Download Mapping the inhibitory determinants within the cytoplasmic tail of CD6

Mapping the inhibitory
determinants within
the cytoplasmic tail of
CD6
Ana Paula Teixeira da Silva
Mestrado em Biologia Celular e Molecular
Departamento de Biologia
2013
Mafalda Pinto, PhD, Instituto de Biologia Molecular e Celular (IBMC)
Alexandre Carmo, PhD, Instituto de Biologia Molecular e Celular (IBMC)
Todas
as
correções
determinadas
pelo júri, e só essas, foram
efetuadas.
O Presidente do Júri,
Porto,
______/______/_________
Faculdade de Ciências da Universidade do Porto
Mestrado em Biologia Celular e Molecular
Ana Paula Teixeira da Silva
Dissertação submetida à Faculdade de
Ciências UP como requisito parcial para
obtenção do grau de Mestre em Biologia
Celular e Molecular.
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
I. Agradecimentos
Em primeiro lugar, gostaria de agradecer ao Prof. José Pissarra e ao corpo docente do
Mestrado de Biologia Celular e Molecular da Faculdade de Ciências da Universidade
do Porto pelo apoio e conselhos dados ao longo do mestrado.
Ao Prof. Doutor Alexandre Carmo, agradeço a oportunidade de trabalhar em
Imunologia no grupo de Cell Activation and Gene Expression do Instituto de Biologia
Molecular e Celular, ao longo do meu mestrado. Obrigada também pelos
ensinamentos científicos que partilhou comigo ao longo do tempo e pela atitude crítica.
À Doutora Mafalda Pinto, pela dedicação constante e por toda a ajuda proporcionada
diariamente. Obrigada também pelos conhecimentos científicos que me transmitiu.
A todos os membros do grupo Cell Activation and Gene Expression e do grupo Gene
Regulation, pelo companheirismo e pelo apoio que me proporcionaram durante o meu
trabalho. Obrigada a todos os outros que no IBMC contribuíram de algum modo para o
meu trabalho.
A todos os meus amigos que de uma forma ou de outra, me apoiaram durante o
percurso da minha tese. À Ana Margarida, à Mafs e ao Fidos, um obrigada pela
amizade e pela motivação.
Finalmente, aos meus pais, um agradecimento muito sentido, pelo apoio e paciência
permanentes.
IV
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
II. Abstract
The adaptive immune response of a T cell is initiated upon recognition by the T cell
receptor of an antigenic peptide presented by the Major Histocompatibility Complex of
antigen presenting cells. Integrating this response there are other signals provided by
accessory and co-stimulatory molecules targeting at the immunological synapse (IS).
The engagement between APCs and T cells triggers several intracellular signaling
pathways, which induce early and late responses of the immune system, culminating
with the production/activation of transcription factors in the nucleus of T lymphocytes.
The CD6 glycoprotein is one of the molecules present at the IS upon T cell-APC
engagement. It binds its physiological ligand, CD166, present at the surface of APCs.
CD6 has been generally regarded as a co-stimulatory molecule over the years, but the
latest results identified its inhibitory potential upon T cell activation. CD6, in its full
length form (CD6FL), was reported to attenuate both early and late responses upon T
cell activation, while CD6Cy5, an isoform devoid of the cytoplasmic domain, featured
high levels of both calcium and IL-2. These results pointed to the cytoplasmic tail of
CD6 as responsible for the inhibitory role of the molecule. Following the latest lead on
CD6 involvement as a negative modulator in T cell activation, we aimed to map the
CD6 inhibitory determinants within its cytoplasmic tail. In the current project, several
isoforms of variable lengths of the cytoplasmic tail were created, having in mind the
existence of different tyrosines, which were reported to be phosphorylated during T cell
activation. We have performed several studies of early and late responses to
activation. Our results suggest that the middle part of the cytoplasmic tail of CD6 is
responsible for the inhibitory potential of the molecule, since deletion of this sequence
resulted in an increase of calcium fluxes and IL-2 production upon activation of cells
through the T cell receptor.
Key Words: CD6; inhibitory; cytoplasmic; tail; activation.
V
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
III. Resumo
A resposta imunológica adquirida de um linfócito T inicia-se após reconhecimento, pelo
complexo do receptor dos linfócitos T/ CD3, de um antigénio sob a forma de péptido,
apresentado pelo Complexo Maior de Histocompatibilidade. Integrando esta resposta,
há sinais adicionais fornecidos por moléculas acessórias e co-estimulatórias que se
translocam para a sinapse imunológica (IS). A ligação entre células apresentadoras de
antigénio (APC) e os linfócitos T desencadeia diversas vias de sinalização, que
incluem respostas iniciais e tardias do sistema imunológico, e termina com a produção
de factores de transcrição no núcleo dos linfócitos T. A glicoproteína CD6 é uma das
moléculas presentes na IS, após ligação das APC com os linfócitos T. Liga-se ao seu
ligando fisiológico, CD166, presente na superfície das APCs. Ao longo dos anos, a
molécula CD6 tem sido abordada como uma molécula co-estimulatória, mas os
resultados mais recentes identificaram o seu potencial inibitório, após activação dos
linfócitos T. Foi observado que a CD6, em todo o seu tamanho integral (CD6FL),
atenuava quer as respostas iniciais, quer as tardias, após activação dos linfócitos T,
enquanto que a CD6Cy5, uma isoforma sem o domínio citoplasmático, apresentava
níveis elevados de cálcio e interleucina-2. Estes resultados apontam para que a cauda
citoplasmática da CD6 seja responsável pelo seu papel inibitório. Seguindo a última
pista relativamente ao envolvimento da CD6 como um regulador negativo na activação
dos linfócitos T, tencionamos mapear as sequências que determinam o papel inibitório
da cauda citoplasmática da CD6. Neste projecto, foram criadas várias isoformas com
comprimentos diferentes relativamente à cauda citoplasmática da CD6, tendo em
conta a existência de diferentes tirosinas fosforiladas por cinases durante a activação
dos linfócitos T. Realizamos vários estudos relativos à resposta inicial e tardia, perante
activação. Os nossos resultados sugerem que a parte média da cauda citoplasmática
é responsável pelo potencial inibitório da CD6, já que não foram induzidos aumentos
do fluxo do cálcio ou de produção de interleucina-2 após activação.
Palavras-Chave: CD6; inibitório; citoplasmática; cauda; activação.
VI
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
IV. Abbreviations
ALCAM
Activated leucocyte cell adhesion molecule
Antigen
Ag
AP-1
Activator protein 1
APC
Antigen-presenting cell
BSA
Bovine Serum albumin
CD
Cluster of Differentiation
CLL
Chronic lymphocytic leukemia
cSMAC
Central Supramolecular Activation Cluster
CTL
Cytotoxic T lymphocytes
CTLA-4
Cytotoxic T lymphocyte-associated antigen 4
DAG
Diaglycerol
DC
Dendritic cell
DMEM
Dulbecco’s Modified Eagle Medium
dSMAC
Distal Supramolecular Activation Cluster
ELISA
Enzyme-linked immunoabsorbent assay
ER
Endoplasmatic reticulum
FACS
Fluorescence-activated cell sorting
FBS
Fetal Bovine Serum
FL
Full-length
IL-2
Interleukin-2
IP3
Inositol triphosphate
IS
Immunological synapse
ITAM
Immuno tyrosine-based activation motif
ITIM
Immuno tyrosine-based inhibitory motif
Itk
Interleukin-2-inducible T-cell kinase
LAT
Linker for activation of T cell
LB
Lysogeny broth
Lck
Lymphocyte-specific tyrosine kinase
LPS
Lipopolysaccharide
LTA
Lypotheichoic acid
mAb
Monoclonal antibody
VII
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
MAPK
Mitogen-activated protein kinase
MC
Microcluster
MS
Multiple Sclerosis
NFAT
Nuclear factor of activated T-cells
NF-kβ
Nuclear factor kappa B
Opti-MEM
Optimal-Minimal Essential Medium
PAMP
Pathogen-associated molecular patterns
PBS
Phosphate Buffered Saline
PCR
Polymerase chain reaction
PHA
Phytohaemagglutinin
PIP2
Phosphatidylinositol 4,5 – biphosphate 2
PKC
Protein Kinase C
PLC
Phospholipase C
pMHC
Peptide-complexed Major Histocompatibility Complex
PMSF
Phenylmethylsulfonyl Fluoride
PRR
Pattern recognition receptors
pSMAC
Peripheral Supramolecular Activation Cluster
PTP
Protein tyrosine phosphatase
RPMI
Roswell Park Memorial Institute
SDS-PAGE
Sodium dodecyl sulfate - polyacrylamide-gel-electrophoresis
SH2
Src Homology 2
SHP-1
Src homology phosphatase-1
SLP-76
SH2-domain containing leucocyte-76
SMAC
Supramolecular Activation Cluster
SNP
Single nucleotide polymorphism
SRCR-SF
Scavenger receptor cysteine-rich superfamily
SS
Sjögren’s Syndrome
Syk
Spleen tyrosine kinase
TBS-T
Tris-buffered saline 1%Tween
TCR
T cell receptor
Th
T helper
ZAP-70
Zeta associated chain -70
VIII
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
V. Table of Contents
I. Agradecimentos ........................................................................................................................ IV
II. Abstract ..................................................................................................................................... V
III. Resumo .................................................................................................................................... VI
IV. Abbreviations ......................................................................................................................... VII
V. Table of Contents ..................................................................................................................... IX
VI. Figures List .............................................................................................................................. XI
VII. Tables List ............................................................................................................................... XI
1. Introduction............................................................................................................................... 1
1.1. Introductory Notes ............................................................................................................. 2
1.2. T cell surface receptors ...................................................................................................... 3
1.3. TCR/CD3 complex ............................................................................................................... 4
1.4. Balance between kinases and phosphatases ..................................................................... 5
1.5. Co-receptors CD4 and CD8 ................................................................................................. 6
1.6. CD28 and CTLA-4 ................................................................................................................ 7
1.7. The Immunological Synapse ............................................................................................... 8
1.8. TCR triggering and T cell activation .................................................................................... 9
1.9. Scavenger Receptor Cysteine-Rich superfamily ............................................................... 11
1.9.1. CD5 ............................................................................................................................ 12
1.9.2. CD6 ............................................................................................................................ 13
2. Materials and Methods ........................................................................................................... 19
2.1. Cloning.............................................................................................................................. 20
2.2. Transformation and miniprep .......................................................................................... 21
2.3. Cell lines ........................................................................................................................... 21
2.4. Stable cell line production ................................................................................................ 22
2.4.1. Virus assembly ........................................................................................................... 22
2.4.2. E6.1 infection............................................................................................................. 22
2.4.3. Assessing infection efficiency .................................................................................... 22
2.6. Sorting ............................................................................................................................. 23
2.7. Western Blotting .............................................................................................................. 23
2.8. Activation Assays .............................................................................................................. 24
IX
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
2.8.1. Calcium flux variation ................................................................................................ 24
2.8.2. Interleukin-2 production ........................................................................................... 24
3. Results ..................................................................................................................................... 25
3.1. Stable cell line production ................................................................................................ 26
3.2. CD3, CD5 and CD6 expression .......................................................................................... 28
3.3. Sorting .............................................................................................................................. 29
3.4. Western-Blotting .............................................................................................................. 29
3.5. Activation assays .............................................................................................................. 30
3.5.1. Calcium flux assays .................................................................................................... 30
3.5.2. Interleukin-2 production ........................................................................................... 31
4. Discussion ................................................................................................................................ 34
5. Conclusion ............................................................................................................................... 39
6. References ............................................................................................................................... 41
X
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
VI. Figures List
Figura 1 – The Immunological Synapse (Page 3)
Figura 2 – CD6-CD166 Interaction (Page 15)
Figura 3 - CD6 protein mutants (Page 20)
Figura 4 – CD6 expression levels, given by the amount of citrine fluorescence, in E6.1
cells infected with virus particles (Page 26)
Figura 5 - Flow cytometry analysis of sorted infected E6.1 cells (Page 27)
Figura 6 - Flow cytometry analysis: of CD3, CD5 and CD6 expression (Page 28)
Figura 7 - Flow cytometry analysis of cells labeled for CD3 and CD6 (Page 29)
Figura 8 – Western-Blot (Page 30)
Figura 9 – Calcium activation assays (Page 32)
Figura 10 – IL-2 activation assays (Page 33)
VII. Tables List
Table I - Sequences of the primers used to amplify CD6 cDNA for cloning (Page 21)
XI
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
1. Introduction
1
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
1.1. Introductory Notes
The immune system is responsible for the host defense against disease. When
facing pathogens and other invaders, it is capable of protecting the host by
discriminating foreign organisms from endogenous cells, without causing any
damage of the host’s tissues and organs. The extremely complex molecular
machinery intrinsically involved in the process of defense is intensively studied in
order to figure out strategic therapies and to develop vaccines to avoid infectious
and inflammatory diseases, autoimmunity or even cancer, worldwide causes of
mortality.
In mammalians, there are two lines of defense, the innate and the adaptive. The
first line of defense to act upon invasion of a pathogen consists of the innate
response. It is mediated by the performance of a particular type of receptors, the
pattern recognition receptors (PRRs). These recognize broad groups of pathogens in
a non-specific manner and target the pathogen-associated molecular patterns
(PAMPs). Not only are PRRs able to stimulate tissue-resident macrophages to
produce cytokines, as they may kill viruses or act by phagocytosis of fungi.
Therefore, PAMPs recognition will trigger inflammation processes. PRR(s) also
assure the distinction between self and pathogens, thus avoiding auto-immune
diseases of infectious origin. However, in several cases, the innate response may
not be sufficient and the host must take advantage of the adaptive immune
response, also designated as acquired immune response, which is the second line
of defense. The adaptive immune system consists of a diverse network of cells
which recognize pathogens specifically. B and T lymphocytes are the cells per
excellence involved in this type of response. Antigens in the form of small peptides
are presented by the major histocompatibility complex (MHC) of antigen presenting
cells (APC) in the lymph nodes and spleen, where they are recognized by the B and
T cell receptors, respectively, in an antigen-specific manner, leading to the activation
of effector mechanisms. The adaptive cells are also gifted with immunological
memory. Although the innate and the adaptive response behave very differently,
they complement mutually.
2
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
A critical event at the beginning of the immune response is T cell activation,
mediated by the engagement of the T cell receptor (TCR) with the MHC. The
encounter of T cells and APCs triggers a series of signaling events that include
proliferation, differentiation and secretion of cytokines and growth factors. The
triggering of T cells occurs in a matter of seconds, when a cascade of tyrosine
phosphorylations is initiated, while T cell proliferation is a process that requires
several hours. T cell activation may result in either an activatory or inhibitory
downstream cascade of signaling events, thus maintaining the homeostasis in T
lymphocytes [1, 2, 3, 4].
1.2. T cell surface receptors
T lymphocytes expose a diverse group of surface molecules acting as receptors in
immune response. These receptors establish interactions with their ligands, located
on APCs membrane, through class I or class II MHC molecules (Figure 1), resulting
in the formation of the immunological synapse (IS). Yet, there are a number of other
molecules that are not directly involved in T cells-APC(s) engagement, but are
instead intrinsically involved in intracellular signaling cascades, thus participating in
signal transduction from the membrane to the nucleus of T cells.
Figure 1 – T lymphocytes receptors and their ligands. (Oliveira M. PhD Thesis, 2008)
3
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
It has become challenging to study all these molecules involved in the immune
response, simultaneously with their interactions. Both gene analysis, mainly by
sequencing, and the evolution in the field of microscopy have become major
contributors on finding the different T cell molecules and on unveiling their
interactions and their roles [5]. In this thesis, I approach the immune system by
describing how the surface receptor CD6 of T cells regulates T lymphocyte
responses. This chapter presents an overall view of the major constituents of T cells
including a brief description of their interactions with their ligands and an
understanding on how signaling cross-talk interferes with T cell responses and
behavior. I am focusing on several CD6 isoforms to map their inhibitory role on T cell
responses [6].
1.3. TCR/CD3 complex
The TCR complex is a multi-subunit receptor complex formed by an heterodimeric
structure of α and β chains, or γ and δ chains, coupled to a CD3 set of polypeptides
[7], that must recognize antigens and translate this recognition into intracellular
signal transduction events [8]. For that matter, two different subunits, able to
communicate with each other, can be discriminated: the antigen (Ag) binding subunit
and the signal transduction subunit. The Ag binding subunit comprises two
transmembrane dissulphide-linked chains, each containing a variable and a constant
immunoglobulin-like domain [9]. The constant domain is responsible to anchor the
TCR to the membrane. On the other hand, the variable domain is dedicated to the
Ag recognition, providing Ag specificity, since it is encoded in separate segments,
rearranged randomly [10].
Each TCR is constitutively associated with a CD3 complex, required for
membrane expression of the TCR and for signal transduction upon TCR-recognition
of Ag. CD3 is composed of four subunits that associate with the TCRαβ in the form
of three dimers. They include CD3ελ and CD3εδ heterodimers, and a CD3ζζ
homodimer [11]. The transmembrane region of CD3 is negatively charged due to the
presence of aspartate residues, allowing these chains to associate with the TCRαβ,
positively charged [7].
4
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
The cytoplasmic domains of CD3 molecules contain immunoreceptor tyrosinebased activation motifs (ITAMs), which are fundamental to the signaling capacity of
the TCR, since no signaling motifs have been found regarding the TCR. Each ITAM
has its own role in signaling events. When the TCR engages the peptide/MHC
(pMHC) on the APC surface, alterations of the homeostasis occur, promoting the
phosphorylation of CD3 ITAMs by Src kinases, such as Lck and Fyn. Several
docking sites for Src-homology 2 (SH2) domain-containing proteins are created,
allowing the association of -associated chain-70 (ZAP-70). ZAP.70 is a tyrosine
kinase which behaves as a key effector on the initiation of the T cell intracellular
signaling cascade.
The TCR binds self or foreign peptide on class I or class II MHC molecules. It
remains unclear how can the TCR recognize a specific ligand and how it
discriminates between the highly similar pMHC(s) present on APC(s) surface [12].
However, the presentation and origin of the antigen were reported to clarify whether
the TCR should bind MHC class I or MHC class II, providing two different types of
response.
1.4. Balance between kinases and phosphatases
Van der Merwe et al. [8] suggested that there is a balance in resting T cells
created between the phosphorylation of ITAMs in the TCR/CD3 complex and the
dephosphorylation by phosphatases. However, TCR triggering is thought to occur in
favor of ITAM phosphorylation, allowing the initiation of intracellular signaling
cascades.
Accordingly, T-cell-APCs engagement leads to phosphorylation of the CD3 ITAMs
by Lck and Fyn. Lck and Fyn feature two key tyrosine residues: one at the kinase
domain that induces T cell activation and one other at the C-terminal region that,
when phosphorylated, inhibits activation since it reduces the kinase activity.
Phosphorylation is accompanied by protein tyrosine phosphatase (PTP) activity.
CD45, one of the most abundant cell surface glycoproteins, with a cell surface
occupancy of about 10%, is a PTP expressed by nucleated hematopoietic cells [13].
It features an extremely long and highly glycosylated extracellular region. One of its
main roles seems to be the dephosphorylation of the C-terminal inhibitory tyrosine of
5
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
Src kinases, which leads to an increase of these kinases’ activity allowing T cell
activation, and the dephosphorylation of the positive autocatalytic tyrosine at the
kinase domain, which establishes a threshold to the kinase activity during activation
[14, 15, 16].
In parallel, other accessory molecules play an important role in T-cell activation.
Among them, co-receptors CD4 and CD8, co-stimulatory molecules such as CD28,
and adhesion molecules such as CD2, can be identified [17].
1.5. Co-receptors CD4 and CD8
T lymphocytes can be divided into two subpopulations according to the expression
of CD4 and CD8 membrane molecules. These co-receptors are known to corecognize Ag when the TCR engages different class MHC molecules [7].
Developing thymocytes are double positive since they express both CD4 and
CD8, until they undergo positive and negative selection differentiating into CD4+ or
CD8+ T cells [18].
CD8+ T cells define cytotoxic T cells (CTLs) able to recognize Ags associated with
class I MHC molecules. CD8+ T cells recognize and induce the apoptosis of infected
cells, commonly containing viruses or other cytosolic pathogens [9]. CD4+ T cells
define helper T cells (Th) which recognize Ag associated with class II MHC
molecules [7]. CD4+ T cells are known to produce cytokines and growth factors,
involved in the adaptive immune response, defending the human body from bacterial
infections. A subset of Th cells, Th1, are known to release cytokines and
chemokines to recruit macrophages and other phagocytic cells to the site of
infection, activating them and leading to the fusion of lysosomes and vesicles
containing bacteria. Another subset of Th cells is Th2. These are responsible for the
destruction of extracellular bacteria, through activation of B cells. [9].
The different roles attributed to the CD4 and CD8 co-receptors may be explained
by the different binding of each one of them to the respective class of MHC
molecule. Although both have Ig-like extracellular domains, a single transmembrane
domain and a short cytoplasmic tail, they are structurally different, which may explain
the different roles they display in the immune response. [7].
6
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
These co-receptors present an important role on T cell responses. An effective
response depends not only on specific TCR/pMHC engagement but also on the
interaction of these receptors with class I or class II MHC molecules. Both coreceptors recruit Lck to their cytoplasmic tail, becoming phosphorylated upon T cell
activation and mediating T cell signaling [19].
1.6. CD28 and CTLA-4
T cell activation requires, as previously referred, the engagement of TCR and
pMHC. However, the adaptive immune response does not occur in the absence of a
second signal provided by co-stimulatory and co-inhibitory molecules, such as CD28
and CTLA-4 (cytotoxic T lymphocyte-associated antigen 4), which allow sustained
activation. Blockage of these molecules may take cells to become anergic or even
apoptotic. CD28 and CTLA-4 are known as transmembrane glycoproteins, members
of the Ig superfamily. Their short cytoplasmic tails contain SH2- and SH3- binding
domains involved in signaling events. CD28 was also reported to be constitutively
expressed in T cells [20], opposite of what happens with the majority of molecules
known to participate in T cell responses.
These molecules share two ligands from B7 family, CD80 and CD86. CD28 and
CTLA-4 engagement with their ligands conjugates co-stimulatory and co-inhibitory
signals in order to maintain the homeostasis in T cells [21]. Whilst CD28 ligation
enhances T cell proliferation; cytokine production, mainly IL-2; transcription factor
activation; anti-apoptotic genes up-regulation; cell adhesion enhancement and cell
cycle regulation, among other roles, [20, 21, 22],
CTLA-4 does the opposite,
reducing the IL-2 production and thereafter reducing T cell activation [21].
These co-stimulatory receptors are also essential for the IS formation. [23]. It has
been hypothesized that CD28 initiates T cell activation and that, upon T cell
stimulation, CTLA-4 is up-regulated and translocates to the cell surface where it
displays the inhibitory potential to end, attenuate and also to establish a threshold in T
cell responses. CTLA-4 can behave this way because it has a higher competitive
advantage for ligand engagement than CD28, due to the higher affinity it shares with
either CD80 and CD86 [21].
7
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
1.7. The Immunological Synapse
The adaptive immune response is initiated when T cells encounter Ag presented
on APCs to form a dynamic and organized interface. The nanometer scale interface
created between these two cells is called the immunological synapse (IS) [2]. The
immature synapse has its receptors and other membrane proteins rearranged in
order to conceive the mature IS [24]. The mature IS was early identified as a
supramolecular activation cluster (SMAC) [25], structurally discriminated into three
spatially distinct concentric rings. The central SMAC, c-SMAC, is localized at the
center of the interface, where the TCR/CD3 complex engages pMHC. The peripheral
region, p-SMAC, surrounds the c-SMAC, and was reported to be enriched with
adhesion molecules and integrin-associated cytoskeleton proteins [26]. More
recently, a more external layer, the distal SMAC, d-SMAC, was also defined as the
region of the SMAC where proteins with large ectodomains, such as CD45 PTP, are
thought to accumulate. This model, known as bull's-eye rearrangement, is not found
at all IS, being absent on those formed with dendritic cells [27]. According to this
model, the IS as a SMAC becomes the interface per excellence responsible for
antigen recognition and T-cell activation [23]
The accumulation and distribution of receptors in the IS probably occurs by
recruiting ligands to the contact site, generating the necessary driving forces to
recruit TCR/CD3-pMHC, adaptor proteins, as well as kinases, to the IS. Upon the
massive recruitment of receptors to the IS, they form a mature IS [28, 29]. A new
hypothesis emerged, based on imaging analyses, that detected small structures
present at all immune synapses, containing different receptors, adaptors and
kinases. According to this hypothesis, microclusters (MC) were reported to form the
moment after pMHC recognition by the TCR complex. TCR-MCs play a role either in
antigen recognition as well as in the initiation of T cell signaling events. After their
formation and assembly in the peripheric region of the IS, it seems that they tend to
migrate to the c-SMAC, where they accumulate. During the migration to the cSMAC, they were reported to lose their associations with phosphorylated kinases
and other adaptors proteins they are bound to, such as Lck and ZAP-70 [23, 30].
The mature IS forms in an order of minutes, upon T cell-APC contact, while TCR
triggering occurs in a matter of seconds [31]. The end of synapse formation was
suggested to happen when lack of antigens decreases the continuous production of
8
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
peripheral MCs, stopping their translocation to the c-SMAC and thereafter
weakening the T cell-APC interaction [23].
1.8. TCR triggering and T cell activation
The recognition of pMHC by the TCR is the key to the process of T cell activation
in adaptive immune responses [32]. However, a second signal integrates this
response. The engagement of other molecules is required for full T cell activation.
Among them, co-receptors CD4 and CD8 and co-stimulatory molecules, such as
CD28, have been identified.
It is important to consider the cellular environment surrounding T cell activation,
which can be regulated by the cytoskeleton and lipid rafts. The cytoskeleton
undergoes several conformational changes modulating its shape during T cell
activation, providing motility and dynamic to T cell surface molecules. IS formation,
TCR-pMHC engagement, receptor recruitment and signaling events are processes
associated with cytoskeleton remodelations. However, lipid rafts also seem to play a
role on T cell activation. Lipid rafts are a combination of glycosphingolipids and
protein
receptors
organized
in
glycolipoprotein
microdomains,
which
compartmentalize cellular processes. Their aggregation, promoted by TCR
engagement, makes them the favorite place for the translocation of signaling
proteins, such as Lck, ZAP-70 and LAT [33].
TCR triggering is the mechanism per excellence responsible for the initiation of T
cell signaling, upon TCR engagement with class I or class II pMHC molecules. Some
models emerged, aiming to explain T cell triggering. Aggregation models proposed
that the aggregation of TCR-CD3 complex results in the proximity of tyrosine
kinases, responsible for ITAMs phosphorylation, allowing triggering of intracellular
signaling cascades. Other models reported that this triggering was achieved by
conformational changes in the cytoplasmic tail of CD3 molecules, upon TCR-CD3
complex engagement with pMHC. These changes were driven by mechanical forces
(ref van der merwe).
9
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
A more recent view proposes a different model, the kinetic segregation model.
According to this model, T cell triggering occurs as result of the balance created
between phosphorylation and dephosphorylation mechanisms. When adhesion
molecules attempt to create close contact zones between T cells and APCs,
molecules with large extracellular domains, such as CD45, are excluded from the cSMAC, reducing the phosphatase activity in that region. Small proteins are recruited
to the interface, mainly the TCR/CD3 complex, and this change provided by the
phosphatase activity reduction will allow an increase in phosphorylation, resulting in
TCR triggering, which is the starting point of T cell activation [34]. However, it
remains unexplained whether the CD45 phosphatase exclusion is sufficient to
induce the TCR triggering [8].
T cell activation is a process that comprises several steps. The first one is called T
cell polarization (1), during which the migration of both T cells and APC(s) are
mediated by chemokines. This process is not only important to the IS formation but
also to provide Ag recognition. Following polarization, adhesion (2) between T cells
and APCs must occur in order to facilitate TCR engagement, by creating an optimal
distance between the two cells. Along with the contribution of adhesion molecules,
TCR engagement (3) is initiated, creating multiple second messengers and inducing
cytoskeleton changes to stop the migration of cells. It is important to sustain full
activation, which requires transcriptional activation, and to establish the IS. Early
signaling (4) is described through several responses, such as intracellular calcium
increase and metabolism changes. One of the earliest events in T cell activation is
the phosphorylation of ITAMs. Finally, the IS is disrupted (5), allowing T cell
activation to end [32].
In the sequence of events involved in T cell activation, from the membrane to the
nucleus, there is a balance created by two opposing processes of phosphorylation
and dephosphorylation, as previously referred. According to the kinetic segregation
model, when the contact zone between T cells and APCs is optimal, large
ectodomains proteins, such as CD45, are excluded, allowing small proteins to be
recruited and to accumulate at the IS. CD3 ITAMs become phosphorylated by Src
kinases; phosphorylation is reported to be enhanced by Lck associated with CD4.
Phosphorylated ITAMs become binding sites for SH2 domain-containing proteins,
such as ZAP-70. ZAP-70 is also phosphorylated by Src family kinases, becoming
10
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
activated and capable of phosphorylating other substrates, such as adaptor linker for
activation of T cell (LAT) or the SH2 domain-containing leucocyte (SLP-76). This
leads to the assembly of multiple adaptor proteins and scaffold enzymes and,
simultaneously, to the activation of multiple signaling pathways.
There is an enormous variety of substrates and molecules involved in T cell
signaling. Upon receptor stimulation, phospholipase C (PLC) is activated and
produces diacylglicerol (DAG) and inositol triphosphate (IP3), by cleaving
phophatidylinositol 4, 5-biphosphate (PIP2). IP3 is a second messenger that
releases calcium, an early event in the timeline of T cell responses. When calcium,
stored at the endoplasmatic reticulum (ER), is released, cytosolic Ca2+ concentration
increases and binds to calmodulin, which in turn activates the phosphatase
calcineurin. Calcineurin dephosphorylates NFAT, allowing it to migrate to the
nucleus and activate the expression of cytokines, such as IL-2, so that they promote
T cell proliferation. Also, DAG may stimulate protein kinase C (PKC) to promote the
initiation of transcription mechanisms. The activation of both NF-B and AP-1 is
mediated by PKC. G proteins, present in the lipid rafts, also mediate signal
transduction. In the context of T cell signaling, they participate in the MAPK pathway,
also promoting the activation of transcription factors at the nucleus [35]. The
activation of transcription factors is very important since it will determine the fate of T
lymphocytes.
1.9. Scavenger Receptor Cysteine-Rich superfamily
The Scavenger Receptor Cysteine-Rich superfamily (SRCR-SF) of proteins is a
highly conserved, stable and ancient family of cysteine-rich type scavenger
receptors [36]. This superfamily contains members that are structurally related but
share very few functions. Some members such as CD5 and CD6 act as receptors.
Moreover, SRCR domains are thought to be involved in different functions, like
pathogen recognition, modulation of the immune response, epithelial homeostasis,
stem cell biology, and tumor development [37].
The SRCR-SF contains more than 30 members, described mainly in mammals,
but also in vertebrates and algae [38]. Typically, SRCR-SF members are expressed
in cells belonging to the immune system: B cells, T cells, macrophages, among
11
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
others. However, some members are expressed in several tissues and organs, such
as the liver, kidney, placenta, stomach, brain and heart [37], and this epithelia and
mononuclear-phagocytic system expression suggests a potential role in mucosal
defense. SRCR-SF members are classified based on the exon organization and
localization and the number of cysteines in each SRCR domain. Accordingly, type A
domains are encoded by two exons and contain six cysteine residues, whereas type
B domains are encoded by a single exon and contain eight cysteine residues. CD5
constitutes an exception since it is a type B SRCR member containing six cysteine
residues [38].
Due to its diversity, the precise function of SRCR proteins is yet to be discovered.
Since these members seem to play an important role on both innate and adaptive
immune systems, it becomes of crucial importance to explore the role(s) of this SF
[39, 40].
1.9.1. CD5
CD5 is a surface receptor, member of the SRCR superfamily [41]. CD5 is
expressed on thymocytes, mature peripheral T cells, on B cells derived from B-CLL
[42] and also in a sub-population of B cells, B-1a cells [43]. It comprises an
extracellular region of three scavenger domains, a hydrophobic transmembrane
region and a highly conserved cytoplasmic domain [41]. The cytoplasmic domain
contains several threonine/serine and tyrosine residues, potential sites of
phosphorylation upon TCR/CD3 complex stimulation [44]. There are four tyrosine
residues in the CD5 cytoplasmic tail at positions Y378, Y429, Y441 and Y463. Y378
is within a tyrosine-based inhibitory motif (ITIM). The middle tyrosines, Y429 and
Y441, form an imperfect ITAM and they are the main targets of phosphorylation [45].
Upon tyrosine phosphorylation, binding sites for SH2 domain-containing molecules
are formed [46]. SHP-1 is a phosphatase able to bind SH2 domain-containing
proteins, thus being able to associate with the CD5 cytoplasmic tail. The sequence
involved in the binding of SHP-1 was mapped to Y378. It is known that, upon
TCR/CD3 stimulation, SHP-1 association with CD5 increases, thus cooperating with
the inhibitory role of CD5 in T cell signaling [47]. Also, CD5 was reported to interact
with molecules present on the APC surface, such as CD72 [48]; it has its SRCR-D3
domain binding to CD2, an adhesion molecule present on the T lymphocyte surface
[44]. CD5 associates through its extracellular region to CD6, also a member of the
12
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
SRCR-SF [49]. Although CD5 has its extracellular and cytoplasmic regions binding
other molecules, no physiological ligand at the APCs was independently confirmed
to bind CD5.
The CD5 signaling pathway involves the participation of Src family kinases, such
as Lck and Fyn, Ca2+/calmodulin-dependent kinases [50], RasGAP and Cbl [51, 52],
among others. These mediators down-modulate T cell activation helping to establish
the main role of CD5 [53]. CD5 was reported to accumulate at the IS, the place of
excellence where molecules are recruited to during T cell activation [54].
Early studies reported CD5 as a dual modulator involved in T cell activation since
it was thought to act both as a co-stimulatory and inhibitory receptor. Moreover,
initial studies describe CD5 as an enhancer of TCR-mediated cell proliferation [55].
However, CD5 is now considered an inhibitory molecule. Thymocytes from CD5
deficient mice showed a higher proliferation rate and increased free cytoplasmic
Ca2+ concentration upon TCR/CD3 stimulation [56]. Also, other studies pointed CD5
as a major down-modulator involved in T cell activation processes [53]. The
inhibitory function of CD5 was described to be dependent on the functional integrity
of its cytoplasmic tail [57]. It has been suggested that SHP-1 is involved in this
function, since it binds SH2 domains, upon phosphorylation,. Recently, Bamberger
et al. proposed an alternative pathway mediated by Src family kinases [53].
According to this model, early T cell signaling comprising effectors such as ZAP-70,
are inhibited via a parallel pathway of CD5. CD5 is able to associate with Fyn in lipid
rafts, allowing Fyn phosphorylation in the C-terminal inhibitory tyrosine residue
followed by a reduction of Fyn activity. Thereafter, the activation of ZAP-70 is downregulated [53]. Lck has been considered as the main kinase interacting with CD5
although others may complement its function.
1.9.2. CD6
CD6 is a type I membrane glycoprotein that participates in the fine-tuning of T cell
responses [37]. It was first discovered in T cell studies using mAb 12.1 by Kamoun
et al. [58]. CD6 is expressed on thymocytes, on a sub-population of B cells (B-1a), in
some brain cells and in cells derived from chronic lymphocytic leukemia (B-CLL) [51,
59, 60]. CD6 expression increases along the process of thymocyte maturation, being
higher on single positive CD4-CD8+ and CD4+CD8- thymocytes[61].
13
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
CD6 belongs to the SRCR-SF [37] like CD5 [41] and SSC5D [62]. As a surface
receptor and a member of SRCR-SF, CD6 comprises an extracellular region
composed of three SRCR domains, a small transmembrane domain and an
unusually long cytoplasmic tail [37, 63, 64, 65]. CD6 has a molecular weight of about
105-130kDa [65] due to heavy glycosylations and phosphorylations [66].
Human CD6 is encoded by 13 exons. First seven exons code for the extracellular
and transmembrane domains while the remaining exons code for its cytoplasmic tail
[69]. Several CD6 isoforms were reported as result of alternative splicing of the
exons coding for the extracellular and cytoplasmic domains [66, 49]. The
cytoplasmic tail strongly participates in T cell responses. Although it features no
intrinsic enzymatic activity, it is enriched with residues that are phosphorylated
during T cell activation and further interact with signaling and cytoskeletal proteins
[37, 70]. The cytoplasmic tail of CD6 has tyrosine [63], threonine and serine residues
which can be phosphorylated, as well as two proline-rich sequences established as
docking sites for SH3 domain-containing proteins [66, 69].
Lymphocytes have multiple accessory molecules on their surface, which have a
relevant role in T cell responses. CD6 and CD5 were reported to be closely related
accessory molecules [70]. In humans, the CD6 gene was reported to map at
chromosome 11q12.2, close to the gene coding for CD5 [67, 71]. While CD5
transcription regulation upon T cell activation has been intensively studied, CD6 has
only been reported to be transcriptionally regulated by RUNX1/3 and Ets-1,
transcription factors that bind the CD6 promoter region in T cells and appear to
regulate conserved mechanisms [72, 73].
When compared with other T cell receptors, the accessory molecules CD5 and
CD6 display a very similar structure and expression pattern [50, 74]. As they have
homologous extracellular regions, it seems understandable that they also share
similar roles on T cell activation and differentiation [51, 75, 76, 77]. Yet, their
cytoplasmic domain is very distinct [53]. CD6 presents an important role in the
regulation of CD5 tyrosine-phosphorylation. It is known that CD5 has the ability to
unusually associate with tyrosine kinases from different families, such as Src family
kinases Lck and Fyn, Syk family kinase ZAP-70, and Tec family kinase Itk, which
may be explaining its possible inhibitory role. CD6 may have an activatory role over
CD5 [49]. CD5 has also been reported to behave as a negative modulator in T cell
activation [78] and CD6 seems to induce CD5 tyrosine-residues phosphorylation
[37], thus increasing the CD5 inhibitory activity [79]. Moreover, the CD6 and CD5 co-
14
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
localization [37, 56, 24] at the IS reinforced the idea of an inhibitory role shared by
both scavenger receptors.
CD6-CD166 interaction
CD166 or ALCAM (Activated leukocyte cell adhesion molecule), is the counter
receptor for CD6. It is located on the APC membrane [80, 82], comprises five Ig
extracellular domains [69] and is expressed in hematopoietic (activated lymphocytes,
macrophages, dendritic cells, thymic epithelial cells) and non-hematopoietic
(epithelial, endothelia, neurons, fibroblasts, etc.) cells [69, 81]. CD166 is the first
described immunoglobulin-like receptor to bind to a cysteine-rich domain [56].
Binding of CD6 to CD166 is both unusual and specific, since T cell receptors are
known to bind their ligands in a “head to head” manner and CD166 binds CD6 on its
most membrane-proximal domain, the third domain (Figure 2). The first evidence
that the membrane-proximal SRCR domain of CD6 bound to CD166 was described
by Whitney et al. [65]. As result of studies using an alternative spliced isoform
without the exon 5, thus lacking the third extracellular domain of CD6, it was
discovered that the CD166 N-terminal region (D1) binds laterally to the third
extracellular SRCR domain (SRCR-D3) of CD6 [83, 60]. The CD6-CD166 interaction
targets CD6 to the center of the IS [49, 84], where it plays a dual role by improving
early and stable adhesion between lymphocytes and APCs, and by modulating the
later proliferative responses of lymphocytes [56, 85]. Accordingly, blocking this
interaction with specific antibodies reduces T cell-APC contacts and both molecules
no longer target to the IS. The other two SRCR domains of CD6, D1 and D2, may
also be responsible for yet non-described and unknown functions of CD6.
15
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
Figure 2 – CD6 and CD166 engagement
T cell signaling
Once TCR-pMHC engagement occurs, along with a second signal provided by
co-stimulatory molecules, T cell activation is initiated. At the beginning of this
process, tyrosine-residues of CD6 cytoplasmic tail become phosphorylated by Src
kinases, such as Fyn and Lck [6]. Upon phosphorylation, SH2 domain-containing
proteins such as ZAP-70, an important effector in T cell activation, are recruited as
well as the positive regulator SLP-76, which binds the CD6 tyrosine residue Y662
[86]. SLP-76 also interacts with molecules activating the PKC and MAPK pathways
[73]. Syntenin-1 is another adaptor protein able to bind signal transduction effectors
and cytoskeletal proteins. It seems to be a good candidate for binding to the CD6
cytoplasmic tail since it was reported to accumulate at the IS, similarly to CD6 [87].
Both adaptor proteins are controlled by phosphorylation of the CD6 C-terminal
region. Cross-linking CD6 with Abs or with its own physiological ligand CD166 was
reported to activate molecules involved in the MAPK pathway, and also the AP-1
and NF-B transcription factors [37, 79].
CD6 biological function
CD6 was regarded as co-stimulatory molecule able to deliver signals to cells [39,
61, 75, 77, 88] and as an adhesion molecule in thymocyte-thymic epithelial cells
16
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
interactions [69]. Accordingly, studies that consist of cross-linking CD6 with
monoclonal antibodies suggest a similar positive regulatory activity of CD6 in T cell
responses [64]. Other studies also suggested that CD6 participates on thymocyte
maturation [69] because during thymocyte development, CD6-depending signals
contribute to thymocytes survival and positive selection [40]. Moreover, CD6 long
term engagement with CD166 is crucial for T cell proliferation induced by dendritic
cells, since it recruits them to DC-T cell contact zones [85]. T cell proliferation is also
enhanced when CD6 acts as a co-stimulatory molecule capable of synergizing with
TCR and co-stimulatory CD28 [56].
On the other hand, in a study using mAbs OX126 and 3A6, which bind CD6-d3
and CD166 respectively, opposite results were obtained. In fact, when using OX126,
T cell proliferation was reduced; on the other hand, when using 3A6, the exact
opposite happened, suggesting that CD6 has, similarly to CD5, an inhibitory role in
T cell activation [6]. A work from 1997, described calcium flux studies using different
CD6 isoforms of variable cytoplasmic lengths [89]. It was suggested that the Nterminal half of the cytoplasmic tail of CD6 was critical for calcium mobilization since
experiments with a full length isoform of CD6 (CD6 FL) presented no calcium flux
variations, and when using shorter isoforms, an increase on calcium flux was
observed. However, a work from 2012 that proved CD6 as an attenuator of early and
late signaling events on T cells activation, presented a different hypothesis. The CD6
cytoplasmic tail seems responsible for the inhibitory potential, since in its absence,
no inhibition occurs [6]. CD6 FL attenuated early and late T cell responses such as
intracellular calcium flux and IL-2 production, respectively, in accordance with
Kobarg et al. [89] point of view. But, on the other hand, CD6Cy5, an isoform with
only five aminoacids in the cytoplasmic tail of CD6, showed no signs of downmodulating T cell activation. In fact, regarding this isoform, there was an increase on
intracellular calcium flux levels upon activation with OKT3 and anti-CD28 mAbs.
As an innate response element
CD6 is not only an intermediate of the adaptive immune response. It has been
also thought to play a role in the innate response. Since some members of the
SRCR-SF act as pattern recognition receptors (PRR) for microbial organisms, CD6
has been suggested to play a similar role in binding pathogen-associated patterns in
bacteria and fungi. The work of Sarrias et al. [39] reported that the extracellular part
of CD6 may have retained this innate immune ability from ancient member of the
SRCR-SF, thus being able to interact with lipopolysaccharide (LPS) from Gram
17
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
negative bacteria and with lipoteichoic acid (LTA) and peptidoglycan from Gram
positive bacteria, an interaction that triggers MAPK cascades, involved in T cell
signaling. CD6 was also reported to be able to aggregate bacteria [38]. These
characteristics give CD6 the potential of being regarded as a possible therapeutic
target. Not only cells of the innate immune responses, but also T cells, may use the
presence of bacterial components through CD6 to recognize PRR's, something
essential for the intervention of septic shock or other inflammatory diseases of
infectious origin (39, 40]. This has led to an increased survival rate and to the
reduction in pro-inflammatory cytokine levels in murine, opening doors to CD6
therapeutic use in human sepsis [37].
CD6 in disease
The determination of CD6’s main role and regulation, simultaneously with the
detailed study of the pathways regulated by this molecule, has achieved great
importance since CD6 has been associated with diseases, such as cancer and autoimmune diseases. Similarly to CD5, a marker of chronic lymphocytic leukemia (BCLL) [60], the possibility that CD6 may be used with therapeutic potential or as a
diagnostic marker on diseases of significant matter has become real. Studies were
developed to explore the therapeutic potential of CD6 (75). It is already known that
CD6-CD166 induces synergistic co-stimulation enhancing the intrinsic activity of
TCR/CD3 activation pathways. Targeting CD6 without interfering with its ligand
reduced T cell activation, proliferation and pro-inflammatory responses, which would
allow us to think of CD6 as a possible target for the treatment of auto-immune
diseases [84]. In fact, CD6 has been linked to rheumatoid arthritis (RA), Sjögren's
syndrome (SS) and multiple sclerosis (MS) [83, 90, 91, 92]. A single nucleotide
polymorphism (SNP) in exon 1 of CD6 was reported to be associated with MS [75].
In SS, a soluble form of CD6 is present in high levels in 2/3 of the patients, although
there is no correlation between these findings and disease prognosis [92]. CD6 is
expressed at high levels in malignant B cells derived from B-CLL [42]. Knowing that
CD6 regulates Bcl-2/Bax ratio, protecting B-CLL cells from apoptosis [60], it would
be interesting to unveil the reason and role of CD6 expression in this disease. It thus
becomes mandatory to elaborate further studies to better understand CD6 as a
negative modulator.
The aim of my thesis is to map the inhibitory role of the CD6 within its
cytoplasmic tail.
18
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
2. Materials and Methods
19
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
2. To map within the cytoplasmic tail of CD6 the region responsible for its inhibitory
properties, six CD6 mutants were created. These isoforms, containing cytoplasmic tails
of different lengths, were designated as Cy5, Cy37, Cy70, Cy135, Cy179 and FL
(Figure 3), being FL the isoform corresponding to the full length protein, and in all the
others the number corresponds to the number of cytoplasmic amino acid residues
present.
Figure 3 – Schematic representation of the six CD6 protein mutants generated by stably expressing the constructs in
E6.1 Jurkat cells.
2.1. Cloning
Prior to my work, cDNA corresponding to each of the six isoforms was amplified
from genomic DNA by Polymerase Chain Reaction (PCR), using a forward primer
containing an AscI restriction site and a Kozac sequence. This primer spans the ATG
start site and was common to all isoforms. Reverse primers were specific to each of the
isoforms and contained a BamHI restriction site (Table I).
20
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
Table I –Sequences of the primers used to amplify CD6 cDNA for cloning
Primer name
Sequence (5’-3’)
CD6_ATG(AscI) forward
TAGTAGGGCGCGCCGCCACCATGTGGCTCTTCTTCGGGATCA
CD6Cy5(BamHI)Rev
CTACTAGGATCCCTATTATTTCCTTTAATTCTCAAGAGGATGAA
CD6Cy37(BamHI)Rev
CTACTAGGATCCTTTGGGGATGGTGATG
CD6Cy70(BamHI)Rev
CTACTAGGATCCCTGGGCGCTGAAGTC
CD6Cy135(BamHI)Rev
CTACTAGGATCCCCTCGGGTGATACTGA
CD6Cy179(BamHI)Rev
CTACTAGGATCCCTCCAAGTTTGGGG
CD6FL(BamHI)Rev
CTACTAGGATCCCTAGGCTGCGCTGATGTCATC
Amplified cDNA corresponding to each of the isoforms was cloned, after purification,
in a pHR vector containing an ampicillin resistant gene for selection, as well as a citrine
gene which is expressed as a fusion protein with our mutants. For cloning, PCR
products were digested with AscI (8 h, 37 ºC) and BamHI (2 h, 37 ºC) restriction
enzymes (BioLAbs) in NEBbuffer 4. pHR vector was digested with MluI and BamHI
enzymes (BioLAbs), for 3 h at 37 ºC. Digestion products were run on a 1% agarose gel
to check efficiency, and digested bands were cut and purified with the QiaexII kit
(Qiagen) according to the manufacturer’s instructions. Ligation was performed
overnight at room temperature, in a 20 µl total volume reaction containing binding
buffer and T4 DNA ligase enzyme (Fermentas).
2.2. Transformation and miniprep
TOP-10 competent cells were transformed with 8 µl of ligation product by a
heatshock method – 20 min on ice followed by 30 sec at 42 ºC and again 5 min on ice.
Cells were grown for 1 h at 37 ºC and then plated on LB plates with ampicillin and left
overnight at 37 ºC. After a colony PCR to confirm the insert size of few colonies
representing each construct, plasmids were isolated with the PureLink® Quick Plasmid
Miniprep Kit protocol (Invitrogen), following the manufacturer’s instructions.
2.3. Cell lines
The Jurkat cell line (clone E6.1) and the kidney adherent 293T cells were
maintained in complete Roswell Park Memorial Institute (RPMI) media (Gibco) and
Dulbecco's Modified Eagle Medium (DMEM) (Gibco), respectively, with 10% Fetal
21
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
Bovine Serum (FBS) (Gibco) and 1% penicillin and streptomycin (Invitrogen), at 37 ºC
and 5% CO2. Cells were passed every 3 days when approaching confluence.
2.4. Stable cell line production
Stable Jurkat cell lines (clone E6.1) expressing each of the CD6 mutants were
produced by lentiviral infection and expression.
2.4.1. Virus assembly
293T cells were transfected with 0.5 µg of each of the three vectors necessary for
virus assembly: pMD-G, p8.91 Ex QV and pHR-citrine, the last one cloned with the
DNA coding for each of the mutants. In short, 24 h before transfection, 293T cells were
counted and plated on a 6-well plate at a concentration of 3 x 105 cells/ml in 2 ml of
DMEM media. The three vectors were transfected in a mix of 4.5 µl lipofectamine
(Invitrogen) and 100 µl of Minimal Essential Medium (Opti-MEM) (Gibco). After 30 min
of incubation at room temperature, the transfection mix was added to the 293T cells,
whose media had been replaced by complete RPMI. Cells were then incubated from 48
to 72 h at 37 ºC to allow virus assembly and production into the supernatant.
2.4.2. E6.1 infection
Virus particles coding for the different CD6 mutants were used to infect E6.1 cells.
The virus-containing supernatant of the transfected 293T cells was centrifuged for 5
min at 1200 rpm to remove any contaminating 293T cell, which was then added to 106
E6.1 cells in 4 ml of complete RPMI. Cells were left for 48 h at 37 ºC to allow infection.
2.4.3. Assessing infection efficiency
CD6 is expressed as a fusion protein of CD6-citrine. We have used citrine
fluorescence to measure the amount of CD6 being expressed in the infected cells and
to assess transfection efficiency by flow cytometry analysis. Cells expressing CD6 were
sorted (Fluorescence-activated cell sorting Aria (FACS Aria)) to homogenize the CD6expression levels within all CD6 mutants.
2.5. CD3, CD5 and CD6 Expression Profile
All CD6 mutant cell lines were analyzed for the expression of CD3, CD5 and CD6
membrane markers, by cytometry, using monoclonal antibodies (mAb) anti-CD3, antiCD5 and anti-CD6, respectively. In short, 3 x 106 cells of each isoform were used for
each labeling. Cells were collected by centrifugation (1200 rpm for 5 min) and washed
22
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
with Phosphate Buffered Saline (PBS) (Invitrogen). All samples were ressuspended in
50 µl of FACS buffer (0.2% Bovine serum albumin (BSA) and 0.1% Azide) containing 1
µg of each of the primary mAb - mouse anti-CD3 (OKT3), mouse anti-CD5 (IgG1
Y2/178 (Santa Cruz Biotechnology)) and mouse anti-CD6 (MEM98 (1 mg/ml) (Exbio));
as a negative control, we used 1 µg of OX-54 (anti-rat CD2). Cells with mAbs were
incubated for 30 min on ice and then washed twice to eliminate the excess of mAb.
Cells were then incubated for 15 min in 50 µl of FACS buffer containing 1 µg of the
secondary Ab labeled with Alexa Fluor® 647 (donkey anti-mouse IgG (H+L),
Invitrogen). Cells were washed again two times using FACS buffer to remove the
secondary Ab in excess and ressuspended in 200 µl of PBS and filtered. Results were
analyzed by Flow Jo software (version 8.8.7).
2.6. Sorting
To ensure that cells were expressing CD6 and CD3 at similar levels, all samples
were labeled for these two markers (as explained above) and sorted.
2.7. Western Blotting
The size of the proteins was confirmed by Western-Blotting. Cells lysates were
obtained by lysis of 3 x 106 cells with NP-40 lysis buffer (10 mM Tris-HCl pH 7.4; 150
mM NaCl; 1 mM EDTA; 1% (v/v) NP-40) containing PMSF (1 mM) (Sigma) for 30 min
on ice. Samples were centrifuged at high speed for 10 min at 4 ºC. The supernatant
was kept and mixed with 2x Laemmli Sample buffer (BioRad). Samples were
denaturated for 5 min at 95 ºC and kept at -20 ºC
Lysates were loaded on a 10% SDS-polyacrylamide gel (SDS-PAGE) and
separated for 1 h and 30 min at 150 V. Samples were transferred to a nitrocellulose
membrane in an iBlot equipment (Invitrogen), according to the manufacturer’s protocol,
which was then blocked in a solution of 5% non-fat dry milk in Tris-Buffered Saline and
1% Tween (TBS-T) (20 mM Tris-HCl; 137 mM NaCl; 0,1% (v/v) Tween 20 (10%); pH
7.6), for 1 h at room temperature. The membrane was incubated with the primary antiCD6 Ab (Anti-Human CD6 Purified 1 mg/ml clone MEM98 (Exbio)) in a solution of 3%
non-fat dry milk in TBS-T, overnight at 4 ºC. After a series of 5 min washes with TBS-T,
the membrane was incubated for 1 h at room temperature with the secondary Ab (goat
anti-mouse IgG-HRP 200 µg/0.5ml (Santa Cruz Biotechnology)) in a solution of 3%
non-fat dry milk in TBS-T. ECL solution (GE Healthcare) was used for developing, after
23
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
which the membrane was exposed to an X-ray film.
2.8. Activation Assays
Jurkat E6.1 cells expressing each of the different CD6 mutants were used to
perform activation studies. Analysis of intracellular calcium mobilization and interleukin
2 (IL-2) production, early and late activation responses respectively, were performed.
2.8.1. Calcium flux variation
Intracellular calcium fluxes were measured on Jurkat E6.1 cells expressing the
different CD6 mutants, as well as CD6 full length. Samples were loaded with 5 µM of
Fluo-3 (Invitrogen), a molecular probe capable of binding free intracellular Ca2+, for 30
min at 37 ºC. Cells were washed with PBS and analyzed by flow cytometry which gives
the variation of fluorescence given by the Fluo-3/calcium interaction upon activation.
Cells were monitored for 5 min and activated with 1 µg/ml of mAb anti-CD3 (OKT3)
after the first minute. Results are analyzed with FlowJo software (version 8.8.7).
2.8.2. Interleukin-2 production
IL-2 production studies are relevant to monitor T cell activation as a late signaling
event. Evaluation of IL-2 production was performed using an Enzyme-linked
immunosorbent assay (ELISA assay) (Human IL-2 ELISA KIT II, BD OptEIA),
according to the manufacturer instructions. In short, the supernatant of resting and 24 h
phytohaemagglutinin (PHA)-activated cells (2 µg), along with the standards, was
loaded, in duplicate, into a plate coated with an IL-2 mAb. After a 2 h incubation period
and a series of washing steps, a detection solution was added producing an antibodyantigen-antibody “sandwich” and, after another hour incubation and another series of
washing steps, a substrate reagent was added to each well and incubated for 30 min,
producing a blue color proportional to the amount of IL-2 present in the initial sample.
The reaction was stopped turning the blue color into a yellow color, whose absorbance
was read at 450 nm, using Biotek software Gen5 (version 1.06).
24
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
3. Results
25
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
Aiming to map within the cytoplasmic tail of CD6 the domain responsible for its
inhibitory potential in T cells, several CD6 constructs featuring variable cytoplasmic tail
lengths were previously created and designated as CD6Cy5, CD6Cy37, CD6Cy70,
CD6Cy135, CD6Cy179 and CD6FL.
3.1. Stable cell line production
In our constructs, CD6 is expressed as a fusion protein with citrine. We have used
citrine fluorescence to assess, by flow cytometry, the levels of CD6 expression in E6.1
transfected cells.
E6.1 cells were efficiently expressing the different CD6 isoforms, except for isoform
CD6Cy37 (Figure 4). CD6 expression levels were not uniform within all cell lines and
expression of isoforms CD6Cy37, CD6Cy135 and CD6FL was quite low or almost null.
Figure 4 – Flow cytometry analysis:
CD6 expression levels (FL-1), given by
the amount of citrine fluorescence, in
E6.1 cells infected with virus particles
containing
CD6Cy5,
CD6Cy37,
CD6Cy70, CD6Cy135, CD6Cy179 and
CD6 FL mutants (blue). Plots show
that E6.1 cell lines express a low
amount of CD6. Non-infected E6.1
cells were used as control (red).
26
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
In order to obtain a more homogeneous CD6-expressing population, these cells
were sorted for the same level of citrine expression and results are shown in Figure 5.
After sorting, all E6.1 cell lines were expressing CD6 isoforms at good levels when
compared with the control. E6.1 cells expressing CD6Cy5 expressed two different
populations, one of them with a low amount of CD6.
Figure 5 - Flow cytometry analysis of sorted infected E6.1 cells: CD6 expression (FL-1) of cell expressing CD6Cy5,
CD6Cy37, CD6Cy70, CD6Cy135, CD6Cy179 and CD6FL isoforms. Plots show that CD6 mutants after sorting express
higher levels of CD6. Non-infected E6.1 cells were used as control (red).
27
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
3.2. CD3, CD5 and CD6 expression
The expression of CD3, CD5 and CD6 of all cell lines, expressing CD6 mutants, was
compared (Figure 6).
Figure 6 - Flow cytometry analysis: of CD3, CD5 and CD6 expression in each of the cell lines; anti-rat OX-54 mAb was
used as control. CD6Cy5 shows no CD6 expression. All the other cell lines were expressing CD6. All cell lines were
also expressing CD5 and CD3. However, the largest CD6 positive population in cells expressing CD6Cy135, CD6Cy179
and CD6FL is not simultaneously expressing CD3. Cells expressing CD6Cy70 show a minimum expression of both CD6
and CD3.
All cell lines expressed high levels of CD3 and CD5 as expected. CD6 expression
levels, however, were not homogeneous among the mutants. Cells expressing
28
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
CD6Cy135, CD6Cy179 and CD6FL showed two populations expressing different levels
of CD6 expression. E6.1CD6Cy5 lost CD6 expression and virus particles with this
mutant were used to re-infect E6.1 cells.
3.3. Sorting
To select cells expressing simultaneously similar levels of CD6 and CD3, we sorted
CD6+/CD3+ cells that were efficiently obtained and cultured (Figure 7).
Figure 7 – Flow cytometry analysis of cells labeled for CD3 and CD6. A) CD6-citrine expressing cells B) E6.1 cells
express CD3, labeled with Alexa-Fluor 647. C) Gate of CD3 and CD6 positive cells to be sorted. D) A 99% pure double
positive CD6/CD3 population was obtained.
3.4. Western-Blotting
The relative size of the CD6 mutant proteins was confirmed by Western Blot, using
CD6 mutant cell lysates (Figure 8).
In Figure 8-A, one can see that, as expected, E6.1 Jurkat cells do not show any
band since in these cells the levels of CD6 are minute. All other cells have a band
corresponding to the approximate size of the protein of each transfected mutant. In
Figure 8-B, E6.1 cells transfected with pHR-citrine without CD6 also shows no band,
29
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
as all CD6 expressed is the endogenous, and as said before, the levels are minute. No
band could be detected for the mutant CD6Cy70 and this is probably due to a technical
problem since one can see in Figure 8-A that this isoform is being expressed. WesternBlot analysis confirmed that each of the cell lines is expressing the CD6 mutant protein
with the expected size. In -B, some extra bands were detected concerning CD6Cy37
and CD6Cy179 isoforms probably corresponding to unspecific products. No bands
could be seen regarding CD6Cy5 isoform (Figure 8-B), which is not at all surprising
since, as said before for FACS analysis, E6.1 CD6Cy5 in culture loses CD6
expression.
Figure 8 - Western-Blot. A) Relative sizes CD6Cy37, CD6Cy70, CD6Cy135 and CD6FL proteins. B) Relative sizes of
CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy135, CD6Cy179 and CD6FL proteins.
3.5. Activation assays
Activation assays were performed to study the CD6 inhibitory role in early and late T
cell responses.
3.5.1. Calcium flux assays
Early response assays were based on calcium immediate release into the T
lymphocyte cytoplasm upon TCR/CD3 complex activation. Due to some technical
problems, we were not able to perform calcium assays using all the isoforms
simultaneously.
30
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
Figure 9 shows calcium flux analysis of five CD6 isoforms: CD6Cy5, CD6Cy37,
CD6Cy70, CD6Cy179 and CD6FL. There was an increase on calcium levels upon
activation for cells expressing the CD6Cy5, CD6Cy70 (Figure 9-A) and CD6Cy37
(Figure 9-B) isoforms. On the other hand, cells expressing CD6Cy179 isoform and
CD6 FL have no variation on calcium levels upon activation (Figure 9-B).
Regarding the ratios between the basal and the highest calcium levels of cells upon
activation calcium variation was higher on cells expressing CD6Cy5, and CD6Cy70,
and lower for cells expressing CD6Cy37. CD6DCy179 and CD6FL isoforms presented
almost no variation on calcium flux for the last two (Figure 9-C).
3.5.2. Interleukin-2 production
Late response activation assays were based on the production of IL-2 responsible
for T cell proliferation. Due to technical problems, we were not able to perform IL-2
assays using all isoforms simultaneously.
Levels of IL-2 were similar between all mutant cells when in a resting state (Figure
10-A). After PHA activation, cells expressing CD6Cy5 were the ones with a higher rate
of IL-2 production, followed by CD6Cy37, CD6Cy70, CD6Cy135, CD6FL and
CD6Cy179 (Figure 10-A).
As expected, IL2 levels were higher upon activation for all cells, except for
CD6Cy179. Regarding variation on the production of IL-2 between all mutants, cells
expressing CD6Cy5 and CD6Cy37 have the highest levels of IL-2, followed by
CD6Cy135, CD6 FL and CD6Cy70. In Figure 10-B), it is possible to see IL-2 variation
results given by the ratio between activated and resting cells. The CD6Cy5 isoform
presents the highest variation, followed by CD6Cy37, CD6Cy70, CD6Cy135 and finally
CD6FL and CD6Cy179 isoforms.
31
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
Figure 9 – A) Calcium flux levels upon activation of cells expressing CD6Cy5, CD6Cy70 and CD6Cy179 isoforms. The
CD6Cy5 isoform presents the highest levels on calcium flux followed by CD6Cy70 isoform. The CD6Cy179 isoform
presents no calcium flux. B) Calcium flux variation upon activation of cells expressing CD6Cy37, CD6Cy179 and CD6FL
isoforms. The CD6Cy37 isoform is the only isoform that presents significant calcium flux, since CD6Cy179 and CD6FL
present none. C) Ratio of calcium variation upon activation of cells expressing CD6Cy5, CD6Cy37, CD6Cy70,
CD6Cy179 and CD6FL isoforms.
32
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
Figure 10 – ELISA assay results. In the vertical axis are represented the values of concentration in pg/ml. A) Analysis of
the IL-2 production on resting and PHA activated cells variation, concerning CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy135,
CD6Cy179 and CD6FL isoforms. B) Analysis of the IL-2 variation, calculated by the ratio between PHA activated cells
and resting cells, concerning CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy135, CD6Cy179 and CD6CFL isoforms.
33
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
4. Discussion
34
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
The inhibitory role of CD6 has been assigned to its cytoplasmic tail [6]. To map
within CD6 cytoplasmic tail the region/motif responsible for its inhibitory role in T cell
activation, we have created E6.1 cells lines stably expressing CD6 isoforms of
variable tail lengths to perform activation assays.
We have used a specific clone of Jurkat cells, E6.1, since the expression of CD6
in these cells is minute and thus there is no interference of endogenous CD6 in our
experiments. CD6 expression in these cells belongs solely to our constructs.
My work consisted of making E6.1 Jurkat cell lines expressing each of the
different CD6 isoforms alone by lentiviral infection. This method was chosen among
other techniques of transfection due to its high efficiency and because it allows the
production of stable cell lines rather than transient ones. Yet, obtaining stable cells
lines was not that straightforward since we had to deal with different technical
problems. Lentiviral infection was indeed efficient, but as not all the cells were
infected, and in order to avoid two different populations, sorting was necessary at all
times. This proved to be laborious and time consuming since few cells could be
recovered after sorting and for most of the isoforms, cells needed a long time to
recover. In spite of all these drawbacks, cells were expressing the correct protein
isoforms, as confirmed by western blot analysis.
After sorting, CD6 expression levels were higher, as intended. Despite that, some
of the cell lines were losing CD6 expression over time, a fact that we cannot explain.
Frequent alterations on the levels of CD6 expression brought the need to constantly
evaluate cell lines for CD6 expression, before performing activation experiments.
Cells expressing CD6Cy5 presented two different populations with different CD6
expression levels, and overtime they ended up losing all CD6 expression at the
surface. We suggest that this might be due to the very small size of the cytoplasmic
tail of this isoform - five amino acids -, that might prevent the protein from being
properly anchored to the membrane.
Not all cells lines were expressing the CD3 receptor at good levels, and this
could interfere with activation of the cells, since we have used an anti-CD3 mAb for
activation. In fact, at some point some cells showed no CD3 expression at all. To
overcome this problem, all cells were selected and sorted based on both CD6-citrine
and CD3 expression at similar levels.
35
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
Upon triggering of the CD3 molecule, which is coupled to the TCR, a
considerable amount of calcium is immediately released into the cytoplasm of T
lymphocytes. As an early response in T cell activation, calcium has been studied
over the years. First studies concerning the inhibitory role of CD6 suggest that the
N-terminal region of its cytoplasmic tail played a critical role on calcium flux.
According to Kobarg et al. [89], CD6 isoforms lacking the region close to the
transmembrane domain showed an increase on calcium flux when compared with
the FL form of CD6 [89]. In human cells, upon CD3 triggering with mAbs, CD6 has
reduced calcium release as well as IL-2 production, a late indicator of T cell
responses known to lead T lymphocytes to proliferate. This study compared
intracellular calcium levels and IL-2 production in E6.1 Jurkat cells expressing
CD6FL and CD6Cy5 [6]. While the CD6FL was shown to attenuate early and late
responses, the CD6Cy5 isoform, featuring a very short cytoplasmic tail, was shown
to recover calcium levels and IL-2 production, thus attributing the inhibitory role to
the cytoplasmic tail.
Following the leads of the previous work from Oliveira et al., we performed
calcium assays on different CD6 mutants having different cytoplasmic tails. Due to
the frequent changes in the CD3, CD5 and CD6 expression levels over the time, we
were not able to perform calcium assays using all isoforms simultaneously.
As expected, isoforms with shorter cytoplasmic tails showed a higher increase on
calcium levels. Cells expressing CD6Cy5 and CD6Cy37 showed an increase similar
to CD6 negative cells. Concerning the CD6Cy5 isoform, results corroborate those
obtained previously by Oliveira et al. [6]. Yet, we remain unsure of their viability
since at the time of the experiment cells could have lost CD6 at the surface due to
its quite small cytoplasmic tail, and thus these cells behave as CD6 negative cells.
Worth to mention that previous studies, using CD6Cy5, were performed with cells
transiently expressing this isoform. We concluded that it is not possible to produce a
stable cell line expressing this isoform since the protein with such a small tail does
not anchor to the membrane for long periods of time.
Cells expressing CD6Cy70 also showed a pick of calcium release but the levels
were lower, meaning that these cells were less activated. On the other hand, cells
expressing CD6Cy179 and CD6 FL showed no variations on calcium flux upon CD3
stimulation, suggesting that the region between amino acids 70 and 179 of the
cytoplasmic tail is most likely the part containing the motif responsible for the CD6
inhibitory role.
36
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
We have compared calcium variations between all isoforms. The variation was
the highest for cells expressing CD6Cy5, which, as explained above, were probably
behaving as CD6 negative, being considered as a negative control, and results were
thus expected; levels of calcium release were then lower concerning CD6Cy37 and
CD6Cy70 isoforms, and almost null in cells expressing CD6Cy179 and CD6FL. As
mentioned before, these results suggest that the region responsible for the CD6
inhibitory role lies within middle region of the CD6 cytoplasmic tail. In this specific
region there are three tyrosine residues that might have a fundamental role in the
signaling through CD6. However, these experiments should be repeated since cells
expressing CD6Cy37 feature low levels of CD5, and this could interfere in the
inhibitory potential of the cells. When cells present a lower expression of CD5, CD6
potential of phosphorylating CD5 may suffer some changes. Thus, it might influence
our results and CD6 modulating activity [78]
Since we were interested in studying the whole response of CD6 in T cell
activation, we took advantage of a different activation assay concerning late
responses in T cells activation. Therefore we have looked into the IL-2 production
upon activation with phytohaemagglutinin (PHA).
As expected, resting cells presented, in general, lower IL-2 levels than activated
cells. Cells expressing CD6Cy179 isoform constitute the only exception since the IL2 levels on resting and activated cells are similar, suggesting that upon activation no
IL-2 variation was registered and that these cells were barely activated. Again, this
might occur due to the presence of the motif responsible for the inhibitory potential
upstream of this residue.
Since IL-2 levels of activated cells might be influenced by the basal levels of IL-2
obtained in resting cells, we found it more useful to measure the IL-2 variation
between resting and activated cells. A gradation of IL-2 levels was observed from
the shortest isoform CD6Cy5, followed by CD6Cy37, CD6Cy70 and CD6Cy135, and
ending with the lowest value, concerning the longest isoform CD6Cy179. The
CD6FL isoform produced, as expected, low levels of IL-2, corroborating with the fact
that CD6 in its full-length form is an inhibitor of T cell responses [6]. Cells expressing
CD6Cy5 always present the higher variation values, but we remain unsure about
data concerning the CD6Cy5 isoform, as explained before. Thereafter, we cannot
suggest that there was a significant decrease between CD6Cy5 and CD6Cy37.
However, it looks like the CD6Cy179 isoform presents the lowest IL-2 variation,
which, and corroborating the calcium results, may suggest that the critical motif
37
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
responsible for the inhibitory function of CD6 relies N-terminal of this region. Also,
except for the CD6FL isoform, it seems that the IL-2 variation is decreasing as the
cytoplasmic tail length increases.
From our results, it seems that the CD6Cy179 is the isoform per excellence
featuring no changes on both early and late activation assays and thereafter, it may
be considered as having the major critical role in the inhibitory potential of the CD6
cytoplasmic tail. Despite this, experiments should be repeated to confirm that results
were not influenced by lower CD5 expression levels.
38
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
5. Conclusion
39
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
We have evaluated early and late responses to activation of T cells expressing
different CD6 isoforms of different length cytoplasmic tails. According to our results,
the sequence between amino acids 70 and 179 of the cytoplasmic tail contain the
motif responsible for CD6 inhibitory potential. CD6Cy179 isoform inhibits T cell
activation the most, since no variation has been detected concerning early calcium
release and late IL-2 production upon activation. Moreover, it seems that the longer
the cytoplasmic tail, the higher the inhibitory potential of the CD6 molecule,
indicating that perhaps other motifs with a role in inhibition are present within the
cytoplasmic tail.
Although the CD6 cytoplasmic is devoid of intrinsic kinase activity, it contains
several motifs related to signal transduction, such as tyrosine residues. These
residues are phosphorylated upon activation that triggers the whole signaling
cascade translating in numerous events. In the future we aim to identify those exact
motifs and to understand how Src kinases, such as Lck and Fyn, and other proteins,
such as SLP-76 and Syntenin-1, might regulate CD6 function and further interfere
with CD6 negative modulation of T cell responses.
40
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
6. References
41
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
1. Shaw A. S., Dustin M. L.. “Making the T cell receptor go the distance: a topological
view of T cell activation”. Immunity 6, 361–369 (1997).
2. Grakoui A, Bromley SK, Sumen C, Davis MM, Shaw AS, Allen PM, Dustin ML. "The
immunological synapse: a molecular machine controlling T cell activation". Science 285
(5425): 221–227 (1999).
3. Medzhitov R. “Recognition of microorganisms and activation of the immune
response.” Nature.;449:819–826 (2007)
4. Pancer Z, Cooper MD. "The evolution of adaptive immunity". Annual Review of
Immunology 24 (1): 497–518 (2006).
5. Evans E. J., Hene L., Sparks L. M., Dong T., Retiere C., Fennelly J. A., MansoSancho R., Powell J., Braud V. M., Rowland-Jones S. L., McMichael A. J., Davis S. J.
Immunity 19, 213–223. (2003).
6. Oliveira MI, Gonçalves CM, Pinto M, Fabre S, Santos AM, et al. “CD6 attenuates
early and late signaling events, setting thresholds for T-cell activation.” Eur J Immunol
(42) 195–205 (2012).
7. Thomas J. Kindt, Richard A. Goldsby, Barbara A. Osborne, Janis. “Kuby Immunology.”
W. H. Freeman, 5th edition, chapter 1 (2007)
8. van der Merwe PA, Dushek O “Mechanisms for T cell receptor triggering.” Nat Rev
Immunol 11: 47–55. (2011).
9. Janeway CA Jr, Travers P, Walport M, et al. Immunobiology: The Immune System in
Health and Disease. 5th edition. Glossary: Garland Science (2001).
10. Davis M.M., Bjorkman P.J. “T-cell antigen receptor genes and T-cell recognition.”
Nature. 334:395–402 (1988).
11. Guy CS, Vignali DA. “Organization of proximal signal initiation at the TCR:CD3
complex”. Immunol Rev.; 232:7–21 (2009).
12. Wucherpfennig, K. W., Gagnon, E., Call, M. J., Huseby, E. S. & Call, M. E.
“Structural biology of the T-cell receptor: insights into receptor assembly, ligand
recognition, and initiation of signaling.” Cold Spring Harbor perspectives in biology 2,
a005140 (2010).
13. Altin, J. G. & Sloan, E. K. “The role of CD45 and CD45-associated molecules in T
cell activation”. Immunology and cell biology 75, 430–45 (1997).
14. Holmes, N. “CD45: all is not yet crystal clear”. Immunology 117, 145–55 (2006).
42
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
15. Zamoyska, R. “Why is there so much CD45 on T cells?” Immunity 27, 421–3 (2007).
16. Grochowy, G., Hermiston, M. L., Kuhny, M., Weiss, A. & Huber, M. “Requirement for
CD45 in fine-tuning mast cell responses mediated by different ligand-receptor systems”.
Cellular signalling 21, 1277–86 (2009).
17. Bridgeman, J. S., Sewell, A. K., Miles, J. J., Price, D. a & Cole, D. K. “Structural and
biophysical determinants of αβ T-cell antigen recognition.” Immunology 135, 9–18
(2012).
18. Singer A, Adoro S, Park JH. “Lineage fate and intense debate: myths, models and
mechanisms of CD4− versus CD8-lineage choice”. Nat Rev Immunol.; 8:788–801
(2008).
19. Barber EK, Dasgupta JD, Schlossman SF, et al. “The CD4 and CD8 antigens are
coupled to a protein-tyrosine kinase (p56lck) that phosphorylates the CD3 complex.”
Proc Natl Acad Sci U S A. 86:3277–3281 (1989).
20. Riha, P. & Rudd, C. E. CD28 co-signaling in the adaptive immune response.
Self/nonself 1, 231–240 (2010).
21. Egen, J. G. & Allison, J. P. “Cytotoxic T lymphocyte antigen-4 accumulation in the
immunological synapse is regulated by TCR signal strength”. Immunity 16, 23–35
(2002).
22. Chambers, C. “The expanding world of co-stimulation: the two-signal model
revisited”. Trends in immunology 22, 217–23 (2001).
23. Saito, T. & Yokosuka, T. “Immunological synapse and microclusters: the site for
recognition and activation of T cells”. Current opinion in immunology 18, 305–13 (2006).
24. Davis S. J., van der Merwe P. A. “Lck and the nature of the T cell receptor trigger.”
Trends Immunol. 32, 1–5 (2011).
25. Monks CR, Freiberg BA, Kupfer H, Sciaky N, Kupfer A “Three-dimensional
segregation of supramolecular activation clusters in T cells”. Nature 395: 82–86 (1998).
26. Bromley SK, Burack WR, Johnson KG, Somersalo K, Sims TN, et al. “The
immunological synapse”. Annu Rev Immunol 19: 375–396 (2001).
27. Alarcón, B., Mestre, D. & Martínez-Martín, N. “The immunological synapse: a cause
or consequence of T-cell receptor triggering?” Immunology 133, 420–5 (2011).
28. van der Merwe, P. A. & Davis, S. J. Immunology. “The immunological synapse - a
multitasking system”. Science (New York, N.Y.) 295, 1479–80 (2002).
43
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
29. González, P. a, Carreño, L. J., Figueroa, C. a & Kalergis, A. M. “Modulation of
immunological synapse by membrane-bound and soluble ligands”. Cytokine & growth
factor reviews 18, 19–31 (2007).
30.Varma R, Campi G, Yokosuka T, Saito T, Dustin ML. “T cell receptor-proximal signals
are sustained in peripheral microclusters and terminated in the central supramolecular
activation cluster”. Immunity;25:117–127 (2006).
31. Cochran, J. R., Aivazian, D., Cameron, T. O. & Stern, L. J. “Receptor clustering and
transmembrane signaling in T cells”. Trends in biochemical sciences 26, 304–10 (2001).
32. Dustin, M. L. & Chan, a C. “Signaling takes shape in the immune system”. Cell 103,
283–94 (2000).
33. Huang, J., Meyer, C. & Zhu, C. “T cell antigen recognition at the cell membrane”.
Molecular immunology 52, 155–64 (2012).
34. Choudhuri, K.; Kearney, A.; Bakker, T.R.; van der Merwe, P.A. “Immunology: How
do T cells recognize antigen?” Current biology: CB 15, R379–82 (2005).
35. Azevedo, Carlos, Livro de Biologia Celular: Chapter Alexandre M.Carmo. 4th
edittion LIDEL (2005)
36. Vilà JM, Padilla O, Arman M, Gimferrer I, Lozano F. “The scavenger receptor
cysteine-rich superfamily (SRCR-SF) Structure and function of group B members”.
Inmunologia 19:105–121
37. Martínez, V. G., Moestrup, S. K., Holmskov, U., Mollenhauer, J. & Lozano, F. “The
conserved scavenger receptor cysteine-rich superfamily in therapy and diagnosis”.
Pharmacological reviews 63, 967–1000 (2011).
38. Sarrias MR, Gronlund J, Padilla O, Madsen J, Holmskov U, Lozano F. “The
Scavenger Receptor Cysteine-Rich (SRCR) domain: an ancient and highly conserved
protein module of the innate immune system”. Crit Rev Immunol.24(1):1–37 (2004).
39. Sarrias MR, Farnós M, Mota R, Sánchez-Barbero F, Ibáñez A, et al. “CD6 binds to
pathogen-associated molecular patterns and protects from LPS-induced septic shock”.
Proc Natl Acad Sci USA 104: 11724–11729 (2007).
40. Vera, J.; Fenutría, R.; Canadas, O.; Figueras, M.; Mota, R.; Sarrias, M.R.; Williams,
D.L.; Casals, C.; Yelamos, J.; Lozano, F. “The CD5 ectodomain interacts with
conserved fungal cell wall components and protects from zymosan-induced septic
shock-like syndrome”. Proceedings of the National Academy of Sciences of the United
States of America 106, 1506–11 (2009).
44
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
41. Jones N. H., Clabby M. L., Dialynas D. P., Huang H. J., Herzenberg L. A.,
Strominger J. L. “Isolation of complementary DNA clones encoding the human
lymphocyte glycoprotein T1/Leu-1” Nature 323, 346–349. (1986).
42. Osorio, L. M., Garcia, C. A., Jondal, M. and Chow, S. C., “The anti-CD6 mAb, IORT1, defined a new epitope on the human CD6 molecule that induces greater
responsiveness in T cell receptor/CD3-mediated T cell proliferation.” Cell. Immunol.154:
123–133 (1994)
43. Casali P, Burastero SE, Nakamura M, Inghirami G, Notkins AL. Human lymphocytes
making rheumatoid factor and antibody to ssDNA belong to Leu-1+ B-cell subset.
Science. 236:77–81 (1997).
44. Carmo, A. M., Castro, M. A. A. and Arosa, F. A. “CD2 and CD3 associate
independently with CD5 and differentially regulate signaling through CD5 in Jurkat T
cells.” J. Immunol 163: 4238–4245 (1999).
45. Dennehy K. M., Ferris W. F., Veenstra H., Zuckerman L. A., Killeen N., Beyers A. D
“Determination of the tyrosine phosphorylation sites in the T cell transmembrane
glycoprotein CD5.” Int. Immunol. 13, 149–156. (2001).
46. Raab M., Yamamoto M., Rudd C. E. “The T-cell antigen CD5 acts as a receptor and
substrate for the protein-tyrosine kinase p56lck”.Mol. Cell. Biol. 14, 2862–2870 (1994).
47. Perez-Villar J. J., Whitney G. S., Bowen M. A., Hewgill D. H., Aruffo A. A., Kanner S.
B. “CD5 Negatively Regulates the T-Cell Antigen Receptor Signal Transduction
Pathway: Involvement of SH2-Containing Phosphotyrosine Phosphatase SHP-1” Mol.
Cell. Biol. 19, 2903–2912. (1999).
48. Van de Velde H., von Hoegen I., Luo W., Parnes J. R., Thielemans K. “The B-cell
surface protein CD72/Lyb-2 is the ligand for CD5.” Nature 351, 662–665 (1991).
49. Castro, M. A. A., Oliveira, M. I., Nunes, R. J., Fabre, S., Barbosa, R., Peixoto, A.,
Brown, M. H. et al. “Extracellular isoforms of CD6 generated by alternative splicing
regulate targeting of CD6 to the immunological synapse”. J. Immunol 178: 4351–4361
(2007).
50. Arman, M.; Calvo, J.; Trojanowska, M.E.; Cockerill, P.N.; Santana, M.; LópezCabrera, M.; Vives, J.; Lozano, F. “Transcriptional regulation of human CD5: important
role of Ets transcription factors in CD5 expression in T cells”. Journal of immunology
(Baltimore, Md. : 1950) 172, 7519–29 (2004).
51. Dennehy K. M., Broszeit R., Garnett D., Durrheim G. A., Spruyt L. L., Beyers A. D.
45
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
“Thymocyte activation induces the association of phosphatidylinositol 3-kinase and
pp120 with CD5.” Eur. J. Immunol. 27, 679–686. (1997).
52. Dennehy, K. M., Broszeit, R., Ferris, W. F. & Beyers, a D. “Thymocyte activation
induces the association of the proto-oncoprotein c-cbl and ras GTPase-activating
protein with CD5”. European journal of immunology 28, 1617–25 (1998).
53. Bamberger, M., Santos, A. M., Gonçalves, C. M., Oliveira, M. I., James, J. R.,
Moreira, A., Lozano, F. et al. “A new pathway of CD5 glycoprotein-mediated T cell
inhibition dependent on inhibitory phosphorylation of Fyn kinase. J. Biol. Chem. 286:
30324–303368 (2011).
54. Gimferrer, I., Calvo, M., Mittelbrunn, M., Farnos, M., Sarrias, M. R., Enrich, C., Vives,
J. et al., “Relevance of CD6-mediated interactions in T cell activation and proliferation.”
J. Immunol. 173: 2262–2270 (2004).
55. June C. H., Rabinovitch P. S., Ledbetter J. A. “CD5 antibodies increase intracellular
ionized calcium concentration in T cells.” J. Immunol. 138, 2782–2792. (1987).
56. Tarakhovsky A., Kanner S. B., Hombach J., Ledbetter J. A., Müller W., Killeen N.,
Rajewsky K. “A role for CD5 in TCR-mediated signal transduction and thymocyte
selection.” Science 269, 535\u2013537. (1995).
57. Azzam H. S., Grinberg A., Lui K., Shen H., Shores E. W., Love P. E. “CD5
expression is developmentally regulated by T cell receptor (TCR) signals and TCR
avidity.” J. Exp. Med. 188, 2301–2311 (1998).
58. Kamoun M, Kadin ME, Martin PJ, Nettleton J, Hansen JA. “A novel human T cell
antigen preferentially expressed on mature T cells and shared by both well and poorly
differentiated B cell leukemias and lymphomas”. J Immunol. Sep;127(3):987–991
(1981).
59. Aruffo, A., Bowen, M. A., Patel, D. D., Haynes, B. F., Starling, G. C., Gebe, J. A. and
Bajorath, J., “CD6-ligand interactions: a paradigm for SRCR domain function?”
Immunol. Today 18: 498–504. (1997).
60. Osorio, L. M., De Santiago, a, Aguilar-Santelises, M., Mellstedt, H. & Jondal, M.
“CD6 ligation modulates the Bcl-2/Bax ratio and protects chronic lymphocytic leukemia
B cells from apoptosis induced by anti-IgM”. Blood 89, 2833–41 (1997).
61. Singer NG, Fox DA, Haqqi TM, Beretta L, Endres JS, et al. “CD6: expression during
development, apoptosis and selection of human and mouse thymocytes”. Int Immunol.
14: 585–597 (2002).
46
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
62. Gonçalves C. M., Castro M. A., Henriques T., Oliveira M. I., Pinheiro H. C., Oliveira
C., Sreenu V. B., Evans E. J., Davis S. J., Moreira A., Carmo A. M. “Molecular cloning
and analysis of SSc5D, a new member of the scavenger receptor cysteine-rich
superfamily”. Molecular immunology 46, 2585–96 (2009).
63. Aruffo, A., Melnick, M. B., Linsley, P. S. and Seed, B., “The lymphocyte glycoprotein
CD6 contains a repeated domain structure characteristic of a new family of cell surface
and secreted proteins.” J. Exp. Med. 174 :949–952 (1991).
64. Robinson, W. H., Neuman de Vegvar, H. E., Prohaska, S. S., Rhee, J. W. & Parnes,
J. R. Human “CD6 possesses a large, alternatively spliced cytoplasmic domain”.
European journal of immunology 25, 2765–9 (1995).
65. Whitney GS, Starling GC, Bowen MA, Modrell B, Siadak AW, et al. “The membraneproximal scavenger receptor cysteine-rich domain of CD6 contains the activated
leukocyte cell adhesion molecule binding site.” J Biol Chem.270:18187–18190. (1995).
66. Swack JA, Mier JW, Romain PL, Hull SR, Rudd CE. “Biosynthesis and posttranslational modification of CD6, a T cell signal-transducing molecule”. J Biol Chem
Apr 15;266(11):7137–7143 (1991).
67. Bowen MA, Bajorath J, D’Egidio M, et al. “Characterization of mouse ALCAM
(CD166): the CD6-binding domain is conserved in different homologs and mediates
cross-species binding”. European journal of immunology 27, 1469–78 (1997).
68. Martinez2011 Wee, S., Schieven, G. L., Kirihara, J. M., Tsu, T. T., Ledbetter, J. A.;
Aruffo, A., “Tyrosine phosphorylation of CD6 by stimulation of CD3: augmentation by
the CD4 and CD2 coreceptors.” J. Exp. Med. 177 :219–223 (1993).
69. Bowen, M. A., Patel, D. D., Li, X., Modrell, B., Malacko, A. R., Wang, W. C.,
Marquardt, H. et al. “Cloning, mapping, and characterization of activated leukocyte-cell
adhesion molecule (ALCAM), a CD6 ligand.” J. Exp. Med. 181: 2213–2220 (1995).
70. Gimferrer, I., Farnós, M., Calvo, M., Mittelbrunn, M., Enrich, C., Sanchez-Madrid, F.,
Vives, J. and Lozano, F “The accessory molecules CD5 and CD6 associate on the
membrane of lymphoid T cells”. The Journal of biological chemistry 278, 8564–71
(2003).
71. Padilla O, Calvo J, Vilà JM, et al. “Genomic organization of the human CD5 gene”.
Immunogenetics. 51(12):993–1001. (2000).
72. Arman M, Aguilera-Montilla N, Mas V, Puig-Kröger A, Pignatelli M, Guigó R, Corbí
47
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
AL, Lozano F. “The human CD6 gene is transcriptionally regulated by RUNX and Ets
transcription factors in T cells”. Molecular immunology 46, 2226–35 (2009).
73. Alonso-Ramirez, R. Loisel S, Buors C, Pers JO, Montero E, Youinou P,
Renaudineau Y. “Rationale for Targeting CD6 as a Treatment for Autoimmune
Diseases”. Arthritis 2010, 130646 (2010).
74. Tung, J. W., Kunnavatana, S. S. & Herzenberg, L. A. “The regulation of CD5
expression in murine T cells”. BMC molecular biology 2, 5 (2001).
75. Bott, C. M., Doshi, J. B., Morimoto, C., Romain, P. L. & Fox, D. A. “Activation of
human T cells through CD6: functional effects of a novel anti-CD6 monoclonal antibody
and definition of four epitopes of the CD6 glycoprotein”. International immunology 5,
783–92 (1993).
76. Osorio, L. M., Rottenberg, M., Jondal, M. & Chow, S. C. “Simultaneous cross-linking
of CD6 and CD28 induces cell proliferation in resting T cells”. Immunology 93, 358–65
(1998).
77. Ibáñez A, Sarrias MR, Farnós M, Gimferrer I, Serra-Pagès C, Vives J, Lozano F.
“Mitogen-activated protein kinase pathway activation by the CD6 lymphocyte surface
receptor”. Journal of immunology 177, 1152–9 (2006).
78. Castro, M. A. A., Nunes, R. J., Oliveira, M. I., Tavares, P. A., Simões, C.,Parnes, J.
R., Moreira, A. and Carmo, A.M. “OX52 is the rat homologue of CD6: evidence for an
effector function in the regulation of CD5 phosphorylation”. Journal of leukocyte biology
73, 183–90 (2003).
79. Hassan, N. J., Barclay, a N. & Brown, M. H. “Optimal T cell activation requires the
engagement of CD6 and CD166”. European journal of immunology 34, 930–40 (2004)
80. Bowen, M. A. & Aruffo, A. A. “Cell Surface Receptors and Their Ligands: In Vitro
Analysis of CD6-CD166 Interactions”. 428, 420–428 (2000).
81. Bowen MA, Whitney GS, Neubauer M, Starling GC, Palmer D, Zhang J, Nowak NJ,
Shows TB, Aruffo A. “Structure and chromosomal location of the human CD6 gene:
detection of five human CD6 isoforms.” Journal of Immunology. 158(3):1149–1156
(1997).
82 Patel, D.; Wee, S-F; Whichard, L.P.; Bowen, M.A.; Pesando, J.M.; Aruffo, A.; Haynes,
B.F. “Identification and characterization of a 100-kD ligand for CD6 on human thymic
epithelial cells”. Journal of Experimental Medicine. 181(4):1563–1568. (1995).
83. Bowen, M.A. & Aruffo, A. “Adhesion molecules, their receptors, and their regulation:
48
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
analysis of CD6-activated leukocyte cell adhesion molecule (ALCAM/CD166)
interactions”. Transplantation proceedings 31, 795–6 (1999).
84. Nair, P.; Melarkode, R.; Rajkumar, D.; Montero, E. “CD6 synergistic co-stimulation
promoting proinflammatory response is modulated without interfering with the activated
leucocyte cell adhesion molecule interaction”. Clinical and experimental immunology
162, 116–30 (2010).
85. Zimmerman A.W.; Joosten B.; Torensma R.; Parnes J.R.; van Leeuwen F.N.; Figdor
C.G.. “Long-term engagement of CD6 and ALCAM is essential for T-cell proliferation
induced by dendritic cells”. Blood 107, 3212–20 (2006).
86. Hassan N.J., Simmonds S.J., Clarkson N.G., Hanrahan S., Puklavec MJ, Bomb M,
Barclay AN, Brown M.H. “CD6 regulates T-cell responses through activation-dependent
recruitment of the positive regulator SLP-76.” Molecular and cellular biology 26, 6727–
38 (2006).
87. Starling G.C.; Whitney G.S.; Siadak A.W.; Llewellyn M.B.; Bowen M.A.; Farr A.G.;
Aruffo A.A. “Characterization of mouse CD6 with novel monoclonal antibodies which
enhance the allogeneic mixed leukocyte reaction”. European journal of immunology 26,
738–46 (1995).
88. Gangemi, R.M.; Swack, J.A.; Gaviria, D.M.; Romain, P.L. “Anti-t12, an anti-cd6
monoclonal antibody, can activate human T lymphocytes”. J. Immunology 143: 2439–
2447 (1989).
89. Kobarg, J; Whitney, G.S.; Palmer, D.; Aruffo, A.; Bowen, M.A. Analysis of the
tyrosine phosphorylation and calcium fluxing of human CD6 isoforms with different
cytoplasmatic domains. European Journal of Immunology. 27(11):2971–2980 (1997).
90. Pawlik, A.; Ostanek, L.; Brzosko, I.; Brzosko, M.; Masiuk, M. et al. The expansion of
CD4+CD28- T cells in patients with rheumatoid arthritis. Arthritis research & therapy 5,
R210–3 (2003).
91. Levesque, M.C.; Heinly, C.S.; Whichard, L.P.; Patel, D.D. “Cytokine-regulated
expression of activated leukocyte cell adhesion molecule (CD166) on monocytelineage cells and in rheumatoid arthritis synovium”. Arthritis and Rheumatism.
1998;41(12):2221–2229.
92. Ramos-Casals M, Cervera Segura R. Sjögren syndrome and hepatitis C virus:
casual or etiopathogenic relationship. Rev Clin Esp 2001;201:515-7 (2001).
93. Kung PC, Goldstein G, Reinherz EL, Schlossman SF. Monoclonal antibodies
defining distinctive human T cell surface antigens. Science 206: 347-9 (1979)
49
FCUP
Mapping the inhibitory determinants within of the cytoplasmic tail of CD6
94. Clark SJ, Law DA, Paterson DJ, Puklavec M, Williams AF. Activation of rat T
lymphocytes by anti-CD2 monoclonal antibodies. J Exp Med. 167:1861–1872 (1998)
50