Download Phosphorus Partitioning of Soybean Lines Containing Different

Published February 6, 2013
O R I G I N A L R ES E A R C H
Phosphorus Partitioning of Soybean Lines Containing
Different Mutant Alleles of Two Soybean SeedSpecific Adenosine Triphosphate-Binding Cassette
Phytic Acid Transporter Paralogs
Jason D. Gillman, Ivan Baxter, and Kristin Bilyeu*
Abstract
(myo-inositol-1,2,3,4,5,6-hexa-kisphosphate) is a storage form of P in plant seeds. Monogastric animals (including humans, poultry, and swine)
lack sufficient levels of phytase to mobilize this P (Raboy,
2007b). In addition, the highly negative overall charge
of phytic acid causes it to spontaneously precipitate cationic species, including a number of critical micronutrients such as Fe2+ and Zn2+ (Raboy, 2002). Phosphorus is
an essential animal macronutrient, and feedstocks for
nonruminants are routinely supplemented with nonsustainable inorganic rock phosphate for optimal growth
and weight gain (Waldroup et al., 2000). In addition
to slightly increasing the cost of feed mixtures, excess
phosphate can accumulate in the environment due to use
of manures as a ready source of fertilizer (Raboy, 2002,
2007b). Unused P has the potential to accelerate eutrophication when released into fresh water streams and
lakes (Correll, 1998; Raboy, 2007a). In soybean, phytic
acid typically makes up the majority of the total seed P
(~72%) (Raboy et al., 1984) although this varies based on
the nutritional status of the maternal plant. The use of
seeds with lowered phytic acid in animal feed mixtures
has the potential to reduce or potentially eliminate the
need for supplementation with exogenous inorganic
phosphate (Raboy, 2007b) as well as increasing the bioavailability of critical micronutrients (Zhou et al., 1992).
HYTIC ACID
Seed phytate is a repository of P and minerals in soybean
[Glycine max (L.) Merr.] seeds that limits P and mineral
bioavailability for monogastric animals (e.g., humans, swine
[Sus scrofa], and poultry [especially chicken, Gallus domesticus])
due to insufficient digestive tract phytase activity. We previously
identified epistatic recessive mutations affecting two paralogous
adenosine triphosphate-binding cassette phytic acid transporter
genes (one a nonsense mutation in Lpa1 and the other a
missense mutation in Lpa2) as the molecular genetic basis in
the ethyl methanesulfonate (EMS)-induced mutant low phytate
soybean line M153. An additional mutant low phytate line,
M766, contained one single nucleotide polymorphism within the
ninth intron of the Lpa1 locus as well as a nonsense mutation in
Lpa2. The objectives of this research were to clarify the genetics
underlying the low phytate phenotype in line M766 and to
determine P partitioning in new combinations of mutant alleles
from M766 and M153. Inheritance of nonsense alleles affecting
both low phytic acid (Lpa) genes (one from M153 and one from
M766) led to the production of viable seeds that contained
transgressive reductions in total seed phytate and significantly
higher levels of inorganic phosphate than has been reported for
nontransgenic soybean material and will allow efficient molecular
selection of soybeans with even greater reductions of phytate for
improved quality soybean meal.
USDA-ARS, Univ. of Missouri-Columbia, 108 Waters Hall, Columbia,
MO 65211. Mention of a trademark, vendor, or proprietary product
does not constitute a guarantee or warranty of the product by the
USDA and does not imply its approval to the exclusion of other
products or vendors that may also be suitable. Received 12 June
2012. *Corresponding author ([email protected]).
Published in The Plant Genome 6.
doi: 10.3835/plantgenome2012.06.0010
© Crop Science Society of America
5585 Guilford Rd., Madison, WI 53711 USA
An open-access publication
All rights reserved. No part of this periodical may be reproduced or
transmitted in any form or by any means, electronic or mechanical,
including photocopying, recording, or any information storage and
retrieval system, without permission in writing from the publisher.
Permission for printing and for reprinting the material contained herein
has been obtained by the publisher.
THE PL ANT GENOME
P
„
M ARCH 2013
„
VOL . 6, NO . 1
Abbreviations: DNase, deoxyribonuclease; EMS, ethyl
methanesulfonate; HPLC, high performance liquid chromatography;
ICP-MS, inductively coupled plasma mass spectrometry; Lpa,
low phytic acid; MIPS, myo-inositol phosphate synthase; mRNA,
messenger ribonucleic acid; PA, phytic acid; PCR, polymerase chain
reaction; RT-PCR, reverse transcription polymerase chain reaction;
SNP, single nucleotide polymorphism.
1 of 10
For these reasons, there has been a great deal of
interest in both the applied goal of reducing the level of
phytic acid accumulation in seeds as well as elucidating
the biosynthetic pathways for phytic acid production. In
soybean, mutagenesis has been used to develop several
independent mutant lines (and in one case a spontaneously
occurring mutant) with significant reductions in phytic
acid content and a concomitant increase in bioavailable
inorganic phosphate (Hitz et al., 2002; Maroof and
Buss, 2011; Wilcox et al., 2000). Mutations affecting two
different classes of genes have identified as causative: (i) a
myo-inositol phosphate synthase (MIPS) gene (Hitz et al.,
2002; Maroof and Buss, 2011; Yuan et al., 2007) and (ii)
two phytic acid specific adenosine triphosphate-binding
cassette transporter paralogs, which have been named low
phytic acid (Lpa) genes (Gillman et al., 2009; Maroof and
Buss, 2011; Shi et al., 2007; Nagy et al., 2009). Deleterious
impacts on germination and/or field emergence have been
observed as consequences of the presence of either of these
two biochemically and genetically distinct sources of low
phytic acid soybean (Anderson and Fehr, 2008; Maupin
and Rainey, 2011; Meis et al., 2003). Unfortunately, the
variable environmental effect has so far precluded a
clear understanding of the physiological basis of the
germination defect, aside from being associated with the
presence of mutant alleles.
Mutations in a single MIPS gene result in modest
reductions in phytic acid content as compared to wildtype lines as well as an additional beneficial reduction in
indigestible raffinose family oligosaccharides (Hitz et al.,
2002). As such, mutations affecting MIPS would be the
more logical a priori target for breeding efforts. However,
MIPS mutant lines have higher levels of the antinutritional
compound phytic acid and less bioavailable P and feature
more significant germination defects as compared to Lpa
mutant lines (Maupin and Rainey, 2011). Indeed, complete
silencing of the MIPS gene has been shown to be embryo
lethal in soybean (Nunes et al., 2006).
In contrast, silencing of the soybean Lpa genes failed
to result in either embryo or seedling lethality in a large
number of transgenic events in maize (Zea mays L.) and
soybean (Shi et al., 2007), and the germination issues
appear to have a lower overall effect (Maupin and Rainey,
2011), which can at least partially be ameliorated by
appropriate genetic selection (Anderson and Fehr, 2008;
Spear and Fehr, 2007). Commercial cultivars with the
reduced phytic acid trait derived from mutant alleles of
the two Lpa genes are in the process of being developed
(Vince Pantalone, personal communication, 2012).
In our previous work (Gillman et al., 2009) we
identified a nonsense mutation in one Lpa paralog
(Glyma03g32500:lpa1-a) (for clarity of presentation in this
study, nonsense mutations will be indicated by presence of
bold type) and a missense R1039K substitution affecting
an ancestrally invariant residue within the second paralog
(Glyma19g35230:lpa2-a) in ethyl methanesulfonate
(EMS)-induced mutant line M153 (Wilcox et al., 2000).
M153 was later used to develop a partially adapted
2 of 10
breeding line CX1834 (Oltmans et al., 2004). Our genetic
analysis revealed a rational biochemical basis for the
duplicate dominant epistatic interaction, based on the
combination of two independent deleterious mutations
(one nonsense and one missense) in two of the genes
encoding Lpa paralogous genes (Gillman et al., 2009). We
also sequenced these genes in a “sister” low phytic acid
EMS-induced mutant line, M766, created in the same
mutagenesis experiment as M153/CX1834 (Wilcox et al.,
2000). The M766 version of the Glyma03g32500 Lpa1 gene
contained one single nucleotide polymorphism (SNP) in
intron 9 compared to the ‘Williams 82’ reference sequence
and is designated herein as lpa1-b (Gillman et al., 2009).
M766 bears a nonsense mutation in Glyma19g35230
(lpa2-b), which coincidentally affects the exact same codon
(R1039*; Fig. 1) as the missense mutation in M153. Thus,
the current collection of variant Lpa alleles is two null
alleles, one of lpa1-a from M153 and one of lpa2-b from
M766, one missense allele of lpa2-a from M153, and one
lpa1-b allele from M766 that does not differ in the coding
sequence from the reference Williams 82 allele but that
contains a single SNP within intron 9 of the gene.
In this study, we report on genetic analysis of F2 and
F3 progeny of two different crosses using the low phytate
EMS mutant line M766: (i) low phytate line TN09-239
(which possesses a nonsense lpa1-a mutation and a
missense lpa2-a mutation originally derived from M153)
× M766 (which contains the unique polymorphic allele
lpa1-b and a nonsense lpa2-b) and (ii) normal phytate
line Williams 82 × M766.
Materials and Methods
Population Development
M766 (lpa1-b/lpa2-b) (Wilcox et al., 2000) was crossed to
Williams 82 (Bernard and Cremeens, 1988) and TN09-239
during the summer of 2009. Williams 82 possesses typical levels of inorganic phosphate and phytic acid whereas
TN09-239 (lpa1-a/lpa2-a) is a BC4 low phytic acid line
developed by backcrossing CX18341-2 to ‘5601T’ (Pantalone
et al., 2003), which has been developed by Vince Pantalone
at the University of Tennessee. The F2 seed were produced
in a growth chamber with a day/night cycle of 28°C day
for 13.5 h followed by 22°C night for 10.5 h. Nutrients were
provided by Osmocote beads (Scotts Company). Putative
F1 plants were verified by lpa2-a/lpa2-b assays as previously
described (Gillman et al., 2009). For a subset of the verified
F1 plants, the F2 progeny seed from two plants (M766 × Williams 82; n = 65) or one plant (M766 × TN09-239; n = 63)
were harvested and lyophilized, and individual seeds were
ground with a mortar and pestle.
Additional F2 seed (from verified F1 plants) was
hand planted at the Bradford experimental field location
near Columbia, MO, in the spring of 2010 to produce F3
seed in a field environment. Leaf presses of the F2 plants
were made in the field with FTA cards (Whatman) for
DNA isolation and genotyping assays. Based on lpa1/
lpa2 marker analysis, a subset of F2 plants were selected
THE PL ANT GENOME
„
M ARCH 2013
„
VOL . 6, NO . 1
Figure 1. Details of the mutant alleles of LPA2. A) Cartoon representation of the Lpa2 gene, with exons indicated by dark boxes
and introns represented by lines. The predicted transcriptional start site is indicated by arrow. The position of codon 1039, which is
affected in both low phytic acid mutant lines CX1834 and/or M153 (missense) (light line) and M766 (nonsense) (asterisk), is indicated
by an arrow. B) Sequencing traces for a region surrounding codon 1039 in LPA2. In lines bearing the CX1834 and/or M153 allele
(lpa2-a) a missense mutation occurs (R1039K), and in lines bearing the M766 derived allele (lpa2-b) a nonsense mutation has occurred
(R1039STOP). WT, wild-type.
for further analysis. Seed from F2 or F3 plants were
harvested when pods were mature, and five F3 seed were
lyophilized and individually ground with a mortar and
pestle. Mature, lyophilized seed powder was subdivided
and used for three distinct analyses: (i) DNA isolation for
marker genotyping, (ii) determination of free inorganic
phosphate by Chen’s method (Gillman et al., 2009;
Wilcox et al., 2000), and (iii) inductively coupled plasma
mass spectrometry (ICP-MS) analysis to determine total
P and other ionomic constituents. The F3 seed was also
analyzed for phytic acid content by high performance
liquid chromatography (HPLC) (Chen and Li, 2003).
Determination of Available Inorganic Phosphate
of Soybean Seeds
Inorganic phosphate content was quantified for 10 to 30
mg of seed tissue as previously described (Gillman et al.,
2009; Wilcox et al., 2000).
Determination of Phytic Acid Content of F3
Soybean Seeds
Phytic acid (PA) P was quantified by modified HPLC
method (Chen and Li, 2003). Powdered seed samples
(0.025 g) were extracted 1 h by shaking at room temperature in 0.5 mL of 0.5 M HCl. After centrifugation for 15
min at 15,000 × g, supernatants were filtered through a
0.22-μm filter, and 100 μL of filtrate was analyzed. Phytic
acid P and inositol polyphosphate separations were
GI LL M AN ET AL .: SOYBEAN SEED PHOSPHO RUS PARTITI ON I N G
performed by a linear gradient elution program on a
Dionex CarboPac PA-100 guard column and a CarboPac
PA-100 analytical column (Dionex) on a Dionex ICS5000 Ion Chromatography System. The elution gradient
was effected by the following program: from start to 30
min ramping from 8 to 92% 0.5 M HCl, from 30 to 35
min running 92% 0.5 M HCl, then ramping down from
92 to 8% 0.5 M HCl during the next 0.1 min, and finishing for 4.9 min running at 92% 0.5 M HCl. A postcolumn
derivitization was achieved with a solution of 1 g L−1
Fe(NO3)3 in 0.33 M HClO4 using a 750-μL knitted coil
and was followed by detection of A295. Flow rates of eluent and postcolumn solution were 1.0 and 0.4 mL min−1,
respectively. The purified standard phytic acid (phytic
acid dipotassium salt; Sigma-Aldrich Corp.) was eluted at
30 min. Standard curves were calculated from dilutions
of PA standards. Results were converted to micrograms
phytic acid P per milligrams seed.
Determination of Soybean Seed Total Ionome
Powder was aliquoted into 16 by 100 mm Pyrex test tubes
and weighed. Digestion was performed by adding 2.5 mL
of concentrated HNO3 containing In internal standard
to the test tubes and incubating overnight at room temperature before heating the samples to 105°C over 2 h and
then cooling to room temperature over 2 h. The digested
samples were diluted in the test tubes to 10 mL by adding ultrapure water, and a second dilution was made in a
3 of 10
second set of test tubes by taking 900 μL of the first dilutions to 5 mL with ultrapure water. Then 1.2 mL of the
second dilutions was transferred to 96-well autosampler
plates using an adjustable-width multichannel pipette.
Elemental analysis was performed using an ICP-MS
(PerkinElmer Elan DRCe; PerkinElmer Inc.) with an Apex
Desolvation Nebulizer, FAST sampling valve, and SC4 DX
autosampler (Elemental Scientific Inc.). A liquid reference
material composed of pooled samples of soybean digests
was run every ninth sample to correct for ICP-MS withinrun drift. All samples were normalized to the recorded
weights.
DNA Isolation from Seeds
The DNA was isolated from approximately 20 μg of seed
tissue using a DNeasy kit (Qiagen, Inc.) and used in
genotyping assays at 5 to 50 ng per reaction.
M766 lpa1-b Marker Development
To track the lpa1-b allele in the Williams 82 × M766 segregating population, we developed a SimpleProbe assay
(Roche Applied Sciences) corresponding to a silent SNP
within intron 9 (T5202A relative to the start codon), which
was unique to M766 (Gillman et al., 2009). The M766 intron
T5202A SNP was detected through melting curve analysis
to measure the disassociation kinetics of a SimpleProbe oligonucleotide (Fluorescein-SimpleProbe chemistry-TTTCTGTTGCTTATTGCTGTTACTTTTTCAGTA-Phosphate)
designed to match the Williams 82 Glyma03g32500/LPA1
sequence (http://www.phytozome.net/soybean). Asymmetric polymerase chain reaction (PCR) using a 1:5 ratio
of primers (forward = ATCCTGGACGATCAACTTATGC
and reverse = GAGGGCGAGAATCTTCAATAAT) provided template for SimpleProbe binding. Asymmetric PCR
and melting curve analysis were performed as previously
described (Gillman et al., 2009) using a Lightcycler 480 II
instrument (Roche Applied Sciences).
lpa1-a and lpa2-a and/or lpa2-b
Genotyping Assays
Genotyping assays for M153 and/or CX1834-derived lpa1-a
and lpa2-a alleles were performed as previously described
(Gillman et al., 2009) using either DNA isolated from seed
tissue or using leaf extract punches from FTA cards (Whatman) according to manufacturer’s recommendations.
Examination of lpa1-b Messenger Ribonucleic
Acid Transcripts by Reverse Transcription
Polymerase Chain Reaction
Pods corresponding to two stages of seed fill (8–10 mm in
length and 10+ mm and fully expanded seeds) were collected from field grown plants of Williams 82, M766, and
the F2:3 line that recreated the lpa1-b/lpa2-b homozygote
mutant allele combination (line 6-8-31). Seeds were then
separated from pods before being flash frozen and ground
in liquid N2. Messenger ribonucleic acid (mRNA) was
extracted from approximately 50 mg seed powder using
4 of 10
the Trizol reagent (Invitrogen Corp.) and purified and
on-column deoxyribonuclease (DNase) treated using the
Direct-Zol RNA (ribonucleic acid) miniprep kit according
to manufacturer’s recommendations (Zymo Research).
Samples of 0.4 μg of DNase treated mRNA were used with
the SMARTScribe Reverse Transcriptase kit with a gene
specific primer located in exon 10 of Lpa1 (5′-GGAGGGCGAGAATCTTCAATAAT-3′) according to manufacturer’s
recommendations (Clontech Laboratories, Inc.), and
reverse transcription polymerase chain reaction (RT-PCR)
was performed using a SYBR green Quantitect PCR kit
according to manufacturer’s recommendations (Qiagen)
using a forward primer located in exon 9 (5′-TATTGTTAGCATACAGAAGTCTCCAAT-3′) and a reverse
primer located in exon 10 of Lpa1 (5′-GGAGGGCGAGAATCTTCAATAAT-3′) primers. Reverse transcription
PCR products were verified to be of appropriate size, purified using a Qiaquick PCR purification kit (Qiagen), and
Sanger sequenced at the DNAcore facility at the University
of Missouri. The resulting sequence traces were imported
into the Geneious software package (version 5.6) (Biomatters, 2012) and manually trimmed and aligned. To verify
the putative mixture of spliced and mispliced transcripts,
a fluorescently labeled version of the forward primer (carboxytetramethylrhodamine [TAMRA] 5′-TATTGTTAGCATACAGAAGTCTCCAAT-3′) was used in RT-PCR,
with amplification products purified as described previously, and diluted 1:15- and 1:50-fold before submission
to the DNAcore facility at the University of Missouri for
size fractionation. The exact sizes of RT-PCR products
were determined by comparison to a standard mixture of
size standards using the PeakScanner software package
(Applied Biosystems, 2006).
Results and Discussion
Development of Populations Segregating
for M766-Derived Alleles of LPA1 and LPA2
To investigate the roles of distinct alleles of the Lpa1
(Glyma03g32500) and Lpa2 (Glyma19g35230) genes in
different combinations, two populations were developed
by crossing the low phytic acid line M766 (lpa1-b/lpa2b) with the reference cultivar Williams 82 (Bernard and
Cremeens, 1988) and also with the low phytic acid line
TN09-239 (lpa1-a/lpa2-a) (Gillman et al., 2009). Wildtype and mutant alleles of Lpa1 and Lpa2 were segregating in the Williams 82 cross while only mutant alleles of
lpa1 and lpa2 were segregating when M766 was crossed
with TN09-239 (Fig. 1).
Sequence differences between wild-type and
mutant lpa genes enabled us to track alleles in the two
segregating populations. The M766 lpa1-b allele contains
a single polymorphism when compared to the reference
sequence for Williams 82, located within intron 9
(T5202A), which was used to develop a molecular marker
assay. We used a previously developed lpa2 molecular
marker assay that correctly distinguished wild-type
Lpa2 alleles from both the missense and the nonsense
THE PL ANT GENOME
„
M ARCH 2013
„
VOL . 6, NO . 1
Figure 2. Histograms displaying mean P phenotypes of F2 genotypic classes from the M766 × Williams 82 cross and comparison
to parental lines. The mean of the genotypic class for total seed P is indicated by the total height of the histogram and inorganic
phosphate P is indicated by light gray. One standard deviation from the mean is indicated by brackets. The nine possible genotypic
classes for LPA1/lpa1 and LPA2/lpa2 of F2 progeny from M766 × Williams 82 are indicated along with their number of samples (n),
and parental and control lines grown in the same growth chamber are included for reference. The allelic status of the lpa1 and lpa2
genes follows the convention that “T” indicates a functional allele derived from Williams 82 and “b” indicates the mutant allele derived
from M766, with the bold font representing the null allele of lpa2-b from M766. Pi, inorganic phosphate.
lpa2 alleles (lpa2-a and lpa2-b, respectively), and that is
also able to distinguish the two mutant alleles from each
other (Gillman et al., 2009).
Confirmed F1 seeds were germinated and
grown to maturity in a growth chamber. For initial
characterization of the P partitioning in the seed, the
F2 progeny of one or two plants from each cross was
destructively analyzed. Individual F2 seeds were ground
and subsampled for P phenotypes and genotyped for
lpa1/lpa2 on a seed-by-seed basis.
Evaluation of Genetic Loci that Influence Seed
Phosphate Concentration in M766
Based on previous results with M153 derived lines containing the lpa1-a and lpa2-a mutations (Gillman et al.,
2009), we predicted that the loss of function mutation
lpa2-b in M766 may reduce the phytic acid transporter
activity below the threshold necessary to produce a measurable P partitioning phenotype even in the presence of
functional versions of Lpa1. Alternately, the phytate reduction could be due to an epistatic effect of the lpa1-b allele
(containing a SNP within intron 9 [T5202A]) or due to an
uncharacterized cis-acting factor in the lpa1-b promoter
or enhancer. To evaluate if the lpa1-b allele was linked to
the low phytate phenotype, we crossed M766 to a line with
typical levels of phytic acid, Williams 82, and examined
F2 seeds for the phenotypic consequences of presence or
absence of alleles derived from M766 on seed P partitioning. We made the assumption that Williams 82 contained
functional alleles of Lpa1 and Lpa2. Only homozygosity for both the lpa1-b and lpa2-b alleles was found to be
associated with significantly elevated levels of inorganic
GI LL M AN ET AL .: SOYBEAN SEED PHOSPHO RUS PARTITI ON I N G
phosphate compared to the Williams 82 parent for the F2
seeds (Fig. 2). This finding is consistent with our previous
findings for CX1834 (Gillman et al., 2009). The necessity
for the combination of homozygous lpa1-b and lpa2-b
alleles for the high inorganic phosphate phenotype was
confirmed by examining the F3 progeny of an F2 selection
that was homozygous for the lpa2-b allele but was heterozygous for Lpa1 (Fig. 3). The F3 seeds containing the lpa2-b
alleles and one or two functional Lpa1 alleles contained
available phosphate levels just above the detection limit
of the assay. Seeds homozygous for the combination of
the lpa2-b alleles and the lpa1-b alleles had approximately
sevenfold more available phosphate, close to the level
achieved by M766 (Fig. 3; Supplemental Table S1).
Linkage of the lpa1-b allele with altered P
partitioning suggests it is not equivalent to a fully
functional allele. However, no changes in the coding
sequence or alterations to the promoter (within 240
bp upstream) were detected in the lpa1-b allele from
M766. We identified a single T > A SNP 7 bp upstream
of the start of exon 10 (Supplemental Fig. S1). Soft ware
prediction analysis (Hebsgaard et al., 1996) of this SNP
indicated the possibility that a cryptic splice site could
have been activated. The result would be the introduction
of five additional basepairs of intron sequence and a
frameshift mutation starting at exon 10. This hypothesis
proved correct, as a portion of transcripts from the
lpa1-b locus are mispliced (Supplemental Fig. S1 and S2).
The cryptic splice site is activated in only a subset of the
total lpa1-b transcripts (Supplemental Fig. S2), which
likely explains our finding that the lpa1-b allele is inferior
as a means of reducing the antinutritional compound
5 of 10
Figure 3. Histograms displaying P phenotypes of F2:3 selections from the M766 × Williams 82 cross and comparison to parental lines.
Each histogram represents the mean of the genotypic class although each seed was individually ground and subsampled for DNA
isolation and genotyping and P assays. Total seed P is indicated by the total height of the histogram, inorganic phosphate (Pi) P is
indicated by light gray, phytic acid (PA) P is indicated by dark gray, and the difference between total P minus PA P and Pi P (cellular P)
is indicated in gray. Parental lines grown in the same environment are included for reference.
phytic acid as compared to the nonsense lpa1-a mutation
found in M153 and/or CX1834 (Gillman et al., 2009).
Phosphate Partitioning in F2 Seeds from the Cross
of M766 × TN09-239
Although the combination of alleles found in M766
(lpa1-b and lpa2-b) is unlikely to be useful in breeding efforts for reducing seed phytic acid, we predicted
that the lpa2-b nonsense mutation in combination with
the lpa1-a nonsense mutation could increase inorganic
phosphate to a greater extent than possible in CX1834 or
derived lines (Gillman et al., 2009).
To address this possibility, a population of plants
was developed from the cross of TN09-239 × M766. F2
seeds produced in a growth chamber environment were
analyzed as described above and data from individual
seeds were grouped into appropriate genotypic classes for
statistical analysis (Fig. 4).
For the two wild-type soybean lines Williams 82 and
5601T, inorganic phosphate was virtually undetectable in
seeds. In contrast, both TN09-239 (bearing homozygous
mutant alleles lpa1-a and lpa2-a) and M766 (bearing
homozygous alleles of lpa1-b and the nonsense mutant
alleles of lpa2-b) possessed elevated inorganic phosphate:
1.63 ± 0.60 and 3.90 ± 0.24 μg P mg−1 seed, respectively.
Curiously, the seeds produced by TN09-239 line in
the growth chamber possessed a lower amount of
inorganic phosphate as compared to M766 as well as
slightly lower levels of total seed P (although this finding
was not statistically significant) as compared to M766
seeds (Fig. 4). This result was unexpected and may be
due to growing a maturity group V line in an artificial
environment optimized for the maturity group III lines
M766 and Williams 82.
6 of 10
We investigated the progeny of a cross between M766
and TN09-239 to assess the phenotypic consequences of
the combinations of the different mutant versions of lpa1
and lpa2. We had previously hypothesized (Gillman et
al., 2009) that the missense lpa2-a allele found in M153
and/or CX1834 might only impair functionality rather
than abolishing it. If this hypothesis was correct, then
the combination of two nonsense mutations affecting the
two independently inherited paralogous genes (lpa1-a
derived from M153 and/or CX1834 in conjunction with
lpa2-b from M766) could result in even higher levels of
available inorganic phosphate in seeds. The combination
of the lpa1-b allele from M766 with the lpa2-a allele from
CX1834 (lpa1-b/lpa2-a) resulted in accumulation of the
least available inorganic phosphate (1.88 ± 0.42 μg P mg−1
seed) among the mutant genotypic classes and the novel
homozygote combination of the two nonsense mutant
alleles, lpa1-a/lpa2-b, produced the highest available
inorganic phosphate of any of the samples examined
(5.39 ± 0.65 μg P mg−1 seed) although the relatively high
standard deviations precluded definitive conclusions
based solely on the F2 generation (Fig. 4). Previous
experiments with different germplasm sources of the
low phytate phenotype had consistently shown strong
negative correlations between the amount of P measured
in available phosphate and the amount of P measured in
phytate (Bilyeu et al., 2008; Gillman et al., 2009), so the
F2 experiments did not include phytate measurements.
Analysis of F3 Seeds from F2 Genotypic FieldGrown Selections
More comprehensive analyses were performed on field
produced F2:3 seeds derived from remnant F2 seeds from
the populations. Plants representing all of the possible
THE PL ANT GENOME
„
M ARCH 2013
„
VOL . 6, NO . 1
Figure 4. Histograms displaying mean P phenotypes of F2 genotypic classes from the M766 × TN09-239 cross and comparison
to parental lines. The mean of the genotypic class for total seed P is indicated by the total height of the histogram and inorganic
phosphate P is indicated by light gray. One standard deviation from the mean is indicated by brackets. The nine possible genotypic
classes for LPA1/lpa1 and LPA2/lpa2 of F2 progeny from M766 × TN09-239 are indicated along with their number of samples (n),
and parental and control lines grown in the same growth chamber are included for reference. The allelic status of the lpa1 and lpa2
genes follows the convention that “a” indicates a mutant allele derived from TN09-239 and “b” indicates the mutant allele derived from
M766, with the bold font representing the null alleles of lpa1-a from TN09-239 and lpa2-b from M766. Pi, inorganic phosphate.
homozygous genotypic combinations of lpa1 and lpa2
mutations (lpa1-a/lpa2-a, lpa1-a/lpa2-b, lpa1-b/lpa2a, and lpa1-b/lpa2-b) were selected and four or five F3
seeds from each plant were analyzed independently to
investigate three distinct seed P related traits: available
inorganic phosphate by colorimetric analysis, phytic acid
content by HPLC analysis, and total cellular P as determined by ICP-MS (Fig. 5; Supplemental Table S2).
Similar to the situation for growth chamber produced
seeds, free inorganic phosphate is present in trace, nearly
undetectable amounts for seeds from field-grown wildtype soybean lines (Supplemental Tables S1 and S2). All
homozygote combinations of mutant alleles for lpa1 and
lpa2 resulted in elevation of inorganic phosphate and a
concomitant reduction in phytic acid (Fig. 5). The novel
combination of the lpa1-a mutation from CX1834 with
the lpa2-b mutation from M766 resulted in the greatest
accumulation of available inorganic phosphate P (3.33 ±
0.40 μg P mg−1 seed) and the least amount of phytic acid
P (0.25 ± 0.06 μg P mg−1 seed). The amount of available
inorganic phosphate was approximately 1.88 times higher
than noted for TN09-239 (1.77 ± 0.57 μg P mg−1 seed) or
the F2 selection homozygous for lpa1-a/lpa2-a (1.78 ± 0.25
μg P mg−1 seed) and these differences were statistically
significant (p = 0.0024). Phytic acid P was dramatically
reduced approximately fourfold for the novel allele
combination (0.25 ± 0.06 μg P mg−1 seed) as compared to
TN09-239 (0.99 ± 0.16 μg P mg−1 seed) or approximately
3.6-fold reduction when compared to the F3 selection
bearing lpa1-a/lpa2-a (0.90 ± 0.19), and these differences
were statistically significant (p < 0.0001). In comparison to
the wild-type line 5601T (4.12 ± 1.18 μg P mg−1 seed), the
reduction in phytic acid was approximately 16.5-fold.
GI LL M AN ET AL .: SOYBEAN SEED PHOSPHO RUS PARTITI ON I N G
Analysis of F3 Progeny of F2 Selections
Heterozygous for One lpa Locus
We investigated the P partitioning in seeds for the progeny of a plant heterozygous for lpa1-a but homozygous
for lpab2-b, which confirmed our findings (Fig. 5) that
the novel combination lpa1-a/lpab2-b results in greater
reductions in phytic acid than is possible using M153
and/or CX1834 derived alleles alone, as evinced by
TN09-239. A concomitant increase in the available inorganic phosphate was also noted. Among these selections,
there was no significant difference in terms of total P, as
detected by ICP-MS (Supplemental Tables S1 and S2).
The percentage of potentially available P (total P – phytic
acid P) ranged from 42.2 to 44.2% for wild-type samples
(Williams 82 and 5601T, respectively) to 87.5% for TN09239 or the genotypic class representing lpa1-a/lpa2-a
(88.5%). The novel combination of lpa1-a/lpa2-b resulted
in a remarkable approximately 97.4% of the total P potentially available for digestion, with only a very minute
trace amount of indigestible phytic acid P present (0.25 ±
0.06 μg PA mg−1 seed or ~2.6% of total P).
Ionomic Impacts of Presence of Low Phytic
Acid Alleles
Inductively coupled plasma mass spectrometry analysis
yields a considerable amount of data regarding the mineral
composition of tissues. A full listing of seed mineral composition results is presented in Supplemental File S1, but
some selected examples will be mentioned here. We noted
differences for certain mineral species between parental
genotypes. For example, Williams 82 possesses a low level
of Ni as compared to plants of the other genotypes grown
in the same environment. Similarly, both Williams 82 and
7 of 10
Figure 5. Histograms displaying P phenotypes of F2:3 selections from the M766 × TN09-239 cross and comparison to parental lines.
Each histogram represents the mean of the genotypic class although each seed was individually ground and subsampled for DNA
isolation and genotyping and P assays. Total seed P is indicated by the total height of the histogram, inorganic phosphate (Pi) P is
indicated by light gray, phytic acid (PA) P is indicated by dark gray, and the difference between total P minus PA P and Pi P (cellular
P) is indicated in gray. The first four genotypic classes represent F2:3 progeny from M766 × TN09-239 selections for all four possible
homozygous genotypic combinations of lpa1 and lpa2 mutant alleles. The next three histograms are from progeny of a single F2 plant
from a cross between M766 × TN09-239 that was fixed for lpa1-a. Parental and control lines grown in the same environment are
included for reference.
TN09-239 appear to have lower levels of Cu as compared to
5601T and M766. M766 also appears to have significantly
higher levels of total P content. The genetic factors responsible and/or biological significance (if any) of these mineral
compositional differences remain to be determined.
In contrast to the results noted for the parental lines,
we did not observe any consistent, statistically significant
differences among any of the lpa1 and lpa2 genotypic
classes for F2 or F3 generations in terms of elemental
content. Based on the dramatic reduction in phytic acid
content and the apparently unchanged level of mineral
species, soymeal derived from plants bearing the novel
lpa1-a/lpa2-b allele combination may have much higher
levels of Zn and Fe available for uptake since there is very
little chelating phytic acid present.
Potential of this Novel Genetic Material
to Have Germination Defects
We anticipate that soybean lines containing the lpa1-a/
lpa2-b combination of alleles may have some degree of
germination and/or field emergence defects when grown
in environments with elevated abiotic stress (high temperature during seed development or germination after cold
treatment), as this trait has previously shown for CX1834derived materials (Anderson and Fehr, 2008; Maupin and
Rainey, 2011; Oltmans et al., 2005). Rigorous analyses of
germination defects require substantial amounts of seed
produced and tested in multiple environments. To evaluate any large effect issues with seedling emergence, we
were only able to do a small scale field study with F2 seeds.
All genotypic classes for both populations from seeds
8 of 10
produced in a growth chamber were able to germinate,
emerge, and produce seed at the Bradford Research and
Extension Center near Columbia, MO, during the summer
of 2010, and we observed no significant segregation distortion at F2 or F3 for the cross of M766 × TN09-239 (Supplemental Table S1). Lines with all combinations of mutant
lpa1/lpa2 alleles are capable of germination and field emergence. We did, however, observe segregation distortion
in the cross between M766 × Williams 82, with an overrepresentation of wild-type samples occurring for LPA2
(Supplemental Table S1), similar to studies previously
reported for low phytic acid wheat (Triticum aestivum L.)
lines (Guttieri et al., 2004). This underlines the need for
molecular assays for this double recessive trait to have sufficient lines to combine the low phytic acid trait with yield.
Definitive quantification of potential germination defects
will require future backcrossing, as M766 is an unimproved
EMS mutant line, and targeting induced local lesions in
genomes (TILLING) studies have found that EMS mutant
lines can have as many as one mutation per 140 kb (Cooper
et al., 2008). This implies that M766 will likely contribute a
significant mutation load (i.e., “yield drag”). Once sufficiently
backcrossed material is developed, we can properly evaluate
the extent of any germination defects. The development of
an allelic series of combinations of the lpa1/lpa2 alleles from
M766 will likely assist in these efforts to quantify the effects
of these alleles on germination efficiency.
Conclusions
To summarize, we have developed a soybean line in which
phytic acid P is reduced to a minute 2.6% of the total seed
THE PL ANT GENOME
„
M ARCH 2013
„
VOL . 6, NO . 1
P using nontransgenic methods. Such material is capable
of germination and field emergence although backcrossing will likely be required to remove other EMS-induced
mutations from the M766 donor. This work enables the
development of cultivars with even lower levels of the
antinutritional compound phytic acid than is currently possible with conventional soybean germplasm. Such efforts
can be accelerated through use of molecular markers we
developed, and the fortuitous discovery that the exact same
codon was affected in two independent mutants (Gillman et
al., 2009) means that the same marker assays used for selection of M153 and/or CX1834 derived alleles can be used to
select for the novel allelic combination.
Supplemental Information Available
Supplemental material is included with this manuscript.
Supplemental Figure S1. Cartoon depiction of lpa1-b
intron single nucleotide polymorphism (SNP) (T > A 7
bp upstream of exon 10) and mRNA consequences of the
presence of the intron mutation. A) Cartoon depiction
of the Lpa1 or lpa1-b locus. Exons are indicated by dark
boxes and introns represented by lines. The predicted
transcriptional start site is indicated by arrow and the
placement of the intron mutation is indicated by a red
arrow. Primers used for reverse transcription polymerase
chain reaction (RT-PCR) are indicated by black arrows
located above exon 9 and exon 10. B) Sequence traces
from RT-PCR products amplified using gene specific
primers located in exon 9 and exon 10.
Supplemental Figure S2. Size fractionation of reverse
transcription polymerase chain reaction (RT-PCR) products between exon 9 and 10 to detect putative splicing
defect in lines bearing lpa1-b.
Supplemental Table S1. Phosphorus phenotypic data
for all nine possible F2 genotypic classes as determined
by genotyping assays and phenotyping on individual F2
seeds from crosses between M766 × TN09-239 or M766
× W82.
Supplemental Table S2. Seed phosphorus phenotypic
data for F2:3 genotypic selections from crosses between
M766 × TN09-239 or M766 × W82.
Supplemental File S1. Ionomic analysis of soybean
seeds for F2:3 genotypic selections from crosses between
M766 × TN09-239 or M766 × W82.
Acknowledgments
We would like to thank the Paul Little, Greg Ziegler, and Walter Iverson for
their superb technical assistance. This research was supported by the USDAAgricultural Research Service. We would also like to thank Vince Pantalone
(University of Tennessee) for his generous sharing of TN09-239 seed and
James Wilcox (USDA/ARS) for generously providing seed of M766.
References
Anderson, B.P., and W.R. Fehr. 2008. Seed source affects field emergence
of low-phytate soybean lines. Crop Sci. 48:929–932. doi:10.2135/
cropsci2007.09.0510
Applied Biosystems. 2006. PeakScanner soft ware, version 1.0. Applied
Biosystems Inc., Life Technologies Corporation, Carlsbad, CA.
Bernard, R., and C. Cremeens. 1988. Registration of ‘Williams 82’
soybean. Crop Sci. 28:1027–1028.
GI LL M AN ET AL .: SOYBEAN SEED PHOSPHO RUS PARTITI ON I N G
Bilyeu, K.D., P. Zeng, P. Coello, Z.J. Zhang, H.B. Krishnan, A. Bailey,
P.R. Beuselinck, and J.C. Polacco. 2008. Quantitative conversion
of phytate to inorganic phosphorus in soybean seeds expressing
a bacterial phytase. Plant Physiol. 146:468–477. doi:10.1104/
pp.107.113480
Biomatters. 2012. Geneious version 5.6. Biomatters Ltd., Aukland,
New Zealand.
Chen, Q.C., and B.W. Li. 2003. Separation of phytic acid and other related
inositol phosphates by high-performance ion chromatography
and its applications. J. Chromatogr. A. 1018:41–52. doi:10.1016/j.
chroma.2003.08.040
Cooper, J., B. Till, R. Laport, M. Darlow, J. Kleff ner, A. Jamai, T.
El-Mellouki, S. Liu, R. Ritchie, N. Nielsen, K. Bilyeu, K. Meksem, L.
Comai, and S. Henikoff. 2008. TILLING to detect induced mutations
in soybean. BMC Plant Biol. 8:9. doi:10.1186/1471-2229-8-9
Correll, D.L. 1998. The role of phosphorus in the eutrophication
of receiving waters: A review. J. Environ. Qual. 27:261–266.
doi:10.2134/jeq1998.00472425002700020004x
Gillman, J.D., V.R. Pantalone, and K. Bilyeu. 2009. The low phytic acid
phenotype in soybean line CX1834 is due to mutations in two
homologs of the maize low phytic acid gene. Plant Genome 2:179–
190. doi:10.3835/plantgenome2008.03.0013
Guttieri, M., D. Bowen, J.A. Dorsch, V. Raboy, and E. Souza. 2004.
Identification and characterization of a low phytic acid wheat. Crop
Sci. 44:418–424. doi:10.2135/cropsci2004.0418
Hebsgaard, S.M., P.G. Korning, N. Tolstrup, J. Engelbrecht, P. Rouze, and
S. Brunak. 1996. Splice site prediction in Arabidopsis thaliana DNA
by combining local and global sequence information. Nucleic Acids
Res. 24(17):3439–3452.
Hitz, W.D., T.J. Carlson, P.S. Kerr, and S.A. Sebastian. 2002. Biochemical
and molecular characterization of a mutation that confers a
decreased raffi nosaccharide and phytic acid phenotype on soybean
seeds. Plant Physiol. 128:650–660. doi:10.1104/pp.010585
Maroof, M.A.S., and G.R. Buss. 2011. Low phytic acid, low stachyose, high
sucrose soybean lines. U.S. Patent 8,003,856. Date issued: 23 August.
Maupin, L.M., and K.M. Rainey. 2011. Improving emergence of modified
phosphorus composition soybeans: Genotypes, germplasm,
environments, and selection. Crop Sci. 51:1946–1955. doi:10.2135/
cropsci2010.10.0585
Meis, S.J., W.R. Fehr, and S.R. Schnebly. 2003. Seed source effect on field
emergence of soybean lines with reduced phytate and raffi nose
saccharides. Crop Sci. 43:1336–1339. doi:10.2135/cropsci2003.1336
Nagy, R., H. Grob, B. Weder, P. Green, M. Klein, A. Frelet-Barrand, J.K.
Schjoerring, C. Brearley, and E. Martinoia. 2009. The Arabidopsis
ATP-binding cassette protein AtMRP5/AtABCC5 is a high affi nity
inositol hexakisphosphate transporter involved in guard cell
signaling and phytate storage. J. Biol. Chem. 284:33614–33622.
doi:10.1074/jbc.M109.030247
Nunes, A., G. Vianna, F. Cuneo, J. Amaya-Farfán, G. de Capdeville, E.
Rech, and F. Aragão. 2006. RNAi-mediated silencing of the myoinositol-1-phosphate synthase gene (GmMIPS1) in transgenic
soybean inhibited seed development and reduced phytate content.
Planta 224:125–132. doi:10.1007/s00425-005-0201-0
Oltmans, S.E., W.R. Fehr, G.A. Welke, and S.R. Cianzio. 2004.
Inheritance of low-phytate phosphorus in soybean. Crop Sci.
44:433–435. doi:10.2135/cropsci2004.0433
Oltmans, S.E., W.R. Fehr, G.A. Welke, V. Raboy, and K.L. Peterson.
2005. Agronomic and seed traits of soybean lines with low-phytate
phosphorus. Crop Sci. 45:593–598. doi:10.2135/cropsci2005.0593
Pantalone, V.R., F.L. Allen, and D. Landau-Ellis. 2003. Registration
of ‘5601T’ soybean. Crop Sci. 43:1123–1124. doi:10.2135/
cropsci2003.1123
Raboy, V. 2002. Progress in breeding low phytate crops. J. Nutr.
132:503S–505S.
Raboy, V. 2007a. The ABCs of low-phytate crops. Nat. Biotechnol. 25:874–
875. doi:10.1038/nbt0807-874
Raboy, V. 2007b. Seed phosphorus and the development of low-phytate
crops. In: B.L. Turner, A.E. Richardson, and E.J. Mullaney, editors,
Inositol phosphates: Linking agriculture and environment. CAB
Int., Oxfordshire, UK. p. 111–132.
9 of 10
Raboy, V., D.B. Dickinson, and F.E. Below. 1984. Variation in seed total
phosphorus, phytic acid, zinc, calcium, magnesium, and protein
among lines of Glycine max and G. soja. Crop Sci. 24:431–434.
doi:10.2135/cropsci1984.0011183X002400030001x
Shi, J., H. Wang, K. Schellin, B. Li, M. Faller, J.M. Stoop, R.B. Meeley, D.S.
Ertl, J.P. Ranch, and K. Glassman. 2007. Embryo-specific silencing
of a transporter reduces phytic acid content of maize and soybean
seeds. Nat. Biotechnol. 25:930–937. doi:10.1038/nbt1322
Spear, J.D., and W.R. Fehr. 2007. Genetic improvement of seedling
emergence of soybean lines with low phytate. Crop Sci. 47:1354–
1360. doi:10.2135/cropsci2006.09.0600
Waldroup, P.W., J.H. Kersey, E.A. Saleh, C.A. Fritts, F. Yan, H.L. Stilborn,
R.C. Crum, Jr., and V. Raboy. 2000. Nonphytate phosphorus
requirement and phosphorus excretion of broiler chicks fed diets
10 of 10
composed of normal or high available phosphate corn with and
without microbial phytase. Poult. Sci. 79:1451–1459.
Wilcox, J.R., G.S. Premachandra, K.A. Young, and V. Raboy. 2000.
Isolation of high seed inorganic P, low-phytate soybean mutants.
Crop Sci. 40:1601–1605. doi:10.2135/cropsci2000.4061601x
Yuan, F.-J., H.-J. Zhao, X.-L. Ren, S.-L. Zhu, X.-J. Fu, and Q.-Y. Shu. 2007.
Generation and characterization of two novel low phytate mutations
in soybean (Glycine max L. Merr.). Theor. Appl. Genet. 115:945–957.
doi:10.1007/s00122-007-0621-2
Zhou, J.R., E.J. Fordyce, V. Raboy, D.B. Dickinson, M.S. Wong, R.A.
Burns, and J.W. Erdman, Jr. 1992. Reduction of phytic acid in
soybean products improves zinc bioavailability in rats. J. Nutr.
122:2466–2473.
THE PL ANT GENOME
„
M ARCH 2013
„
VOL . 6, NO . 1