Download The RNA-binding protein HuR regulates protein nuclear import

© 2016. Published by The Company of Biologists Ltd.
The RNA-binding protein HuR regulates protein nuclear import
Wei Zhang1, Amanda C. Vreeland1, and Noa Noy1,2*
1
Department of Cellular & Molecular Medicine, Lerner Research Institute, Cleveland Clinic
Foundation, and 2Department of Nutrition, Case Western Reserve University School of
Medicine, Cleveland, Ohio
*Correspondence: Noa Noy, Department of Cellular & Molecular Medicine, Lerner Research
Institute, Cleveland Clinic, 9500 Euclid Ave./NC10, Cleveland, OH 44195, USA. Tel: 216444-8423; E. Mail: [email protected]
Keywords: HuR, RNA stability, nuclear import, retinoic acid, cellular retinoic acid-binding
protein, NFκB
This manuscript reveals that an RNA-binding protein plays a key role in a novel mechanism
for regulation of protein nuclear import.
JCS Advance Online Article. Posted on 8 September 2016
Journal of Cell Science • Advance article
Summary statement
Abstract
The RNA-binding protein HuR binds to AU-rich elements in target mRNAs and stabilizes
them against degradation. The complete spectrum of genes whose expression is regulated by
HuR and thus the basis for the broad range of cellular functions of the protein are
incompletely understood. We show that HuR controls the expression of multiple components
of the nuclear import machinery. Consequently, HuR is critical for the nuclear import of
cellular retinoic acid-binding protein 2 (CRABP2), which delivers RA to the nuclear receptor
RAR and whose mobilization to the nucleus is mediated by a ‘classical-like’ nuclear
localization signal (NLS). HuR is also required for heregulin-induced nuclear translocation of
the NFκB subunit p65, which contains both classical and non-canonical NLS. HuR thus
regulates the transcriptional activities of both RAR and NFκB. The observations reveal that
Journal of Cell Science • Advance article
HuR plays a central role in regulating protein nuclear import.
Introduction
One of the best characterized RNA binding proteins in animals is HuR (encoded for by
Elavl1), a ubiquitously-expressed member of the embryonic lethal abnormal vision
(ELAV)/Hu family of RNA-binding proteins. In the nucleus, HuR is involved in various
functions including RNA splicing and nuclear export. In the extra-nuclear compartment, HuR
is associated with polysomes where it binds AU-rich elements (ARE) in 3’UTR regions of
target transcripts and protects them against degradation (Brennan and Steitz, 2001; Chen et
al., 2002; Hinman and Lou, 2008; Lebedeva et al., 2011; Lopez de Silanes et al., 2004;
Mukherjee et al., 2011; Myer et al., 1997). By stabilizing target mRNAs, HuR is involved in
key biological processes including cell-cycle progression, apoptosis, immune function,
inflammation, and oncogenic activities (Abdelmohsen and Gorospe, 2010; Ghosh et al., 2009;
Gupta et al., 2012; Hinman and Lou, 2008; Lebedeva et al., 2011).
We recently discovered that transcript stabilization by HuR is aided by cellular
retinoic acid-binding protein 2 (CRABP2) (Vreeland et al., 2014b). The best understood
function of CRABP2 is its ability to shuttle retinoic acid (RA) from the cytosol to the nucleus
where it directly delivers it to the nuclear receptor RAR and thereby promotes its
transcriptional activities (Budhu and Noy, 2002; Donato et al., 2007; Dong et al., 1999;
in the absence of RA, CRABP2 binds to HuR and dramatically increases its RNA-binding
affinity. Consequently, CRABP2 enhances the stability and upregulates the levels of various
HuR target transcripts (Vreeland et al., 2014b). Binding of RA triggers dissociation of
CRABP2 from HuR as well as activates a nuclear localization signal (NLS) allowing it to
mobilize to the nucleus where it delivers RA to RAR. Our observations further showed that
the well-established anti-carcinogenic activity of CRABP2 is mediated both by its ability to
activate RAR, leading to induction of anti-proliferative RAR target genes (Budhu et al., 2001;
Journal of Cell Science • Advance article
Manor et al., 2003; Schug et al., 2007; Sessler and Noy, 2005). Surprisingly, we found that,
Donato and Noy, 2005; Donato et al., 2007; Manor et al., 2003) and by cooperation with HuR,
resulting in stabilization of anti-oncogenic HuR target mRNAs (Vreeland et al., 2014a;
Vreeland et al., 2014b). Interestingly however, we found that reducing the expression level
of HuR not only abolished the ability of CRABP2 to upregulate HuR target transcripts but
also inhibited the transcriptional activity of RAR (Vreeland et al., 2014a). The additional
observations that reducing the expression of HuR blocked the nuclear translocation of
CRABP2 provided a rationale and suggested that HuR may be involved in some aspects of
nuclear import (Vreeland et al., 2014a).
Proteins that localize to the nucleus contain nuclear targeting sequences that link them
to carrier proteins of the β-karyopherin (importinβ) superfamily. Linkage can be
accomplished by direct binding to an importinβ or it may be mediated by adaptor proteins
such as importinα (karyopherinα). The best characterized nuclear targeting signal is the
classical nuclear localization sequence (NLS) recognized by an importinα which, in turn,
links the NLS-containing protein to importinβ1 (encoded for by Kpnb1) (Gorlich et al., 1995).
Classical NLSs are usually identifiable in the primary sequence of a protein as a series of
basic residues (Chook and Blobel, 2001; Hodel et al., 2001; Kalderon et al., 1984; Robbins
et al., 1991). We previously showed that CRABP2 contains an unusual variation of a classical
dimensional structure of the protein in response to RA-binding. Consequently, holo-CRABP2
is recognized by importinα1 (encoded for by Kpna2), enabling its ligand-induced nuclear
translocation (Sessler and Noy, 2005). Other importinβ proteins, such as transportin
1/importinβ2 (encoded for by Tnpo1), directly bind cargoes that contain a broad range of
“non-classical” NLSs characterized by a C-terminal sequence comprised of Arg separated
from a Pro-Tyr (PY) motif by 2–5 residues (Christie et al., 2015). An additional key
component of the nuclear import machinery is the small GTPase Ran. The activation state of
Journal of Cell Science • Advance article
NLS. Rather than existing in the primary sequence, this NLS is assembled in the 3-
Ran is determined by Ran guanine nucleotide exchange factor (RanGEF), which loads the
protein with GTP, and Ran GTPase-activating protein (RanGAP), which facilitates the
hydrolysis of Ran-bound GTP to GDP (Bischoff et al., 1994; Bischoff and Ponstingl, 1991;
Gorlich et al., 1996). GTP hydrolysis by Ran is also stimulated by the Ran binding protein
RanBP1 (Bischoff et al., 1995). Nuclear RanGEF and cytosolic RanGAP/RanBP1 thus form
a RanGDP/GTP gradient which allows cargo-loaded importins to release their cargo in the
nucleus, and to dissociate from Ran in the cytosol (reviewed in (Christie et al., 2015)).
Here we show that HuR regulates the expression of several components of the nuclear
import machinery and thus controls the nuclear localization of both CRABP2, which contains
a classical NLS, and the NFκB subunit p65, which contains both a classical and a noncanonical NLS. We show further that, while importinβ1 and RanBP1 are necessary for
nuclear import of CRABP2, they are dispensable for cross-cytosol trafficking that allows the
protein to accumulate at the nuclear membrane in response to RA.
Results
HuR mediates the endoplasmic reticulum localization of apo-CRABP2. HuR shuttles
between the nucleus and the cytosol but s predominantly nuclear in non-dividing cells (Fig.
(Cdk1) and inhibition of the kinase results in retention of HuR in the cytosol (Kim et al.,
2008). Indeed, a larger fraction of HuR was found in the extra-nuclear compartment in cells
treated with the Cdk1 inhibitor CGP-74514A (Fig. 2A). The cytosolic HuR extensively colocalized with the endoplasmic reticulum (ER) marker calnexin both in the absence and in the
presence of CGP-74514A (Fig. 1A), demonstrating that extra-nuclear HuR is associated with
the ER.
Journal of Cell Science • Advance article
1A). The cyto-nuclear shuttling of this protein is regulated by cyclin-dependent kinase 1
We previously reported that, in the absence of RA, CRABP2 localizes at the ER (Kim
et al., 2008). Considering that CRABP2 is highly soluble, this localization is likely mediated
by protein-protein interactions and not by interactions with the ER membrane. Taken
together, the observations that HuR is associated with the ER and can bind CRABP2
(Vreeland et al., 2014b) suggest that the ER localization of CRABP2 may be mediated by
HuR. To examine this possibility, a cell line derived from tumors that arose in a CRABP2null MMTV-neu mouse model of breast cancer (M2-/- cells, (Schug et al., 2008)) was used.
M2-/- lines that stably express shLuciferase (shCtrl) or shHuR were generated (Fig. 1B). Cells
were depleted of retinoids by culturing in charcoal-treated medium, and transfected with a
vector encoding Flag-tagged CRABP2. Parental cells and cells with reduced expression of
HuR were co-immunostained for Flag-CRABP2 and the ER marker calnexin (Fig. 1C). As
expected, CRABP2 colocalized with calnexin in parental cells, reflecting its ER association.
Notably, the co-localization was markedly reduced in cells with decreased expression of HuR
(Fig. 1C), suggesting that CRABP2 may be associated with the ER through interactions with
HuR.
HuR is required for RA-induced nuclear import of CRABP2. Upon binding RA,
within 30 min. of RA treatment ((Majumdar et al., 2011; Sessler and Noy, 2005) and Fig. 2A).
Strikingly, in M2-/- cells with stable reduced expression of HuR, RA induced a discernible
shift in the subcellular localization of CRABP2 but this shift did not culminate in nuclear
import. Instead, CRABP2 accumulated around the nucleus and did not enter this
compartment (Fig. 2A). Similar responses were observed in M2-/- cells in which HuR
expression was transiently reduced using two different shHuR (Fig. S1), validating that the
effect reflects reduction of HuR expression and not from off-target effects of the shRNA.
Journal of Cell Science • Advance article
CRABP2 dissociates from the ER and mobilizes to the nucleus, a process that is complete
MCF-7 mammary carcinoma cells, which express a high level of CRABP2, were used to
examine the involvement of HuR in the nuclear import of endogenous protein. MCF-7 cell
lines that stably express shCtrl or shHuR were generated (Fig. 2B). Cells were treated with
RA, immunostained for CRABP2, and imaged. Similarly to its behavior in M2-/- cells that
ectopically overexpress CRABP2, endogenous CRABP2 in parental MCF-7 cells underwent
nuclear translocation in response to RA. In contrast, in MCF-7 cells with reduced expression
of HuR, RA treatment resulted in accumulation of CRABP2 around the nucleus but, again,
failed to affect complete nuclear import (Fig. 2C). Fluorescence microscopy experiments
further showed that, in the presence of RA, CRABP2 displays extensive co-localization with
the nuclear membrane marker lamin B1 (Fig. 2D). Hence, HuR is not necessary for
mobilization of holo-CRABP2 to the nuclear membrane but is critical for enabling
translocation of the protein across this membrane into the nucleus.
HuR controls the nuclear import of CRABP2 in part by regulating the expression of
importin β1. Binding of RA to CRABP2 induces structural rearrangements that activate a
nuclear localization signal (NLS) recognized by importin α1 (Sessler and Noy, 2005). The
possibility that HuR regulates the nuclear import of CRABP2 by controlling importin
HuR did not affect the expression of importin α1 in either M2-/- (Fig. 3A) or MCF-7 cells (Fig.
3B). We further considered that nuclear import of importin α1 and its cargoes is known to
rely on an importin β such as importinβ1 (Chook and Blobel, 2001; Gorlich et al., 1995;
Hodel et al., 2001; Kalderon et al., 1984; Robbins et al., 1991). Examination of importin β1
(encoded for by the Kpnb1 gene) expression revealed that decreasing the expression of HuR
reduced the levels of both importin β1 protein (Fig. 3C, 3D, S2A, S2B) and Kpnb1 mRNA
(Fig. 3e). The possibility that HuR regulates importin β1 expression by stabilizing its mRNA
Journal of Cell Science • Advance article
α1expression was thus examined. The data showed however that decreasing the expression of
was then evaluated. M2-/- cells expressing shCtrl or shHuR were treated with transcription
inhibitor actinomycin D (2.5 µg/ml), and the rate of degradation of Kpnb1 mRNA was
monitored. The half-life of Kpnb1 mRNA was found to be 16.5±0.75 h. and 10.2±1.12 h. in
shCtrl and shHuR-expressing cells, respectively (Fig. 3F), indicating that this transcript is
indeed stabilized by HuR. The observations that downregulation of HuR did not affect the
stability of Gapdh mRNA (Fig. S2C) attested to the specificity of the response. Moreover,
ribonucleoprotin immunoprecipitation (RIP) assays showed that Kpnb1 mRNA coprecipitates with HuR protein (Fig. 3G). The observations thus demonstrate that HuR
modulates the level of importin β1 by binding and stabilizing its RNA.
The importin β1 inhibitor importazole (Soderholm et al., 2011) was used to evaluate
whether HuR controls the nuclear import of CRABP2 by governing the expression of
importin β1. M2-/- cells ectopically expressing Flag-CRABP2, were pre-treated with vehicle
or importazole (30 µM, 1h.) prior to treatment with RA. Similarly to the effect of
downregulation of HuR, importazole efficiently blocked the RA-induced nuclear
translocation of CRABP2 (Fig. 4). The effect of restoring the level of importin β1 in shHuRexpressing cells was then examined. Ectopic overexpression of importin β1 in these cells (Fig.
5A) enabled RA-induced nuclear translocation of CRABP2. However, completion of import
expressed importin β1 rescued the nuclear import of CRABP2 but did not fully restore the
kinetics of the process.
In the nucleus, CRABP2 delivers RA to the nuclear receptor RAR thereby promoting
its transcriptional activity. Transcriptional activation assays were carried out to examine
whether downregulation of HuR interferes with the activation of RAR and whether importin
β1 can rescue this inhibition. M2-/- cells stably expressing shCtrl or shHuR were transfected
with empty vector (ev) or vector encoding CRABP2 in the presence or absence of co-
Journal of Cell Science • Advance article
was delayed from 30 min. in parental cells (Fig. 2A) to 60 min. (Fig. 5B). Hence, ectopically
transfection of importin β1 (Fig. S3A). Cells were also transfected with a luciferase reporter
driven by an RAR response element (RARE) and a vector encoding β-galactosidase, which
served as transfection control. Cells were treated with RA (1 μM, overnight) and luciferase
activity measured and normalized to the activity of β-galactosidase (Fig. 5C, S3B). Ectopic
expression of CRABP2 or importin β1 alone enhanced the activation of RAR and expression
of both further promoted transactivation in parental cells. The transcriptional activity of RAR
was significantly lower in shHuR-expressing cells and was partially restored upon ectopic
expression of importin β1 and CRABP2. Effects on the expression level of the direct
endogenous RAR target gene Cyp26a1 were then examined. Cells were treated with RA (4 h.)
and Cyp26a1 mRNA measured by quantitative real-time PCR (Q-PCR) (Fig. 5D). Similarly
to the effects observed in transactivation assays, ectopic expression of CRABP2 or importin
β1 alone increased, and expression of both further increased Cyp26a1 expression. Cyp26a1
level was significantly lower in cells with reduced expression of HuR and, in contrast with
control cells, ectopic expression of CRABP2 alone had no effect on Cyp26a1 mRNA in these
cells. Overexpression of importin β1 partially restored Cyp26a1 levels and recovered the
effect of CRABP2. Taken together, the data indicate that importin β1 is necessary for the
nuclear import of CRABP2 and for transcriptional activation by RAR, and support the notion
level of expression of importin β1 protein.
Journal of Cell Science • Advance article
that HuR regulates these processes by controlling the stability of Kpnb1 mRNA and thus the
HuR regulates the expression of multiple components of the nuclear import machinery.
The observations that importin β1only partially rescued the nuclear import of CRABP2
suggest that additional factors involved in nuclear import are regulated by HuR.
Decreasing HuR levels decreased the level of mRNA for Ranbp1 (Fig. 6A) and the
half-life of Ranbp1 mRNA was found to be 8.25±1.16 h and 4.88±1.10 h in cells expressing
shCtrl and shHuR, respectively (Fig. 6B). Furthermore, RIP assays demonstrated that
Ranbp1 mRNA co-precipitates with HuR protein (Fig. 6C). Hence, HuR regulates
expression of RanBP1 by binding and stabilizing its mRNA. The ability of Ranbp1 to rescue
the impaired nuclear import of CRABP2 brought about by downregulation of HuR was then
examined. Ectopic expression of RANBP1 enabled RA-induced nuclear translocation of
CRABP2 although completion of the process was delayed from 30 min. following treatment
with RA in parental cells (Fig. 2A) to 60 min. (Fig. 6D). Interestingly, co-expression of
RANBP1 together with importin β1 restored the time course, allowing CRABP2 to complete
its nuclear translocation within 30 min. of RA treatment (Fig. 6D).
CRABP2 contains a “classical like” NLS and is mobilized to the nucleus by the
importin α1/importin β1 path. However, nuclear import of proteins may also be directly
mediated by an importinβ (Lee et al., 2006; Palmeri and Malim, 1999). For example, the
cargo proteins containing non-canonical NLS (Fridell et al., 1997). Moreover, some nuclear
proteins contain both classical and non-canonical NLS. One such protein is the NF-кB
subunit p65 which contains a classical NLS recognized by importinα5 (encoded for by Kpna1)
(Fagerlund et al., 2008) and a non-classical NLS recognized by transportin 1(Liang et al.,
2013). Downregulation of HuR decreased the level of mRNA for both Kpna1and Tnpo1 (Fig
7A), and RIP assays showed that both transcripts can be co-precipitated with HuR (Fig. 7B).
The half-life of Tnpo1 mRNA decreased from 6.6±0.51 to 4.16±0.26 h upon downregulation
Journal of Cell Science • Advance article
importinβ transportin 1 (encoded for by Tnpo1) can directly bind and mobilize to the nucleus
of HuR (Fig. 7C), while the half-life of Kpna1 mRNA was 25.67±4.51 and 9.63±1.89 h. in
parental and shHuR-expressing cells, respectively. Hence, HuR regulates the expression of
both genes by stabilizing their transcripts.
The NF-кB subunit p65 translocates to nucleus upon activation by various signals,
including the growth factor heregulin (Kannan-Thulasiraman et al., 2010). Heregulin (0.1
µg/ml, 30 min.) indeed induced nuclear translocation of p65 (Fig. 7D). Heregulin-induced
nuclear translocation of p65 was completely abolished in cells with decreased expression of
HuR and over-expression of importinα5 partially restored the import (Fig. 7D). In the nucleus,
p65 regulates the transcription of various proteins, including the fatty acid-binding protein
FABP5 (Kannan-Thulasiraman et al., 2010). The involvement of HuR in regulating the
transcriptional activity of p65 was examined by transactivation assays utilizing a luciferase
reporter driven by an 800-bp sequence of the proximal promoter of FABP5. The data showed
that while HRG-β1 activated the reporter in parental cells, decreasing the expression of HuR
completely abolished the response (Fig. 7E).
Discussion
The ability of HuR to stabilize target transcripts allows this RNA-binding protein to control
(Abdelmohsen and Gorospe, 2010; Ghosh et al., 2009; Hinman and Lou, 2008). However, the
complete spectrum of genes whose expression is regulated by HuR and thus the basis for the
broad range of cellular functions of the protein remain incompletely understood. We show
here that HuR plays a central role in regulating protein nuclear import. The data reveal that
HuR controls the expression of multiple components of the nuclear import machinery
including RANBP1, importinβ1/KPNB1, transportin 1, and importinα5/KPNA. In agreement,
it was previously reported that HuR binds to mRNA for both KPNB1 and TNPO1 mRNA
Journal of Cell Science • Advance article
biological processes ranging from cell growth and death to inflammatory responses
(Mukherjee et al., 2011). At least in the case of the former 3 proteins, HuR functions in this
capacity by enhancing the stability of their transcripts. Consequently, down-regulation of
HuR severely impaired the nuclear import of CRABP2, a protein that harbors a “classical-like”
NLS (Fig. 2) as well as of the NFκB subunit p65, which reaches the nucleus using both a
classical and a non-canonical NLS (Fig. 7). In both cases, ectopic supplementation of factors
that are lost in the absence of HuR either partially or almost completely ‘rescued’ nuclear
translocation. The control of nuclear import by HuR must have important consequences for
nuclear functions beyond the regulation of the nuclear translocation of CRABP2 addressed
here. Indeed, decreasing the expression of HuR not only interfered with the ability of
CRABP2 to promote the transcriptional activity of its cognate nuclear receptor RAR (Fig. 5C,
5D) but also significantly depressed the activity of the receptor in the absence of CRABP2
(Fig. 5C, 5D). As HuR appears to be critical for nuclear import mediated by different classes
of NLSs, its depletion must interfere with nuclear localization of multiple proteins, including
proteins that are necessary for transcriptional activity in general. The role of HuR in
regulating the nuclear import of such proteins, e.g. transcription factors, transcriptional
coregulators, and components of the general transcription machinery, remains to be explored.
We previously reported that, in the absence of RA, CRABP2 is not uniformly
that this localization is disrupted in cells with reduced level of HuR (Fig. 1B), indicating that
CRABP2 associates with the ER through its interactions with HuR. Notably, while the
nuclear translocation of CRABP2 was completely blocked in cells with reduced expression of
HuR, RA induced a discernible shift in the protein’s subcellular localization; RA-binding not
only triggered dissociation CRABP2 from the ER, reflecting dissociation of the CRABP2HuR complex (Fig. 1B), but also induced accumulation of the protein at the nuclear
membrane (Fig. 2d). The observations that modulation of HuR expression did not affect the
Journal of Cell Science • Advance article
distributed in cytosol but, instead, localizes at the ER (Majumdar et al., 2011). We show here
level of importinα1 (Fig. 3A, 3B) raise the possibility that this protein is sufficient to mediate
the movement of its cargo towards the nucleus even in the absence of a partner importinβ.
How CRABP2 travels to the nuclear surface under conditions that do not allow it to
translocate into this nucleus remains to be clarified.
Materials and Methods
Cells. We generated the M2-/- cell line from tumors that arose in MMTV- neu/CRABP2-null
mice (Schug et al., 2008). MCF7 cells were recently purchased from ATCC. Cell lines were
recently tested for contamination. Cells were maintained in Dulbecco’s modified Eagle’s
medium (DMEM) containing 4.5 g/liter of glucose, 4.5 g/liter of L-glutamine, 10% fetal
bovine serum (FBS; Life Technologies), 100 IU/ml of penicillin, and 100 µg/mL
streptomycin. Cell transfections were carried out using PolyFect (Qiagen).
Reagents. Retinoic acid (RA) was purchased from Calbiochem. Actinomycin D was from
Sigma-Aldrich. Antibodies against HuR (sc-5261; 1:1000 WB), β-actin (sc-57778; 1:1000
WB), karyopherin β1 (importin β1) (sc-1863; 1:1000 WB) and lamin B (sc-6217; 1:300 IF)
were from Santa Cruz Biotechnology, Inc. Antibody against KPNA2 (importin α1) (AB6036;
1:1000 WB) was from Abcam. Antibody against CRABP2 (1:1000 WB) was a gift from
Journal of Cell Science • Advance article
Cecile Rochette-Egly (IGBMC, Strasbourg, France).
Lentiviral shRNA production. pLKO.1 vectors harboring short hairpin RNAs (shRNAs) for
HuR (Elavl1, TRCN0000112085; Elavl1 TRCN0000112087; Elavl1 TRCN0000112088;
Mouse)(Elavl1, TRCN0000017275; Human) were from Open Biosystems; pLKO.1 vector
harboring luciferase shRNA (SHC007) or non-targeting shRNA (SHC002) was from SigmaAldrich. Using pCMV packaging vector and pMD2.G envelope vector, lentiviruses were
produced in HEK293T cells and target cells were infected using standard protocols and
selected by 5 µg/mL and 1 µg/mL puromycin for M2-/- cells and MCF-7 cells respectively. .
Real-time quantitative PCR (Q-PCR). Q-PCR was performed using a StepOnePlus realtime PCR system with the following TaqMan probes: Elavl1, Mm00516012_m1; Kpna1,
Mm00434700_m1; Kpnb1, Mm00434318_m1; Tnpo1, Mm00839059_g1;Tnpo2,
Mm00520392_m1; Ranbp1, Mm00650862_m1; Cyp26a1, Mm00514486_m1; and 18s rRNA
(4352930E, Applied Biosystems). Levels of mRNAs were normalized to 18s rRNA using the
threshold cycle (∆∆CT) method (Applied Biosystems technical bulletin no. 2)
Immunoblotting. Cells were lysed in a RIPA buffer containing 150 mM NaCl, 10 mM Tris,
pH 7.2, 0.1% SDS, 1% Triton X-100, 1% deoxycholate, and Halt protease inhibitor cocktail
(Thermo Scientific). Protein concentration was determined by the Bradford protein assay.
Cell lysates (50 µg protein) were resolved by SDS-PAGE and immunobloted using
Transactivation Assays. 5x104 cells were plated in 6-well plates in DMEM supplemented
with 10% charcoal-treated FBS. Cells were transfected with vectors harboring a luciferase
reporter driven by a RARE (RARE-Luc) and were co-transfected with an expression vector
for β-galactosidase, serving as transfection efficiency control. Cells were also co-transfected
with pSG5 vector encoding CRABP2 or pCMV-Sport6encoding importin β1. 24 h posttransfection, cells were treated with 1 μM RA or vehicle overnight. Luciferase activity was
Journal of Cell Science • Advance article
appropriate antibodies.
measured and corrected for transfection efficent by the activity of β-galactosidase as
previously described (Budhu et al., 2001).
Confocal fluorescence microscopy. Cells, cultured in DMEM containing 10% charcoaltreated FBS, were transfected with pCMV-3Tag-1 vector encoding Flag-CRABP2. Cells
were treated with RA or heregulin β1 as described in the text, fixed with 4%
paraformaldehyde in phosphatebuffered saline (PBS), and permeabilized with 0.2% Triton X100. Endogenous CRABP2 in MCF-7 cells and Flag-tagged CRABP2 in M2-/- cells were
visualized by immunostaining. Antibodies: CRABP2 (Santa Cruz sc-10065; 1:300 IF), Flag
(Sigma-Aldrich F1804; 1:250 IF), calnexin (Sigma-Aldrich C4731; 1:300 IF), Alexa Fluor®
conjugated secondary antibodies (Invitrogen A11008, A11059, A11005; 1:1000 IF). MycDDK-pCMV- Entry vector encoding mKPNA1 and myc-His A-pCDNA3.1(+) vector
encoding mRanBP1 were used. Cells were imaged using a PerkinElmer UltraVox spinning
disk confocal microscope. The analysis of images were done by Fiji-Image J and OfficePowerPoint.
Ribonucleoprotein immunoprecipitations were performed as previously described (Keene
and Tenenbaum, 2002; Vreeland et al., 2014b). Semi-quantitative PCR was performed using
the following primers: Kpnb1: forward: TGGCAAACCCAGGAAACAGT, reverse:
reverse:
Kpna1:
forward:
CCTGGTGCCATCTCCATGTT;
GCAGATGAGTCCAACCACGA,
reverse:
CGAGCGTCTCCCTCTTCGTA,
Ranbp1:
GCTTGACATCTCCAGTGCCT;
forward:
Tnpo1:
forward: GCTCGTCCCTTACCTTGCTT, reverse: TGTGGCAACAGACGAGAGAC.
Statistical analysis. Statistical significance of difference was analyzed by a Paired Student’s
T-test. Analyses were performed using SPSS 16.0 software.
Journal of Cell Science • Advance article
GCCCAACGTCTGCAAAACAT;
Acknowledgements
We thank Cecile Rochette-Egly (IGBMC, Strasbourg) for CRABP2 antibodies.
Author contributions
WZ designed and carried out experiments and contributed to the writing of the manuscript,
ACV designed and carried out experiments and contributed to the writing, NN conceived and
supervised the project, designed experiments, and wrote the manuscript.
Funding
This work was supported by NIH grants DK060684 and CA166955 to N.N. The work
utilized a confocal microscope that was acquired with National Institutes of Health SIG grant
Journal of Cell Science • Advance article
1S10OD019972-01.
Abdelmohsen, K. and Gorospe, M. (2010). Posttranscriptional regulation of cancer traits by
HuR. Wiley Interdiscip Rev RNA 1, 214-29.
Bischoff, F. R., Klebe, C., Kretschmer, J., Wittinghofer, A. and Ponstingl, H. (1994). RanGAP1
induces GTPase activity of nuclear Ras-related Ran. Proc Natl Acad Sci U S A 91, 2587-91.
Bischoff, F. R., Krebber, H., Smirnova, E., Dong, W. and Ponstingl, H. (1995). Co-activation
of RanGTPase and inhibition of GTP dissociation by Ran-GTP binding protein RanBP1. EMBO J 14,
705-15.
Bischoff, F. R. and Ponstingl, H. (1991). Catalysis of guanine nucleotide exchange on Ran by
the mitotic regulator RCC1. Nature 354, 80-2.
Brennan, C. M. and Steitz, J. A. (2001). HuR and mRNA stability. Cell Mol Life Sci 58, 266-77.
Budhu, A., Gillilan, R. and Noy, N. (2001). Localization of the RAR interaction domain of
cellular retinoic acid binding protein-II. J Mol Biol 305, 939-49.
Budhu, A. S. and Noy, N. (2002). Direct channeling of retinoic acid between cellular retinoic
acid-binding protein II and retinoic acid receptor sensitizes mammary carcinoma cells to retinoic
acid-induced growth arrest. Mol Cell Biol 22, 2632-41.
Chen, C. Y., Xu, N. and Shyu, A. B. (2002). Highly selective actions of HuR in antagonizing AUrich element-mediated mRNA destabilization. Mol Cell Biol 22, 7268-78.
Chook, Y. M. and Blobel, G. (2001). Karyopherins and nuclear import. Curr Opin Struct Biol
11, 703-15.
Christie, M., Chang, C. W., Rona, G., Smith, K. M., Stewart, A. G., Takeda, A. A., Fontes, M.
R., Stewart, M., Vertessy, B. G., Forwood, J. K. et al. (2015). Structural Biology and Regulation of
Protein Import into the Nucleus. J Mol Biol.
Donato, L. J. and Noy, N. (2005). Suppression of mammary carcinoma growth by retinoic
acid: proapoptotic genes are targets for retinoic acid receptor and cellular retinoic acid-binding
protein II signaling. Cancer Res 65, 8193-9.
Donato, L. J., Suh, J. H. and Noy, N. (2007). Suppression of mammary carcinoma cell growth
by retinoic acid: the cell cycle control gene Btg2 is a direct target for retinoic acid receptor signaling.
Cancer Res 67, 609-15.
Dong, D., Ruuska, S. E., Levinthal, D. J. and Noy, N. (1999). Distinct roles for cellular retinoic
acid-binding proteins I and II in regulating signaling by retinoic acid. J Biol Chem 274, 23695-8.
Fagerlund, R., Melen, K., Cao, X. and Julkunen, I. (2008). NF-kappaB p52, RelB and c-Rel are
transported into the nucleus via a subset of importin alpha molecules. Cell Signal 20, 1442-51.
Fridell, R. A., Truant, R., Thorne, L., Benson, R. E. and Cullen, B. R. (1997). Nuclear import of
hnRNP A1 is mediated by a novel cellular cofactor related to karyopherin-beta. J Cell Sci 110 ( Pt 11),
1325-31.
Ghosh, M., Aguila, H. L., Michaud, J., Ai, Y., Wu, M. T., Hemmes, A., Ristimaki, A., Guo, C.,
Furneaux, H. and Hla, T. (2009). Essential role of the RNA-binding protein HuR in progenitor cell
survival in mice. J Clin Invest 119, 3530-43.
Gorlich, D., Kostka, S., Kraft, R., Dingwall, C., Laskey, R. A., Hartmann, E. and Prehn, S.
(1995). Two different subunits of importin cooperate to recognize nuclear localization signals and
bind them to the nuclear envelope. Curr Biol 5, 383-92.
Gorlich, D., Pante, N., Kutay, U., Aebi, U. and Bischoff, F. R. (1996). Identification of
different roles for RanGDP and RanGTP in nuclear protein import. EMBO J 15, 5584-94.
Gupta, S., Pramanik, D., Mukherjee, R., Campbell, N. R., Elumalai, S., de Wilde, R. F., Hong,
S. M., Goggins, M. G., De Jesus-Acosta, A., Laheru, D. et al. (2012). Molecular determinants of
retinoic acid sensitivity in pancreatic cancer. Clin Cancer Res 18, 280-9.
Hinman, M. N. and Lou, H. (2008). Diverse molecular functions of Hu proteins. Cell Mol Life
Sci 65, 3168-81.
Journal of Cell Science • Advance article
REFERENCES
Journal of Cell Science • Advance article
Hodel, M. R., Corbett, A. H. and Hodel, A. E. (2001). Dissection of a nuclear localization
signal. J Biol Chem 276, 1317-25.
Kalderon, D., Roberts, B. L., Richardson, W. D. and Smith, A. E. (1984). A short amino acid
sequence able to specify nuclear location. Cell 39, 499-509.
Kannan-Thulasiraman, P., Seachrist, D. D., Mahabeleshwar, G. H., Jain, M. K. and Noy, N.
(2010). Fatty acid-binding protein 5 and PPARbeta/delta are critical mediators of epidermal growth
factor receptor-induced carcinoma cell growth. J Biol Chem 285, 19106-15.
Keene, J. D. and Tenenbaum, S. A. (2002). Eukaryotic mRNPs may represent
posttranscriptional operons. Mol Cell 9, 1161-7.
Kim, H. H., Abdelmohsen, K., Lal, A., Pullmann, R., Jr., Yang, X., Galban, S., Srikantan, S.,
Martindale, J. L., Blethrow, J., Shokat, K. M. et al. (2008). Nuclear HuR accumulation through
phosphorylation by Cdk1. Genes Dev 22, 1804-15.
Lebedeva, S., Jens, M., Theil, K., Schwanhausser, B., Selbach, M., Landthaler, M. and
Rajewsky, N. (2011). Transcriptome-wide analysis of regulatory interactions of the RNA-binding
protein HuR. Mol Cell 43, 340-52.
Lee, B. J., Cansizoglu, A. E., Suel, K. E., Louis, T. H., Zhang, Z. and Chook, Y. M. (2006). Rules
for nuclear localization sequence recognition by karyopherin beta 2. Cell 126, 543-58.
Liang, P., Zhang, H., Wang, G., Li, S., Cong, S., Luo, Y. and Zhang, B. (2013). KPNB1, XPO7
and IPO8 mediate the translocation ofNF-kappaB/p65 into the nucleus. Traffic 14, 1132-43.
Lopez de Silanes, I., Zhan, M., Lal, A., Yang, X. and Gorospe, M. (2004). Identification of a
target RNA motif for RNA-binding protein HuR. Proc Natl Acad Sci U S A 101, 2987-92.
Majumdar, A., Petrescu, A. D., Xiong, Y. and Noy, N. (2011). Nuclear translocation of
cellular retinoic acid-binding protein II is regulated by retinoic acid-controlled SUMOylation. J Biol
Chem 286, 42749-57.
Manor, D., Shmidt, E. N., Budhu, A., Flesken-Nikitin, A., Zgola, M., Page, R., Nikitin, A. Y.
and Noy, N. (2003). Mammary carcinoma suppression by cellular retinoic acid binding protein-II.
Cancer Res 63, 4426-33.
Mukherjee, N., Corcoran, D. L., Nusbaum, J. D., Reid, D. W., Georgiev, S., Hafner, M.,
Ascano, M., Jr., Tuschl, T., Ohler, U. and Keene, J. D. (2011). Integrative regulatory mapping
indicates that the RNA-binding protein HuR couples pre-mRNA processing and mRNA stability. Mol
Cell 43, 327-39.
Myer, V. E., Fan, X. C. and Steitz, J. A. (1997). Identification of HuR as a protein implicated in
AUUUA-mediated mRNA decay. EMBO J 16, 2130-9.
Palmeri, D. and Malim, M. H. (1999). Importin beta can mediate the nuclear impor of an
arginine-rich nuclear localization signal in the absence of importin alpha. Mol Cell Biol 19, 1218-1225.
Robbins, J., Dilworth, S. M., Laskey, R. A. and Dingwall, C. (1991). Two interdependent basic
domains in nucleoplasmin nuclear targeting sequence: identification of a class of bipartite nuclear
targeting sequence. Cell 64, 615-23.
Schug, T. T., Berry, D. C., Shaw, N. S., Travis, S. N. and Noy, N. (2007). Opposing effects of
retinoic acid on cell growth result from alternate activation of two different nuclear receptors. Cell
129, 723-33.
Schug, T. T., Berry, D. C., Toshkov, I. A., Cheng, L., Nikitin, A. Y. and Noy, N. (2008).
Overcoming retinoic acid-resistance of mammary carcinomas by diverting retinoic acid from
PPARbeta/delta to RAR. Proc Natl Acad Sci U S A 105, 7546-51.
Sessler, R. J. and Noy, N. (2005). A ligand-activated nuclear localization signal in cellular
retinoic acid binding protein-II. Mol Cell 18, 343-53.
Soderholm, J. F., Bird, S. L., Kalab, P., Sampathkumar, Y., Hasegawa, K., Uehara-Bingen, M.,
Weis, K. and Heald, R. (2011). Importazole, a small molecule inhibitor of the transport receptor
importin-beta. ACS Chem Biol 6, 700-8.
Vreeland, A. C., Levi, L., Zhang, W., Berry, D. C. and Noy, N. (2014a). Cellular retinoic acidbinding protein 2 inhibits tumor growth by two distinct mechanisms. J Biol Chem 289, 34065-73.
Journal of Cell Science • Advance article
Vreeland, A. C., Yu, S., Levi, L., de Barros Rossetto, D. and Noy, N. (2014b). Transcript
stabilization by the RNA-binding protein HuR is regulated by cellular retinoic acid-binding protein 2.
Mol Cell Biol 34, 2135-46.
Figures
Figure 1. HuR mediates the association of CRABP2 with endoplasmic reticulum. (A) M2-/cells were untreated (-) or treated with CGP74514A (2 µM, 2 h). The ER maker calnexin and
phenylindole (DAPI) to visualize nuclei. (B) Immunoblot demonstrating expression of HuR
in M2-/- cells stably expressing shRNAs targeting luciferase (shCtrl) or HuR (shHuR). (C)
M2-/- cell stably expressing shCtrl or shHuR were transiently transfected with a vector
encoding Flag-CRABP2. Flag-CRABP2 (red) and ER marker calnexin (green) were
immunostained and visualized using confocal microscopy. DAPI was used to visualize
nucleus.
Journal of Cell Science • Advance article
HuR were visualized by immunostaining. Cells were counterstained with 4ʹ, 6-diamidino-2-
Figure 2. HuR is required for RA-induced nuclear translocation of CRABP2. (A) M2-/- cells
stably expressing shCtrl or shHuR were cultured in delipidated medium and transfected with
vector encoding Flag-CRABP2. Flag-CRABP2 was immunostained in untreated cells and in
to visualize nuclei. (B) Immunoblot demonstrating expression of HuR in MCF-7 cells stably
expressing shCtrl or shHuR. (C) MCF-7 cells expressing shCtr or shHuR were cultured in
delipidated medium and treated with vehicle or RA for 30 min. Endogenous CRABP2 was
immunostained and visualized using confocal microscopy. DAPI was used to visualize
nucleus. (D) M2-/- cells stably expressing shHuR were transfected with a vector encoding
Flag-CRABP2 and treated with vehicle or RA. Flag-CRABP2 (red) and nuclear membrane
Journal of Cell Science • Advance article
cells treated with RA for 30 min. and visualized using confocal microscopy. DAPI was used
marker lamin B (green) were immunostained and visualized using confocal microscopy.
Journal of Cell Science • Advance article
DAPI was used to visualize nucleus.
Figure 3. HuR stabilizes importin β1/Knbp1 but not importin α1 mRNA . (A) (B)
Immunoblots of importin α1 in M2-/- (A) or MCF-7 (B) cells stably expressing shCtrl or
shHuR. (C) (D) Immunoblots of importin β1 in M2-/- (C) or MCF-7 (D) cells stably
expressing shCtrl or shHuR. (E) Levels of mRNA for importinβ1 in M2-/- cells stably
*p<0.05, paired Student’s T-test. (F) M2-/- cells stably expressing shCtrl or shHuR were
treated with actinomycin D (2.5 µg/ml). Levels of Knbp1 mRNA at various time points
following treatment were measured by Q-PCR. Data were normalized to corresponding
values at time zero. Data are Mean±SEM, n = 3 (n = 3). (G) HuR was immunoprecipitated
from M2−/− cells. Kpnb1 mRNA that co-precipitated with HuR was detected by semiquantitative PCR.
Journal of Cell Science • Advance article
expressing shCtrl or shHuR measured by Q-PCR and normalized to 18s. Mean±SD, n = 3.
Figure 4. The importinβ inhibitor importazole blocks nuclear import of CRABP2. M2-/- cells
were transfected with a vector encoding Flag-CRABP2. Cells were pretreated with
importazole (30 µM) for 1 hr. prior to treatment with RA. Flag-CRABP2 (red) was
nucleus.
Journal of Cell Science • Advance article
immunostained and visualized using confocal microscopy. DAPI was used to visualize
Figure 5. Importin β1 partially rescues the nuclear import of holo-CRABP2 in cells with
reduced expression of HuR. (A) Immunoblot demonstrating expression of importinβ1 in M2-/-
importin β1 (impβ1). (B) Cells were transfected with a vector encoding Flag-CRABP2 and
treated with vehicle or RA for denoted times. Flag-CRABP2 (red) was immunostained and
visualized using confocal microscopy. DAPI was used to visualize nucleus. (C)
Transactivation assays in denoted cells transfected with an ev or vector encoding CRABP2,
or importin β1, or both. Levels of proteins levels were assessed by immunoblots (Fig. S3A).
Cells were treated with RA and luciferase activity measured and normalized to βgalactosidase. Means±S.D. (n = 3). (D) Expression of the RAR target gene Cyp26a1 in
Journal of Cell Science • Advance article
cells stably expressing shHuR transfected with an empty vector (ev) or vector encoding
denoted cells transfected with an ev, vector encoding CRABP2, or importin β1, or both. Cells
were treated with RA for 4 h. and CYP26a expression measured by Q-PCR. Mean±S.E.M.,
Journal of Cell Science • Advance article
n=3. *p < 0.05, paired Student’s T-test.
Figure 6. Stabilization of Ranbp1 mRNA by HuR contributes to its ability to control the
shCtrl or shHuR measured by Q-PCR and normalized to 18s. Levels of mRNAs in shHuRexpressing normalized to shCtrl-expressing cells are shown. Mean±SD, n = 3. *p<0.05,
paired Student’s T-test. (B) Cells were treated with actinomycin D (2.5 µg/ml) and levels of
Ranbp1 mRNA at various time points were measured by Q-PCR. Data were normalized to
corresponding values at time zero. Mean±S.E.M, (n = 3). (C) HuR was immunoprecipitated
from M2−/− cells. Ranbp1 mRNA that co-precipitated with HuR was detected by semiquantitative PCR. (D) ShHuR-expressing M2-/- cells were transfected with a vector encoding
Journal of Cell Science • Advance article
nuclear import of CRABP2. (A) Levels of Ranbp1 mRNA in M2-/- cells stably expressing
Flag-CRABP2 in concert with a vector encoding RanBP1, or RanBP1 and importin β1. Cells
were treated with RA and Flag-CRABP2 (red) immunostained and visualized using confocal
Journal of Cell Science • Advance article
fluorescence microscopy. DAPI was used to visualize nuclei.
Figure 7. Stabilization of Tnpo1 and Kpna1 mRNA by HuR contributes to its ability to
control the nuclear import of p65. (A) Levels of mRNA for Tnpo1/importinβ1, Tnpo2, and
Kpna1/importin α5 in M2-/- cells stably expressing shCtrl or shHuR, measured by Q-PCR and
normalized to 18 s. Levels of mRNAs in shHuR-expressing cells normalized to cells
was immunoprecipitated from M2−/− cells. Tnpo1 and Kpna1 mRNAs that co-precipitated
with HuR were detected by semi-quantitative PCR. (C) Cells were treated with actinomycin
D (2.5 µg/ml) and levels of Tnpo1 (left) and Kpna1 (right) mRNAs at various time points
were measured by Q-PCR. Data were normalized to corresponding values at time zero.
Mean±S.E.M, (n = 3). (D) M2-/- cells stably expressing shCtrl or shHuR and shHuRexpressing cells transfected with a vector encoding importinα5 were treated with vehicle or
Journal of Cell Science • Advance article
expressing shCtrl are shown. Mean±SD, n = 3. *p<0.05, paired Student’s T-test. (B) HuR
heregulin-β1 (0.1 µg/ml) for 30 min. p65 was immunostained and visualized. DAPI was used
to visualize nucleus. (E) Transactivation assays in denoted cells transfected with a vector
harboring a luciferase reporter driven by 800 bp of the proximal promoter of FABP5. Cells
were serum starved and treated with vehicle or heregulin-β1 (HRG, 50 ng/ml, overnight) and
luciferase activity measured and normalized to β-galactosidase. Means±S.D. (n = 3), *p <
Journal of Cell Science • Advance article
0.05.
Figure S1. Transient down-regulation of HuR decreases the level of importin β1 and blocks the
nuclear import of CRABP2 (A) Immunoblot demonstrating downregulation of HuR in M2-/- cells
transiently expressing shLuciferase (shCtrl) or two different shHuR. (B) M2-/- cells transiently
expressing shLuc or two different shHuR were cultured in charcoal-treated medium and
transfected with vector encoding Flag-CRABP2. Cells were treated with RA for 30 min. and
Flag-CRABP2 was immunostained and visualized using confocal microscopy. DAPI was used to
visualize nucleus.
Journal of Cell Science • Supplementary information
J. Cell Sci. 129: doi:10.1242/jcs.192096: Supplementary information
J. Cell Sci. 129: doi:10.1242/jcs.192096: Supplementary information
Figure S2. (A) (Quantification of immunoblots showing decreased importinβ1 levels in M2-/cells stably expressing shCtrl or shHuR (Fig. 3C). (B) Quantification of immunoblots showing
M2-/- cells stably expressing shCtrl or shHuR were treated with actinomycin D (2.5 µg/ml).
Levels of GAPDH mRNAs at various time points were measured by Q-PCR. Data were
normalized to corresponding values at time zero. Data are Mean±SEM, n = 3. (D) M2-/- cells
stably expressing shHuR were transfected with a vector encoding Flag-CRABP2 and treated with
RA for 0 min. Flag-CRABP2 (red) and nuclear membrane marker lamin B (green) were
immunostained and visualized using confocal microscopy. DAPI was used to visualize nucleus.
Journal of Cell Science • Supplementary information
decreased importinβ1 levels in in MCF-7 cells stably expressing shCtrl or shHuR (Fig. 3D). (C)
J. Cell Sci. 129: doi:10.1242/jcs.192096: Supplementary information
Figure S3. (A) (B) Immunoblots demonstrating expression of CRABP2 and importin β1 in
Journal of Cell Science • Supplementary information
experiments described in Fig. 5C (A) and 5D (B).
Figure S1. Transient down-regulation of HuR decreases the level of importin β1 and blocks the
nuclear import of CRABP2 (A) Immunoblot demonstrating downregulation of HuR in M2-/- cells
transiently expressing shLuciferase (shCtrl) or two different shHuR. (B) M2-/- cells transiently
expressing shLuc or two different shHuR were cultured in charcoal-treated medium and
transfected with vector encoding Flag-CRABP2. Cells were treated with RA for 30 min. and
Flag-CRABP2 was immunostained and visualized using confocal microscopy. DAPI was used to
visualize nucleus.
Journal of Cell Science • Supplementary information
J. Cell Sci. 129: doi:10.1242/jcs.192096: Supplementary information
J. Cell Sci. 129: doi:10.1242/jcs.192096: Supplementary information
Figure S2. (A) (Quantification of immunoblots showing decreased importinβ1 levels in M2-/cells stably expressing shCtrl or shHuR (Fig. 3C). (B) Quantification of immunoblots showing
M2-/- cells stably expressing shCtrl or shHuR were treated with actinomycin D (2.5 µg/ml).
Levels of GAPDH mRNAs at various time points were measured by Q-PCR. Data were
normalized to corresponding values at time zero. Data are Mean±SEM, n = 3. (D) M2-/- cells
stably expressing shHuR were transfected with a vector encoding Flag-CRABP2 and treated with
RA for 0 min. Flag-CRABP2 (red) and nuclear membrane marker lamin B (green) were
immunostained and visualized using confocal microscopy. DAPI was used to visualize nucleus.
Journal of Cell Science • Supplementary information
decreased importinβ1 levels in in MCF-7 cells stably expressing shCtrl or shHuR (Fig. 3D). (C)
J. Cell Sci. 129: doi:10.1242/jcs.192096: Supplementary information
Figure S3. (A) (B) Immunoblots demonstrating expression of CRABP2 and importin β1 in
Journal of Cell Science • Supplementary information
experiments described in Fig. 5C (A) and 5D (B).