Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
CHAPTER 12 DNA Technology PowerPoint® Lectures for Campbell Essential Biology, Fourth Edition – Eric Simon, Jane Reece, and Jean Dickey Campbell Essential Biology with Physiology, Third Edition – Eric Simon, Jane Reece, and Jean Dickey Lectures by Chris C. Romero, updated by Edward J. Zalisko © 2010 Pearson Education, Inc. Stem Cells © 2010 Pearson Education, Inc. Adult stem cells in bone marrow Blood cells Nerve cells Cultured embryonic stem cells Heart muscle cells Different culture conditions © 2010 Pearson Education, Inc. Different types of differentiated cells Figure 11.15 Umbilical Cord Blood Banking Umbilical Can cord blood be collected at birth Contains partially differentiated stem cells Limited use © 2010 Pearson Education, Inc. Figure 12.1 Recombinant DNA Techniques • • Bacteria are the workhorses of modern biotechnology. In the lab, biologists use bacterial plasmids (small, circular DNA molecules) that are separate from the much larger bacterial chromosome. Can easily pick up foreign DNA Are taken up by bacterial cells; called transformation Act as vectors (DNA carriers that move genes from one cell to another) Recombinant DNA help biologists produce large quantities of a desired protein. © 2010 Pearson Education, Inc. Bacterial chromosome Remnant of bacterium Colorized TEM Plasmids Figure 12.7 Cut both DNAs with same enzyme. Gene of Other interest genes Gene of interest Bacterial cell DNA fragments from cell Isolate DNA. Mix the DNAs and join them together. Cell containing the gene of interest Isolate plasmids. Recombinant DNA plasmids Bacteria take up recombinant plasmids. Plasmid DNA Bacterial clone Recombinant bacteria Clone the bacteria. Find the clone with the gene of interest. Some uses of genes Gene for pest resistance Some uses of proteins Protein for dissolving clots Gene for toxic-cleanup bacteria Genes may be inserted into other organisms. The gene and protein of interest are isolated from the bacteria. Harvested proteins may be used directly. Protein for “stone-washing” jeans Figure 12.8-8 A Closer Look: Cutting and Pasting DNA with Restriction Enzymes Recombinant DNA is produced by combining two ingredients: A bacterial plasmid The gene of interest To combine these ingredients, a piece of DNA must be spliced into a plasmid. This splicing process can be accomplished by: Using restriction enzymes, which cut DNA at specific nucleotide sequences © 2010 Pearson Education, Inc. Restriction enzymes Bacterial enzymes that recognize and cut DNA at specific sequences What is there use naturally in bacteria? Are very specific Usually recognize sequences 4-8 nucleotides long Sequences recognized are palindromes Example: EcoR1 recognizes GAATTC and cuts always between the G and A © 2010 Pearson Education, Inc. • Producing pieces of DNA called restriction fragments with “sticky ends” important for joining DNA from different sources – DNA ligase connects the DNA pieces into continuous strands by forming bonds between adjacent nucleotides. © 2010 Pearson Education, Inc. Recognition sequence for a restriction enzyme DNA A restriction enzyme cuts the DNA into fragments. Restriction enzyme Figure 12.9-1 Recognition sequence for a restriction enzyme DNA A restriction enzyme cuts the DNA into fragments. Restriction enzyme A DNA fragment is added from another source. Figure 12.9-2 Recognition sequence for a restriction enzyme DNA A restriction enzyme cuts the DNA into fragments. Restriction enzyme A DNA fragment is added from another source. Fragments stick together by base pairing. Figure 12.9-3 Recognition sequence for a restriction enzyme DNA A restriction enzyme cuts the DNA into fragments. Restriction enzyme A DNA fragment is added from another source. Fragments stick together by base pairing. DNA ligase joins the fragments into strands. DNA ligase Recombinant DNA molecule Figure 12.9-4 Genetic engineering vocab Recombinant DNA- nucleotide sequences from two different sources to form a single DNA molecule. genetic engineering, the direct manipulation of DNA for practical purposes. Biotechnology – use of organisms or their components to make useful products Transgenic organism – contains a gene from another organism, typically a different species Genetically modified organisms (GMOs)- organisms that have acquired one or more genes by artificial means. © 2010 Pearson Education, Inc. Cut both DNAs with same enzyme. Gene of Other interest genes Gene of interest Bacterial cell DNA fragments from cell Isolate DNA. Mix the DNAs and join them together. Cell containing the gene of interest Isolate plasmids. Recombinant DNA plasmids Bacteria take up recombinant plasmids. Plasmid DNA Bacterial clone Recombinant bacteria Clone the bacteria. Find the clone with the gene of interest. Some uses of genes Gene for pest resistance Some uses of proteins Protein for dissolving clots Gene for toxic-cleanup bacteria Genes may be inserted into other organisms. The gene and protein of interest are isolated from the bacteria. Harvested proteins may be used directly. Protein for “stone-washing” jeans Figure 12.8-8 Warm up December 17 How do these cats show examples of genetic engineering, transgenic organisms and recombinant DNA? © 2010 Pearson Education, Inc. Gene for human growth hormone DNA recombination Human Cell Sticky ends DNA insertion Bacterial Cell Bacterial chromosome Bacterial cell for containing gene for human growth hormone Plasmid © 2010 Pearson Education, Inc. Making Humulin - 1st engineered product © 2010 Pearson Education, Inc. Genetically Modified (GM) Foods © 2010 Pearson Education, Inc. “Golden © 2010 Pearson Education, Inc. rice” DNA PROFILING AND FORENSIC SCIENCE DNA profiling (fingerprinting): Used to determine if two samples of genetic material are from same person Scientific crime scene analysis To produce a DNA profile Scientists compare genetic markers Sequences in the genome that vary from person to person. © 2010 Pearson Education, Inc. Investigating Murder, Paternity, and Ancient DNA DNA profiling can be used to: Test the guilt of suspected criminals Identify tissue samples of victims Resolve paternity cases Identify contraband animal products Trace the evolutionary history of organisms © 2010 Pearson Education, Inc. Crime scene Suspect 1 Suspect 2 DNA isolated DNA amplified DNA compared Figure 12.13-3 DNA Profiling Techniques The Polymerase Chain Reaction (PCR) The polymerase chain reaction (PCR): Is a technique to copy quickly and precisely any segment of DNA Can generate enough DNA, from even minute amounts of blood or other tissue, to allow DNA profiling How do you test if two samples of DNA come from the same person? © 2010 Pearson Education, Inc. Gel Electrophoresis Compares the lengths of varied DNA fragments Uses gel electrophoresis, a method for sorting macromolecules—usually proteins or nucleic acids—primarily by their Electrical charge Size © 2010 Pearson Education, Inc. Mixture of DNA fragments of different sizes Band of longest (slowest) fragments Power source Gel Completed gel Band of shortest (fastest) fragments •Shorter fragments travel through the gel faster than longer fragments •Fragments travel to positive end because phosphates in DNA are negatively charged •2 ways to analyze DNA in gel electrophoresis Short Tandem Repeat (STR) Analysis Short Tandem Repeats (STR’s) Short repetitions (usually 4 nucleotides) Number of repeats can vary from person to person Used in DNA profiling/criminal investigations FBI uses 13 repetitive sites on our DNA © 2010 Pearson Education, Inc. STR site 1 AGAT STR site 2 GATA Crime scene DNA Different numbers of short tandem repeats Same number of short tandem repeats Suspect’s DNA AGAT GATA Figure 12.16 Amplified crime scene DNA Amplified suspect’s DNA Longer fragments Shorter fragments Figure 12.18 RFLP Analysis Before placed in the gel, DNA is mixed and cut by restriction enzymes Individuals have unique restriction sites so DNA fragment lengths may vary Used often to compare different gene alleles Basis of some genetic and paternity tests © 2010 Pearson Education, Inc. RFLP EcoRI GAATTC CTTAAG ATGCTTAAGGCGTACACTGAATTCTAGTACCTA TACGAATTCCGCATGTGACTTAAGATCATGGAT ATGCTTAAGGCGTACACTG TACGAATTCCGCATGTGACTTAA AATTCTAGTACCTA GATCATGGAT Region cut into 2 fragments by EcoRI ATGCTTAAGGCGTACACTGGATTTCTAGTACCTA TACGAATTCCGCATGTGACCTTAAGATCATGGT T ATGCTTAAGGCGTACACTGGATTTCTAGTACCTA TACGAATTCCGCATGTGACCTTAAGATCATGGT T Region not cut by EcoRI due to base substitution at restriction site. © 2010 Pearson Education, Inc. Restriction enzymes added Suspect’s DNA Crime scene DNA Fragment w Cut Fragment z Fragment x Cut Cut Fragment y Fragment y Crime scene DNA Longer fragments Suspect’s DNA z x Shorter fragments w y y Figure 12.19 Lane 2 is mom, lane 5 is son so…who’s the daddy? 3 or 4? © 2010 Pearson Education, Inc. For the test 1. Cloning 1. 2. 3. 2. Stem cells 1. 2. 3. 4. 3. What is it? Reproductive vs. therapeutic cloning How to do reproductive cloning (how did you clone mimi the mouse) What are they? Types of stem cells and their potential Where do we find different types of stem cells such as adult, embryonic What are IPS stem cells and why are they important? Recombinant DNA 1. 2. 3. What is it? How do we make a recombinant plasmid? What is it used for? © 2010 Pearson Education, Inc. For the test PCR/gel electrophoresis 4. 4. 5. 6. What are they used for? How is a gel electrophoresis run? How is a gel electrophoresis read? Human genome project/Gene therapy 5. 4. 5. What are they? For what do they hope to use these? © 2010 Pearson Education, Inc. Table 12.1 The Human Genome Project Begun in 1990, the Human Genome Project was a massive scientific endeavor: To determine the nucleotide sequence of all the DNA in the human genome and To identify the location and sequence of every gene © 2010 Pearson Education, Inc. HUMAN GENE THERAPY Human Is gene therapy: a recombinant DNA procedure Seeks to treat disease by altering the genes of the afflicted person Often replaces or supplements the mutant version of a gene with a properly functioning one © 2010 Pearson Education, Inc. Normal human gene isolated and cloned Healthy person Figure 12.24-1 Normal human gene isolated and cloned Harmless virus (vector) Normal human gene inserted into virus Virus containing normal human gene Healthy person Figure 12.24-2 Normal human gene isolated and cloned Harmless virus (vector) Normal human gene inserted into virus Virus containing normal human gene Bone marrow Healthy person Virus injected into patient with abnormal gene Bone of person with disease Figure 12.24-3 SCID – severe combined immune deficiency SCID is a fatal inherited disease caused by a single defective gene that prevents the development of the immune system. SCID patients quickly die unless treated with: A bone marrow transplant or Gene therapy © 2010 Pearson Education, Inc. SCID and gene therapy Since the year 2000, gene therapy has: Cured 22 children with inborn SCID but Unfortunately, caused four of the patients to develop leukemia, killing one of these children © 2010 Pearson Education, Inc.