the adjacent descending aorta.
Both the ascending limb of the aorta (Fig. 2D⬘-F⬘) and the
pulmonary artery trunk (Fig. 2G⬘-I⬘) of the mutant embryos
exhibited normal differentiation of contractile vascular smooth
muscle cells throughout the medial wall.
Additional assays support our finding of defects in vascular
smooth muscle cell differentiation in the outer layers of the medial
wall of the ductus arteriosus and descending aorta of Jag1-SMcko
mice. We assessed expression levels of genes involved in
contractile smooth muscle cell differentiation by quantitative realtime RT-PCR of RNA isolated at P0 from the ductus arteriosus
(which displays the differentiation defect) and ascending aorta
(which does not display the defect) of Jag1-SMcko and control
littermate mice. The expression of all these contractile smooth
muscle cell marker genes was downregulated in the ductus
arteriosus of Jag1-SMcko compared with wild-type littermates (Fig.
3). However, in RNA isolated from the ascending aorta, only the
SMMHC gene (Myh11) exhibited substantial downregulation in
Jag1-SMcko mutants. Ultrastructural analysis further revealed that
whereas the control ductus arteriosus medial wall is composed of
compact, well-organized smooth muscle cell layers throughout the
width of the vessel wall (Fig. 4A,C), the Jag1-SMcko ductus
arteriosus is composed of more loosely organized cells surrounded
by thicker layers of extracellular matrix (Fig. 4B,D). Taken
together, these data demonstrate that PDA in Jag1-SMcko mice is
caused by defects in vascular smooth muscle cell differentiation in
the ductus arteriosus and descending aorta.
A possible explanation for the regional restriction of the vascular
smooth muscle cell differentiation defect in Jag1-SMcko mice is
that SM22a-Cre-mediated recombination is more efficient in the
ductus arteriosus and its adjacent descending aorta than it is in the
pulmonary trunk and ascending aorta. Cre-mediated deletion of our
Jag1flox allele generates a nonfunctional, but still immunoreactive,
JAG1 protein that exhibits altered cellular trafficking (Kiernan et
al., 2006) (Fig. 5). Detection of this nonfunctional JAG1 protein by
immunofluorescence enabled us to assess Cre-mediated Jag1
deletion in the outflow tract of Jag1-SMcko embryos (Fig. 5).
Whereas the wild-type JAG1 protein localized primarily around the
4194 RESEARCH ARTICLE
Development 137 (24)
Fig. 2. Jag1-SMcko mouse embryos exhibit regionally restricted
vascular smooth muscle cell differentiation defects.
(A-I⬘) Immunofluorescent staining of outflow tract vessels in E17.5 control
littermate (A-I) and Jag1-SMcko (A⬘-I⬘) embryos stained with antibodies
(red) against smooth muscle 22a (SM22), smooth muscle myosin heavy
chain (SMMHC) and smooth muscle actin (SMA). All sections were
counterstained with DAPI (blue). In the control (A-C), expression of these
contractile smooth muscle cell proteins was observed throughout the
width of the medial wall of the ductus arteriosus (DA) and descending
aorta (dAo). However, in the Jag1-SMcko ductus arteriosus and
descending aorta (A⬘-C⬘), expression of all three contractile smooth muscle
cell proteins was observed only in the region adjacent to the endothelial
cell layer lining the lumens of the ductus arteriosus and descending aorta.
By contrast, in both the ascending aorta (aAo) (D-F versus D⬘-F⬘) and
pulmonary artery (PA) (G-I versus G⬘-I⬘), no differences in expression of
these contractile smooth muscle cell proteins were observed between the
control littermates and Jag1-SMcko embryos. Asterisks (A-C⬘) mark the
entry point of the ductus arteriosus (left side) with the descending aorta
(right side). Scale bars: 100m for A-F⬘; 50m for G-I⬘.
restriction of the vascular smooth muscle cell differentiation defect
in Jag1-SMcko embryos is not caused by regional differences in
Jag1 gene deletion.
JAG1 regulates its own expression via lateral
induction
Previous studies have shown that Jag1 is highly expressed in both
endothelial cells and smooth muscle cells of large arteries at early
embryonic stages in mice (High et al., 2008; Loomes et al., 1999).
However, Jag1 expression in the outflow tract at later embryonic
stages has not been closely examined. We assessed JAG1 protein
expression by immunofluorescence from E13.5 through E16.5. At
E13.5, JAG1 was expressed at high levels across the full width of the
vessel wall of the ductus arteriosus and descending aorta (Fig. 6A,J).
By contrast, in the ascending aorta and pulmonary artery trunk, only
the layer of smooth muscle cells adjacent to the endothelial layer
displayed a similarly high level of JAG1 expression (Fig. 6A,J versus
6D,G). The expression pattern seen at E13.5 was maintained at
stages as late as E15.5 (see Fig. S4 in the supplementary material),
although the high levels of JAG1 expression observed in the ductus
arteriosus and descending aorta at E13.5 gradually declined. By
E16.5, JAG1 expression had decreased to a low level in all parts of
the outflow tract.
We utilized the altered cellular localization of the mutant JAG1
protein to assess the consequences of inactivation of JAG1 function
in Jag1-SMcko embryos. Expression of mutant JAG1 protein in
Jag1-SMcko ductus arteriosus and descending aorta was restricted to
vascular smooth muscle cells in the region of the medial wall
DEVELOPMENT
Fig. 3. Transcription of contractile smooth muscle cell marker
genes is reduced in Jag1-SMcko mice. Relative gene expression
levels were examined in ductus arteriosus (top) and ascending aorta
(bottom) in P0 wild-type (WT) and Jag1-SMcko (CKO) mice. Genes
included encode smooth muscle 22a (SM22), smooth muscle actin a2
(SMA2a), smooth muscle actin 2 (SMA2g), smooth muscle myosin
heavy chain (SMMHC), smoothelin (SML) and calponin 2 (CALP).
P<0.05 for control versus mutant DA comparisons (Student’s t-test);
aAo comparisons (except the SMMHC comparison) were not
statistically significant. Error bars indicate standard deviation of the
mean.
Fig. 4. Ultrastructural changes in the ductus arteriosus wall of
Jag1-SMcko mouse embryos. (A-D)The tunica media of E18.5
control littermate ductus arteriosus (A) is more compactly organized
than that of the Jag1-SMcko ductus arteriosus (B), particularly in layers
distal to the vessel lumen (Lu). The ductus arteriosus medial wall of the
control littermate (A) is composed of vascular smooth muscle cells with
spindle-shaped nuclei (asterisks in high-magnification view C) forming
compact, well-organized layers throughout the width of the vessel wall.
These cells are surrounded by thin layers of extracellular matrix (arrows
in C). The Jag1-SMcko ductus arteriosus is composed of more loosely
organized cells (B), with irregularly shaped nuclei that are surrounded
by thicker layers of extracellular matrix (arrows in high-magnification
view D) than in the control (C). Asterisks mark smooth muscle nuclei.
Scale bars: 20m in A,B; 2m in C,D.
adjacent to the endothelium (Fig. 6B,K). This suggests that
expression of functional JAG1 protein at the surface of differentiated
vascular smooth muscle cells adjacent to the endothelium is required
for JAG1 expression in adjacent smooth muscle cells located more
distally in the ductus arteriosus and descending aorta medial wall.
To confirm that the mutant JAG1 protein is capable of being
expressed throughout the medial wall of the ductus arteriosus and
descending aorta, we analyzed JAG1 expression in SM22a-Cre/+;
Jag1flox/+ embryos. These embryos contain the SM22a-Cre and
Jag1flox alleles, but also have the wild-type Jag1 allele. SM22aCre/+; Jag1flox/+ embryos and mice therefore express both the
wild-type JAG1 protein and the mutant JAG1 protein that exhibits
altered cellular localization. Since JAG1-mediated Notch signaling
is active in SM22a-Cre/+; Jag1flox/+ embryos, which exhibit no
mutant phenotype, we should observe the superimposition of the
wild-type JAG1 and mutant JAG1 expression patterns. Analysis of
E13.5 SM22a-Cre/+; Jag1flox/+ embryos revealed that both the
wild-type and mutant JAG1 proteins were expressed throughout the
entire medial wall in SM22a-Cre/+; Jag1flox/+ embryos (Fig.
6F,I,L,O). Taken together, these results indicate that expression of
functional JAG1 protein at the cell surface of smooth muscle cells
adjacent to the endothelial cell layer is required for expression of
JAG1 protein in smooth muscle cell layers located more distally,
which is a hallmark of Notch signaling via lateral induction
(Eddison et al., 2000; Lewis, 1998; Saravanamuthu et al., 2009).
RESEARCH ARTICLE 4195
Fig. 5. Regional restriction of vascular smooth muscle cell
differentiation defects in Jag1-SMcko mouse embryos is not
caused by regional differences in Jag1 gene deletion. (A)In the
control littermate embryo, wild-type JAG1 protein (red) localizes
primarily at the cell surface. Nuclei are stained with DAPI (blue).
(B)However, in the Jag1-SMcko embryo, the nonfunctional JAG1
protein generated after deletion of the Jag1flox allele is localized to the
cytoplasm. (C-G)The differences in JAG1 protein localization are
apparent from immunostaining of outflow tract vessels of E13.5 control
littermate (C,E,G) and Jag1-SMcko (D,F,H) embryos. In the mutant
embryo, the same JAG1 staining pattern was observed in the ascending
aorta (aAo) (H), which does not exhibit the vascular smooth muscle
differentiation defect, as was observed in the embryonic ductus
arteriosus (DA) and descending aorta (dAo) (F), which does exhibit the
differentiation defect. PT, pulmonary artery trunk. Scale bars: 200m in
C,D; 100m in E-H.
Cleaved NOTCH1 protein is reduced in Jag1-SMcko
embryos at E13.5
We assessed expression of cleaved NOTCH1 by utilizing the antiVal1744 antibody, which recognizes an epitope generated by
gamma secretase cleavage of the NOTCH1 protein (Del Monte et
al., 2007; Schroeter et al., 1998). At E13.5, at the level of the
connection between the ductus arteriosus and descending branch of
the dorsal aorta, cleaved NOTCH1 protein was observed
throughout the developing medial wall in the control littermate
(Fig. 7A), whereas in the Jag1-SMcko mutant cleaved NOTCH1
was observed in only a few cells adjacent to the vascular
DEVELOPMENT
Jag1 in vascular development
4196 RESEARCH ARTICLE
Development 137 (24)
Fig. 7. Cleaved NOTCH1 protein expression is reduced in Jag1SMcko mouse embryos at E13.5. (A-F)Immunofluorescent staining
with anti-cleaved NOTCH1 antibody (Val1744 epitope; red) of a control
littermate (A,C,E) and Jag1-SMcko mutant (B,D,F) at E13.5 (A,B) and
E17.5 (C-F). At the level of the connection between the ductus
arteriosus (left) and descending branch of the dorsal aorta (right) (A-D),
cleaved NOTCH1 protein was observed throughout the developing
medial wall in the control littermate at E13.5 (A), whereas in the Jag1SMcko mutant (B) expression was only observed in a few cells adjacent
to the vascular endothelium. By E17.5, cleaved NOTCH1 protein was
downregulated in the medial wall of both control and mutant embryos
(C,D), whereas nuclear cleaved NOTCH1 protein was still observed at
this stage in hair follicles in the skin (E,F, arrowheads). Scale bars:
100m.
endothelium (Fig. 7B). By E17.5, levels of cleaved NOTCH1 were
reduced in the medial wall of both control and mutant embryos
(Fig. 7C,D). However, cleaved NOTCH1 was still observed in both
controls and Jag1-SMcko mutants at E17.5 in other tissues, such as
in the hair follicles in the skin (Fig. 7E,F). Analysis of NOTCH3
Postnatal indomethacin injection rescues ductus
arteriosus closure in a subset of Jag1-SMcko
neonates
Prostaglandins are key regulators of ductus arteriosus patency. Cyclooxygenases 1 and 2 (COX1 and 2; PTGS1 and 2; formally known as
prostaglandin H synthases 1 and 2) are rate-limiting enzymes
involved in the conversion of arachidonic acid to prostaglandins.
Non-steroidal anti-inflammatory drugs such as indomethacin and
ibuprofen inhibit the formation of prostanoids by the COX enzymes
(Mitchell and Warner, 2006). In premature infants exhibiting PDA,
COX inhibitors are used clinically to induce ductus arteriosus closure
by reducing prostaglandin levels, thereby inducing constriction of the
ductus arteriosus and closure of its lumen.
We assessed whether indomethacin administration to naturally
born neonatal mice could rescue the PDA of Jag1-SMcko neonates.
Indomethacin administered by subcutaneous injection within 12
hours of birth rescued ductus arteriosus closure in ~50% of the
Jag1-SMcko mutants (Table 3; see Fig. S6 in the supplementary
DEVELOPMENT
Fig. 6. JAG1 protein is highly expressed in the ductus arteriosus
and descending aorta and is required for its own expression.
Transverse sections of E13.5 mouse embryos through the level at which
the ductus arteriosus (DA) connects to the descending aorta (dAo).
Sections are immunostained with JAG1 antibody (red); A-L are also
counterstained with DAPI (blue) to highlight nuclei. (A-C)Lowmagnification views showing the JAG1 expression pattern in the ductus
arteriosus and descending aorta, ascending aorta (aAo) and pulmonary
trunk (PT). (D-L)High-magnification views of the medial walls of the
ascending aorta (D-F), pulmonary trunk (G-I) and descending aorta (J-L).
(M-O)JAG1 immunofluorescent staining reveals the superimposition of
the wild-type JAG1 and mutant JAG1 expression patterns throughout
the entire medial wall in the descending aorta of SM22a-Cre/+;
Jag1flox/+ embryos (O). Scale bars: 200m in A-C; 40m in D-L; 25m
in M-O.
expression revealed that in both controls and Jag1-SMcko mutants,
expression was high throughout the medial wall of the ductus
arteriosus and descending dorsal aorta at both E13.5 and E17.5.
(see Fig. S5 in the supplementary material).
Jag1 in vascular development
RESEARCH ARTICLE 4197
Table 3. Indomethacin injection rescues ductus arteriosus
closure in a subset of Jag1-SMcko mutant neonates
Phenotype
Jag1-SMcko
All other genotypes
Closed DA
Patent DA
4/7 (57%)
3/7 (43%)
25/25 (100%)
0/25 (0%)
Indomethacin (6 mg/kg body weight) was injected subcutaneously into pups within
12 hours of birth. After 6 hours, pups were euthanized and the ductus arteriosus
(DA) scored for patency or closure among total littermates (from four litters) of Jag1SMcko versus all other genotypes.
DISCUSSION
One of the primary physiological signals regulating patency of the
ductus arteriosus is the level of circulating prostaglandins (Clyman,
2006; Forsey et al., 2009; Schneider and Moore, 2006). The most
important of these is prostaglandin E2 (PGE2), which signals through
the G protein-coupled receptor EP4 (also known as PTGER4).
Targeted deletion of several genes encoding components of the
prostaglandin signaling pathway, including the receptor EP4
(Nguyen et al., 1997; Segi et al., 1998), 15-hydroxy prostaglandin
dehydrogenase (HPGD) (Coggins et al., 2002), the prostaglandin
transporter PGT (also known as SLCO2A1) (Chang et al., 2010) and
COX1 and 2 (Loftin et al., 2001), lead to PDA in neonatal mice.
However, several recent studies have demonstrated that, in both mice
and humans, defects in smooth muscle cell differentiation or function
in the ductus arteriosus wall can cause PDA. Smooth muscle cells
differ from most other differentiated cell lineages in adult mammals
in that they are not irreversibly, terminally differentiated. Smooth
muscle cells, unlike skeletal muscle cells and cardiomyocytes, retain
the ability to reversibly alter their phenotype in response to various
environmental, physiological and genetic cues (McDonald and
Owens, 2007; Owens et al., 2004). This property has been termed
phenotypic switching or smooth muscle cell plasticity. Contractile
smooth muscle cells express high levels of contractile proteins
involved in establishing and maintaining myofilament structure and
function, including SM22a, SMA and SMMHC. By contrast,
synthetic smooth muscle cells express lower levels of contractile
muscle proteins and have higher rates of proliferation, migration and
production of extracellular matrix components.
In humans, mutations in both the smooth muscle myosin heavy
chain (MYH11) and the smooth muscle a-actin (ACTA2) genes are
found in inherited forms of thoracic aortic aneurysm and dissection
with PDA (Guo et al., 2007; Zhu et al., 2006). In mice, neural crest
cell-specific deletion of the myocardin gene (Myocd) results in death
of the mutant neonates from PDA (Huang et al., 2008). The Myocd
conditional mutant mice exhibit reduced expression of smooth
muscle-specific contractile proteins and display ultrastructural
features indicating that vascular smooth muscle in the ductus
arteriosus medial wall has acquired a synthetic, rather than a
contractile, phenotype (Huang et al., 2008). Our analyses of Jag1SMcko embryos and mice indicate that most smooth muscle cells in
the medial wall of the ductus arteriosus and descending aorta fail to
express contractile smooth muscle cell proteins. In the Jag1-SMcko
mutants, the differentiation of contractile vascular smooth muscle
cells is confined to the region adjacent to the endothelial cell layer.
Our studies of both Jag1-SMcko mutants and embryos with
endothelial cell-specific Jag1 deletion indicate that Jag1-mediated
Notch signaling induces Jag1 expression in the signal-receiving
Fig. 8. Model for JAG1-Notch signaling in the ductus arteriosus
and descending aorta. In the ductus arteriosus and descending aorta
of wild-type mice, endothelial cells expressing JAG1 protein undergo
heterotypic interactions with adjacent vascular mural/smooth muscle
cells expressing Notch receptors (most likely through NOTCH1,
although a role for NOTCH3 cannot be excluded). Notch signal
reception via lateral induction induces JAG1 expression in the receiving
cells, leading to JAG1-mediated Notch signal transmission through
homotypic interactions with the adjacent layer of smooth muscle cells.
We further propose that Notch signal reception by vascular smooth
muscle cells is required for their differentiation into contractile, rather
than synthetic, smooth muscle cells. In embryos with endothelial cellspecific Jag1 deletion, the mutant endothelial cells are unable to signal
to adjacent smooth muscle cells, which consequently differentiate into
synthetic smooth muscle cells. In embryos with smooth muscle cellspecific Jag1 deletion, JAG1-expressing endothelial cells signal
heterotypically to the adjacent layer of mutant vascular smooth muscle
cells. These cells differentiate as contractile smooth muscle and
upregulate expression of the mutant JAG1 protein. However, these
mutant smooth muscle cells are unable to propagate the JAG1 signal
through homotypic cellular interactions to more distal layers of smooth
muscle, which therefore differentiate as synthetic smooth muscle cells.
cells, which is a hallmark of Notch signaling via lateral induction
(Eddison et al., 2000; Lewis, 1998; Saravanamuthu et al., 2009).
Several other studies have also demonstrated that expression of
Jag1 is induced by Notch signal reception (Ascano et al., 2003;
Daudet et al., 2007; Eddison et al., 2000; Luo et al., 1997; Ross and
Kadesch, 2004; Saravanamuthu et al., 2009), although some of
these studies indicate that Jag1 might not be a direct Notch target
gene (Ross and Kadesch, 2004). Significantly, a recent study
demonstrated that both the JAG1 and NOTCH3 proteins were
induced in vascular smooth muscle cells upon co-culture with
endothelial cells (Liu et al., 2009).
Requirements for the NOTCH1 and NOTCH3 receptors have
been studied previously in an in vivo vascular injury model (Li et
al., 2009). Subsequent to vascular injury, smooth muscle cells in
the vascular wall in the injured area proliferate and form a
thickened layer of smooth muscle cells termed the neointima.
Notch1+/– mice and mice with a heterozygous deletion of Notch1
in smooth muscle cells exhibit a 70% decrease in neointimal
formation after carotid artery ligation. However, neointimal
formation is unaffected after carotid artery ligation in Notch3–/–
mice (Li et al., 2009). These data indicate that the NOTCH1
receptor plays a dominant role in vascular smooth muscle cells
during the response to vascular injury. Whether NOTCH1 plays a
similar dominant role during embryonic vascular smooth muscle
development is not known.
Our analyses, along with those of others (Benedito et al., 2009;
High et al., 2008), suggest a model for JAG1-mediated Notch
signaling during development of the vascular wall of the ductus
arteriosus and descending aorta (Fig. 8). In the ductus arteriosus
DEVELOPMENT
material). These data suggest that the ductus arteriosus of some
Jag1-SMcko mutants retains sufficient smooth muscle to constrict
in response to the drop in prostaglandin levels caused by postnatal
indomethacin administration.
and descending aorta of wild-type mice, endothelial cells
expressing JAG1 protein undergo heterotypic interactions with
adjacent vascular mural/smooth muscle cells expressing Notch
receptors (most likely through the NOTCH1 receptor, although our
data cannot exclude a role for the NOTCH3 receptor). Notch signal
reception via lateral induction induces JAG1 expression in the
receiving cells, leading to JAG1-mediated Notch signal
transmission through homotypic interactions with the adjacent
layer of smooth muscle cells. We further propose that Notch signal
reception by vascular smooth muscle cells is required for their
differentiation into contractile, rather than synthetic, smooth muscle
cells. In embryos with endothelial cell-specific Jag1 deletion, the
mutant endothelial cells are unable to signal to adjacent smooth
muscle cells, which consequently differentiate into synthetic
smooth muscle cells. In embryos with smooth muscle cell-specific
Jag1 deletion, JAG1-expressing endothelial cells signal
heterotypically to the adjacent layer of mutant vascular smooth
muscle cells. These cells differentiate as contractile smooth muscle
and upregulate expression of the mutant JAG1 protein. However,
the Jag1-SMcko smooth muscle cells are unable to propagate the
JAG1 signal through homotypic cellular interactions to more distal
layers of smooth muscle, which therefore differentiate as synthetic
smooth muscle cells.
The mechanism that terminates the propagation of the JAG1mediated signal in wild-type embryos is not understood. Our
model proposes that the Jag1 gene is induced in vascular smooth
muscle cell progenitors adjacent to the innermost layer of cells
expressing the JAG1 ligand on their surface (Fig. 8). There is not
an obvious signal to terminate propagation of this JAG1mediated signal. Recent studies of NOTCH1-DLL1 signaling in
mammalian cells have demonstrated that cis-interactions
resulting in mutual inactivation of NOTCH1 and DLL1 in the
same cell can generate a molecular switch between mutually
exclusive signal-sending and signal-receiving states (Sprinzak et
al., 2010). Whether such a mechanism contributes to termination
of the JAG1-mediated signal during the development of vascular
smooth muscle cells in the ductus arteriosus and descending
aorta remains to be determined.
It is also unclear why the vascular smooth muscle cell
differentiation defect in Jag1-SMcko mice is restricted to the
ductus arteriosus and descending aorta. Our data indicate that
regional restriction of the vascular smooth muscle cell
differentiation defect is not caused by regional differences in
Jag1 gene deletion. Jag1 deletion in the ascending aorta of the
Jag1-SMcko embryos, which does not exhibit the differentiation
defect, was equivalent to that in the embryonic ductus arteriosus
and descending aorta, which do exhibit the defect (Fig. 5). The
ductus arteriosus is a very specialized blood vessel, with a
vascular wall composed of highly differentiated and contractile
smooth muscle (Slomp et al., 1997). Smooth muscle of the
ductus arteriosus activates a unique transcriptional program
during its development (Ivey et al., 2008). This ductus
arteriosus-specific transcriptional program might contribute to
the regional restriction of the vascular smooth muscle
differentiation defects exhibited by Jag1-SMcko mice.
The models for PDA exhibited by Jag1-SMcko mice and neural
crest cell-specific Myocd gene deletion mice (Huang et al., 2008)
represent a new paradigm for the etiology of PDA in mammals. In
these mice, the differentiation of ductal smooth muscle cells along
the synthetic, rather than the contractile, pathway leads to PDA.
Further work will be required to determine whether this mechanism
for the etiology of PDA occurs in humans.
Development 137 (24)
Acknowledgements
We thank Greg Sousa and Chris Norton for helpful discussions. This work was
supported by grants from the NIH (HD034883) and the March of Dimes
Foundation (1-FY10-367) to T.G., and by a Center Grant from the National
Cancer Institute (CA034196) to the Jackson Laboratory. Deposited in PMC for
release after 12 months.
Competing interests statement
The authors declare no competing financial interests.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.052043/-/DC1
References
Ascano, J. M., Beverly, L. J. and Capobianco, A. J. (2003). The C-terminal PDZligand of JAGGED1 is essential for cellular transformation. J. Biol. Chem. 278,
8771-8779.
Benedito, R., Roca, C., Sorensen, I., Adams, S., Gossler, A., Fruttiger, M. and
Adams, R. H. (2009). The Notch ligands Dll4 and Jagged1 have opposing
effects on angiogenesis. Cell 137, 1124-1135.
Chang, H. Y., Locker, J., Lu, R. and Schuster, V. L. (2010). Failure of postnatal
ductus arteriosus closure in prostaglandin transporter-deficient mice. Circulation
121, 529-536.
Clyman, R. I. (2006). Mechanisms regulating the ductus arteriosus. Biol. Neonate
89, 330-335.
Coggins, K. G., Latour, A., Nguyen, M. S., Audoly, L., Coffman, T. M. and
Koller, B. H. (2002). Metabolism of PGE2 by prostaglandin dehydrogenase is
essential for remodeling the ductus arteriosus. Nat. Med. 8, 91-92.
Daudet, N., Ariza-McNaughton, L. and Lewis, J. (2007). Notch signalling is
needed to maintain, but not to initiate, the formation of prosensory patches in
the chick inner ear. Development 134, 2369-2378.
Del Monte, G., Grego-Bessa, J., Gonzalez-Rajal, A., Bolos, V. and De La
Pompa, J. L. (2007). Monitoring Notch1 activity in development: evidence for a
feedback regulatory loop. Dev. Dyn. 236, 2594-2614.
Eddison, M., Le Roux, I. and Lewis, J. (2000). Notch signaling in the
development of the inner ear: lessons from Drosophila. Proc. Natl. Acad. Sci.
USA 97, 11692-11699.
Forsey, J. T., Elmasry, O. A. and Martin, R. P. (2009). Patent arterial duct.
Orphanet. J. Rare Dis. 4, 17.
Gridley, T. (2010). Notch signaling in the vasculature. Curr. Top. Dev. Biol. 92, 277309.
Guo, D. C., Pannu, H., Tran-Fadulu, V., Papke, C. L., Yu, R. K., Avidan, N.,
Bourgeois, S., Estrera, A. L., Safi, H. J., Sparks, E. et al. (2007). Mutations in
smooth muscle alpha-actin (ACTA2) lead to thoracic aortic aneurysms and
dissections. Nat. Genet. 39, 1488-1493.
High, F. A., Lu, M. M., Pear, W. S., Loomes, K. M., Kaestner, K. H. and Epstein,
J. A. (2008). Endothelial expression of the Notch ligand Jagged1 is required for
vascular smooth muscle development. Proc. Natl. Acad. Sci. USA 105, 1955-1959.
Hofmann, J. J. and Iruela-Arispe, M. L. (2007). Notch signaling in blood vessels:
who is talking to whom about what? Circ. Res. 100, 1556-1568.
Holtwick, R., Gotthardt, M., Skryabin, B., Steinmetz, M., Potthast, R.,
Zetsche, B., Hammer, R. E., Herz, J. and Kuhn, M. (2002). Smooth muscleselective deletion of guanylyl cyclase-A prevents the acute but not chronic
effects of ANP on blood pressure. Proc. Natl. Acad. Sci. USA 99, 7142-7147.
Huang, J., Cheng, L., Li, J., Chen, M., Zhou, D., Lu, M. M., Proweller, A.,
Epstein, J. A. and Parmacek, M. S. (2008). Myocardin regulates expression of
contractile genes in smooth muscle cells and is required for closure of the ductus
arteriosus in mice. J. Clin. Invest. 118, 515-525.
Ivey, K. N., Sutcliffe, D., Richardson, J., Clyman, R. I., Garcia, J. A. and
Srivastava, D. (2008). Transcriptional regulation during development of the
ductus arteriosus. Circ. Res. 103, 388-395.
Kiernan, A. E., Xu, J. and Gridley, T. (2006). The Notch ligand JAG1 is required
for sensory progenitor development in the mammalian inner ear. PLoS Genet. 2,
e4.
Koni, P. A., Joshi, S. K., Temann, U. A., Olson, D., Burkly, L. and Flavell, R. A.
(2001). Conditional vascular cell adhesion molecule 1 deletion in mice: impaired
lymphocyte migration to bone marrow. J. Exp. Med. 193, 741-754.
Lewis, J. (1998). Notch signalling and the control of cell fate choices in
vertebrates. Semin. Cell Dev. Biol. 9, 583-589.
Li, Y., Takeshita, K., Liu, P. Y., Satoh, M., Oyama, N., Mukai, Y., Chin, M. T.,
Krebs, L., Kotlikoff, M. I., Radtke, F. et al. (2009). Smooth muscle Notch1
mediates neointimal formation after vascular injury. Circulation 119, 2686-2692.
Liu, H., Kennard, S. and Lilly, B. (2009). NOTCH3 expression is induced in mural
cells through an autoregulatory loop that requires endothelial-expressed
JAGGED1. Circ. Res. 104, 466-475.
Loftin, C. D., Trivedi, D. B., Tiano, H. F., Clark, J. A., Lee, C. A., Epstein, J. A.,
Morham, S. G., Breyer, M. D., Nguyen, M., Hawkins, B. M. et al. (2001).
Failure of ductus arteriosus closure and remodeling in neonatal mice deficient in
DEVELOPMENT
4198 RESEARCH ARTICLE
cyclooxygenase-1 and cyclooxygenase-2. Proc. Natl. Acad. Sci. USA 98, 10591064.
Loomes, K. M., Underkoffler, L. A., Morabito, J., Gottlieb, S., Piccoli, D. A.,
Spinner, N. B., Baldwin, H. S. and Oakey, R. J. (1999). The expression of
Jagged1 in the developing mammalian heart correlates with cardiovascular
disease in Alagille syndrome. Hum. Mol. Genet. 8, 2443-2449.
Luo, B., Aster, J. C., Hasserjian, R. P., Kuo, F. and Sklar, J. (1997). Isolation and
functional analysis of a cDNA for human Jagged2, a gene encoding a ligand for
the Notch1 receptor. Mol. Cell. Biol. 17, 6057-6067.
McDonald, O. G. and Owens, G. K. (2007). Programming smooth muscle
plasticity with chromatin dynamics. Circ. Res. 100, 1428-1441.
Mitchell, J. A. and Warner, T. D. (2006). COX isoforms in the cardiovascular
system: understanding the activities of non-steroidal anti-inflammatory drugs.
Nat. Rev. Drug Discov. 5, 75-86.
Nguyen, M., Camenisch, T., Snouwaert, J. N., Hicks, E., Coffman, T. M.,
Anderson, P. A., Malouf, N. N. and Koller, B. H. (1997). The prostaglandin
receptor EP4 triggers remodelling of the cardiovascular system at birth. Nature
390, 78-81.
Owens, G. K., Kumar, M. S. and Wamhoff, B. R. (2004). Molecular regulation
of vascular smooth muscle cell differentiation in development and disease.
Physiol. Rev. 84, 767-801.
Phng, L. K. and Gerhardt, H. (2009). Angiogenesis: a team effort coordinated by
Notch. Dev. Cell 16, 196-208.
Roca, C. and Adams, R. H. (2007). Regulation of vascular morphogenesis by
Notch signaling. Genes Dev. 21, 2511-2524.
Ross, D. A. and Kadesch, T. (2004). Consequences of Notch-mediated induction
of Jagged1. Exp. Cell Res. 296, 173-182.
Saravanamuthu, S. S., Gao, C. Y. and Zelenka, P. S. (2009). Notch signaling is
required for lateral induction of Jagged1 during FGF-induced lens fiber
differentiation. Dev. Biol. 332, 166-176.
Schneider, D. J. and Moore, J. W. (2006). Patent ductus arteriosus. Circulation
114, 1873-1882.
RESEARCH ARTICLE 4199
Schroeter, E. H., Kisslinger, J. A. and Kopan, R. (1998). Notch-1 signalling
requires ligand-induced proteolytic release of intracellular domain. Nature 393,
382-386.
Segi, E., Sugimoto, Y., Yamasaki, A., Aze, Y., Oida, H., Nishimura, T., Murata,
T., Matsuoka, T., Ushikubi, F., Hirose, M. et al. (1998). Patent ductus
arteriosus and neonatal death in prostaglandin receptor EP4-deficient mice.
Biochem. Biophys. Res. Commun. 246, 7-12.
Slomp, J., Gittenberger-de Groot, A. C., Glukhova, M. A., Conny van
Munsteren, J., Kockx, M. M., Schwartz, S. M. and Koteliansky, V. E. (1997).
Differentiation, dedifferentiation, and apoptosis of smooth muscle cells during
the development of the human ductus arteriosus. Arterioscler. Thromb. Vasc.
Biol. 17, 1003-1009.
Spandidos, A., Wang, X., Wang, H., Dragnev, S., Thurber, T. and Seed, B.
(2008). A comprehensive collection of experimentally validated primers for
polymerase chain reaction quantitation of murine transcript abundance. BMC
Genomics 9, 633.
Sprinzak, D., Lakhanpal, A., Lebon, L., Santat, L. A., Fontes, M. E.,
Anderson, G. A., Garcia-Ojalvo, J. and Elowitz, M. B. (2010). Cisinteractions between Notch and Delta generate mutually exclusive signalling
states. Nature 465, 86-90.
Villa, N., Walker, L., Lindsell, C. E., Gasson, J., Iruela-Arispe, M. L. and
Weinmaster, G. (2001). Vascular expression of Notch pathway receptors and
ligands is restricted to arterial vessels. Mech. Dev. 108, 161-164.
Xue, Y., Gao, X., Lindsell, C. E., Norton, C. R., Chang, B., Hicks, C., GendronMaguire, M., Rand, E. B., Weinmaster, G. and Gridley, T. (1999). Embryonic
lethality and vascular defects in mice lacking the Notch ligand Jagged1. Hum.
Mol. Genet. 8, 723-730.
Zhu, L., Vranckx, R., Khau Van Kien, P., Lalande, A., Boisset, N., Mathieu, F.,
Wegman, M., Glancy, L., Gasc, J. M., Brunotte, F. et al. (2006). Mutations in
myosin heavy chain 11 cause a syndrome associating thoracic aortic
aneurysm/aortic dissection and patent ductus arteriosus. Nat. Genet. 38, 343349.
DEVELOPMENT
Jag1 in vascular development