Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
DNA Mav Mark Mav Mark Mav Mark Organic Compounds Any compound that contains BOTH Carbon (C) and (H) – Methane CH4 – Glucose C6H12O6 Organic Compounds for Metabolism Carbohydrates Lipids Proteins Nucleic Acids Carbohydrates and Lipids Carbohydrates – Provide Energy – Contain C, H, O in a 1:2:1 ratio C6H12O6 C5H10O5 Lipids – Store Energy – Contain C, H, O; but have less Oxygen than Carbohydrates Proteins and Nucleic Acids Proteins – Important for body-building material (muscles) – Made from Amino Acids – Contain C, H, O, and N Nucleic Acids – Helps to store cellular information – Includes DNA and RNA – Contain C, H, O, N, and P DNA The Blue Print of Life DeoxyriboNucleic Acid Contains the genetic information used for our growth and development Credit for structure is given to Watson and Crick. What DNA is Composed Of Double stranded DNA is made up of Nucleotides Each nucleotide has: – A 5-carbon sugar: Deoxyribose – A phosphate – A nitrogen base The Nitrogen Bases The four Bases of DNA are: – Adenine (A) – Thymine (T) – Cytosine (C) – Guanine (G) The base pairing are: – Adenine with Thymine – Cytosine with Guanine Purines and Pyrimidines Purines: 1 ring – Adenine (A) – Guanine (G) Pyrimidines: 2 rings – Thymine (T) – Cytosine (C) Purines can only pair with Pyrimidines Structure of DNA Structure – Two strands twisted together (helix) – Sides of Ladder Alternating Phosphate and Sugar – Rungs of Ladder Pair of nucleotide bases Replication Replication is the process of duplicating DNA Two identical copies of DNA result The process occurs: – in the nucleus – During the s-phase of the cell cycle Replication Process DNA Helicase unzips the double helix Free-floating nucleotides from within the nucleus “repair” each side Two new and identical structures result – Complimentary (original strand) – Template (newly formed strand) Replication Practice Where does replication take place? During what phase of the cell cycle? Practice: – Template: ATTGCAGGCCTTAGTCAC – Replicate: More Practice AGTTCAGCGGTATTAGCTAGCAACCGT RNA RiboNucleic Acid RNA is made of nucleotides Single stranded Each nucleotide has – 5-carbon sugar; Ribose – Phosphate group – Nitrogen Base The RNA Bases The four bases of RNA are: – Adenine – Uracil – Cytosine – Guanine The base pairs are – Adenine and Uracil – Cytosine and Guanine Comparing DNA and RNA DNA RNA 2 strands 1 strand Deoxyribose sugar Ribose Sugar Adenine - Thymine Cytosine - Guanine Adenine - Uracil Cytosine - Guanine Made by Replication Made by Transcription Types of RNA Three Types: – mRNA: (messenger) Takes code from DNA in nucleus to ribosome – tRNA: (transfer) Brings amino acids to the ribosome to build proteins – rRNA: (ribosomal) Makes up ribosomes Transcription RNA polymerase unzips the DNA structure Free-floating RNA nucleotides repair ONE SIDE of the structure The new mRNA strand leaves the nucleus to go to a ribosome in the cytoplasm Transcription Practice DNA strand: ATACTGTCAGTATGGCCAT RNA strand: Practice problem: TATTACGACCCGTACTAGAATG Reverse Transcription DNA strand: RNA strand: UAGGCUACUGAUCCAAUG Proteins There are 20 different amino acids that join together to make proteins The amino acids are joined by peptide bonds AA + AA + AA + AA = Protein Codons Codons are groups of three nitrogen bases They signal for specific amino acids – CUC (Leucine) – ACC (Threonine) Some codons start or stop protein synthesis – – – – AUG (Start) UAA (Stop) UAG (Stop) UGA (Stop) Facts About Translation It is also called Protein Synthesis It occurs – At a ribosome – In the cytoplasm Translation (Protein Synthesis) mRNA breaks into codons and signals specific amino acids tRNA brings the amino acid to the ribosome Each amino acid bonds to another to form a protein Transcription and Translation Translation Practice mRNA: Amino acid: Practice mRNA: tRNA: Amino acid: AUG AGC UGG GGG UAU UAG Met Ser Leu Gly Tyr Stop AUG UGU AGC CCU AUU UAA Central Dogma of Protein Synthesis Mutation Mutations any changes to either DNA or RNA. Causes: copying errors in the DNA during mitosis and by exposure to ultraviolet radiation, xrays, radioactivity, or viruses. Results: genetic disorders, death, or have no affect. Most mutations are repaired by enzymes. Mutations Chromosome – – – – – Insertion Deletion Translocation Substitution Nondisjunction Gene – Point – Frameshift Insertion Insertion: the addition of one or more nucleotide base pairs into a genetic sequence – Ex: Normal: AAACCCGGG Mutated: AAACACCGGG Deletion Deletion: part of a chromosome or a sequence of DNA is missing. Any number of nucleotides can be deleted, from a single base to an entire piece of chromosome. Example Normal: AAACCCGGG Mutated: AAACCGGG Substitution Substitution: one or more nucleotides are substituted by the same number of different nucleotides. In most cases, only one nucleotide is changed. Example: Normal: AAACCCGGG Mutated: AAACACGGG Gene Mutations Frame-shift mutation: causes a change all the way down a DNA sequence, making each codon a different sequence. (MORE SERIOUS!) EX. CAG TTC CTG GAA -> (frameshift)-> CAG TTA CCT GGA – Insertion – Deletion Point-shift mutation: a single letter is the only thing changed in the DNA sequence EX. GTA CTG CAA-----> (point mutation) -----> GTA GTG CAA – Substitution Viruses Virus Virus is a tiny non-living particle that enters and then reproduces inside a living host cell. Characteristics of Viruses Have either DNA or RNA. May be single stranded or double stranded. Nonliving because cannot: – – – – – – make food take in food use energy respond to stimuli make waste multiply on their own. A Bacteriophage is a virus that infects bacteria. Virus Shape and Size Viruses are smaller than bacteria (measured in nanometers) Structure: (2 main Parts) – Protein Coat – Inner Genetic Material (DNA or RNA) Virus Shapes and Sizes Lytic Cycle: Lytic Cycle: Virus enters cell and uses cell to reproduce. (Ex. Flu, Rhinovirus) – Viral DNA destroys Cell DNA, takes over cell functions and destroys the cell. – The Virus replicates. – There are symptoms of viral infection. – Active viral infection takes place. Lysogenic Cycle Lysogenic Cycle: Virus enters cell and becomes part of cells DNA. May enter lytic cycle if exposed to stress. (Herpes, cold sores.) – Viral DNA merges with Cell DNA and does not destroy the cell. – There are no symptoms of viral infection. – Passive viral replication takes place. Lysogenic/Lytic Cycle Lytic VS Lysogenic Cycle Ways to Protect Vaccinations: weakened or dead viruses injected into the body to stimulate immune response. (Antibodies form against virus) Proper hygiene/hand washing Minimize risk by avoiding risky behavior. (ex. IV drug use, unprotected sex) Cancer Some viruses have been linked to the formation of tumors. – HPV linked to cervical cancer – Hepatitis B and C linked to liver cancer – Epstein-Barr linked to lymphoma