Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
From www.bloodjournal.org by guest on August 11, 2017. For personal use only. RED CELLS Transcriptional interference among the murine -like globin genes Xiao Hu,1 Susan Eszterhas,1 Nicolas Pallazzi,2 Eric E. Bouhassira,2 Jennifer Fields,1 Osamu Tanabe,3 Scott A. Gerber,4 Michael Bulger,5 James Douglas Engel,3 Mark Groudine,6 and Steven Fiering1,4 1Department of Microbiology/Immunology and Norris Cotton Cancer Center, Dartmouth Medical School, Hanover, NH; 2Department of Medicine, Division of Hematology, Albert Einstein College of Medicine, Bronx, NY; 3Department of Cell and Developmental Biology, University of Michigan Medical School, Ann Arbor; 4Department of Genetics and Norris Cotton Cancer Center, Dartmouth Medical School, Hanover, NH; 5Center for Human Genetics and Molecular Pediatric Disease and Department of Biophysics and Biochemistry, University of Rochester, NY; 6Basic Sciences Division, Fred Hutchinson Cancer Research Center, Seattle, WA Mammalian -globin loci contain multiple genes that are activated at different developmental stages. Studies have suggested that the transcription of one gene in a locus can influence the expression of the other locus genes. The prevalent model to explain this transcriptional interference is that all potentially active genes compete for locus control region (LCR) activity. To investigate the influence of transcription by the murine embryonic genes on transcription of the other -like genes, we generated mice with deletions of the promoter regions of Ey and h1 and measured transcription of the remaining genes. Deletion of the Ey and h1 promoters increased transcription of major and minor 2-fold to 3-fold during primitive erythropoiesis. Deletion of Ey did not affect h1 nor did deletion of h1 affect Ey, but Ey deletion uniquely activated transcription from h0, a -like globin gene immediately downstream of Ey. Protein analysis showed that h0 encodes a translatable -like globin protein that can pair with alpha globin. The lack of transcriptional interference between Ey and h1 and the gene-specific repression of h0 did not support LCR competition among the embryonic genes and suggested that direct transcriptional interference from Ey suppressed h0. (Blood. 2007;109:2210-2216) © 2007 by The American Society of Hematology Introduction The mammalian -globin loci consist of multiple genes that are activated at different developmental stages in a tissue-specific manner. In the mouse, 2 “embryonic” -like globin genes, Ey and h1, are transcribed at high levels only during primitive erythropoiesis in the embryonic yolk sac. The “adult” expressed -type globin genes—-major and -minor—are expressed at low levels in embryos and at high levels during fetal and adult definitive erythropoiesis. This developmental up-regulation of the adult -like globin genes is coincident with the silencing of the embryonic -like globin genes and is hypothesized to be mechanistically related to the silencing of the embryonic genes. Regulatory elements of each -like globin gene include a promoter and associated gene proximal cis-regulatory elements bound by multiple-tissue specific or ubiquitous transcription factors. High-level expression of all the genes at the locus requires a gene distal cis-regulatory element, the locus control region (LCR), which is located 5 to 22 kb upstream of the embryonic Ey gene in the mouse locus (for a review, see Stamatoyannopoulos and Grosveld1). The role, if any, of the LCR in the developmental regulation of individual genes within the locus is unclear. Previous studies of -globin gene regulation in transgenic mice carrying portions of the human -globin locus have suggested that developmental expression of the embryonic and adult genes is regulated through different mechanisms. For the embryonic genes, the developmental silencing is gene autonomous and is achieved through binding or dissociation of specific transcription factors to or from the gene proximal cis-regulatory elements. When directly linked to the LCR, the human embryonic ⑀ is expressed only at embryonic stages.2 When the LCR is deleted from the murine endogenous locus or from the human transgenic locus, all the genes are expressed at a very low level, yet tissue specificity and developmental silencing of the genes are maintained.3-5 The human -globin gene is not autonomously suppressed in the embryo. When directly linked to the LCR or inserted in place of the endogenous embryonic gene in a transgene containing the entire human locus, the adult  gene is activated at all developmental stages.6-9 Therefore, neither gene proximal cis-elements nor trans-acting factors in primitive erythroid cells directly suppress transcription of the adult -globin gene during the embryonic stage. However, insertion of a ␥ gene (which as a transgene is expressed during embryonic erythropoiesis) between the LCR and the adult -globin gene results in suppression of the adult  gene during embryonic erythropoiesis.6,7 Based on these and other observations, the prevalent model for the developmental silencing of the adult -globin gene is an LCR competition model10 (for a review, see Stamatoyannopoulos and Grosveld1). These and other studies have led to models in which all -like globin genes compete for a rate-limiting interaction with the LCR. Proximity to the LCR is thought to favor LCR–promoter interaction, and the geneautonomous silencing of the LCR-proximal embryonic genes is proposed to block interaction of the earlier stage genes with the LCR and thereby stimulate fetal or adult gene transcription. LCR–gene interaction and gene competition studies have been performed with small LCR–gene constructs or human -globin Submitted June 20, 2006; accepted October 12, 2006. Prepublished online as Blood First Edition Paper, October 31, 2006; DOI 10.1182/blood-200606-029868. The publication costs of this article were defrayed in part by page charge payment. Therefore, and solely to indicate this fact, this article is hereby marked ‘‘advertisement’’ in accordance with 18 USC section 1734. The online version of this article contains a data supplement. © 2007 by The American Society of Hematology 2210 BLOOD, 1 MARCH 2007 䡠 VOLUME 109, NUMBER 5 From www.bloodjournal.org by guest on August 11, 2017. For personal use only. BLOOD, 1 MARCH 2007 䡠 VOLUME 109, NUMBER 5 YAC constructs in which the general organization of the locus has been altered. This disturbance of the locus structure complicates the interpretation of those studies. Furthermore, because even large, intact, wild-type human b-globin YAC transgenes can occasionally have little or no expression11,12 or experience some degree of variegation at a higher frequency,13 concerns remain that the YACs do not, in fact, harbor the full cis-regulatory requirements of the endogenous human locus. Therefore, it is important to reexamine the conclusions drawn from transgene constructs at the endogenous mouse locus with minimal disturbance of the overall structure. In addition, none of these experiments explicitly addressed how genes expressed at the same developmental stage influence one another. Given that the mouse genome can be modified through homologous recombination (HR) in embryonic stem (ES) cells to generate mutant mice and that there are multiple genes for each development stage, the murine -globin locus provides an excellent alternative system to study the interactions among the -like globin genes. Previous studies in our laboratory and in others have found that when the endogenous major⌬ gene was deleted by random mutation from the mouse endogenous locus (Thal-1 mutation), expression of the downstream minor⌬ gene increased14 (J. Roach, S.F., unpublished observations, October 2001). To investigate the gene interaction mechanisms at the endogenous locus, we previously produced and reported analyses of the individual deletions of the promoters of each of the 2 major murine embryonic genes, Ey (⌬Ey) and h1 (⌬h1), in ES cells and in mice bearing these mutations.15 In the current study, the promoters of both major embryonic genes were simultaneously deleted, and the phenotype was analyzed in mice. Results reveal that the deletion of Ey, h1, or both increases major and minor expression in the embryo, consistent with the LCR competition model. However, deletion of Ey did not affect the transcription of h1 nor did the transcription of h1 affect the deletion of Ey, which is not consistent with the LCR competition model. Moreover, deletion of Ey greatly increases transcription of h0 (a weakly expressed embryonic gene), without affecting h1, whereas deletion of h1 had no effect on either Ey or h0. These results are consistent with direct transcriptional interference of Ey on h0. Materials and methods Generation of Ey and h1 promoter replacement and deletion mice Targeting constructs used for Ey promoter deletion (pEyprd-Hygro) and for h1 promoter deletion (ph1prd-Neo) have been described.15 To generate mice with Ey and h1 promoters deleted in cis, embryonic stem cell (ES) clones with the h1 promoter targeted by ph1prd-Neo were electroporated with the pEyprd-Hygro construct. ES clones correctly targeted in cis with both promoter replacements were used to generate promoter replacement chimeric mice. Southern blot assay for ES cell and mouse genotyping Mouse tail DNA was prepared with the PureGene DNA Isolation kit (catalog no. D-70KB; Gentra Systems, Minneapolis, MN). The probe used for Southern blotting is a 0.7-kb BamHI/XbaI fragment located upstream of h1 (BamH1 site is 7633 bp and XbaI site is 8307 bp from the transcription start site of Ey). RT-PCR assay of expression of -like globin genes The assay system uses polymorphisms in the gene-coding regions between mice with the diffuse Hbb(d), (D) haplotype, on which the mutations are made, and mice with the single Hbb(s), (S) haplotype of -like globin. The MURINE -GLOBIN TRANSCRIPTIONAL INTERFERENCE 2211 assay compares expression from the S allele to expression from the D allele in D/S heterozygous mice that are either wild-type or mutant at the D allele. The PCR primers and the system for the assay of Ey, h1, -major, and -minor have been described.16 In short, the primers are exact matches for genes from the D and S haplotypes, but within the amplified region of the cDNA is a restriction site found in one haplotype but not the other. Amplified products were labeled with radioactive nucleotides during the last cycle of the PCR, digested with the appropriate restriction enzyme, and separated by size on an acrylamide gel, and the product of each allele was quantitated. Each product was amplified and assayed by itself with no multiplexing, and each gene-specific PCR had its own optimized number of cycles, as reported.16 The h0 expression was achieved with RT-PCR to amplify the h0 and the h1 cDNA and with RFLP differences between the amplified regions to compare levels of h0 with levels of h1. Primers for h0 expression were 5⬘CTCTGGGAAGGCTCCTGATTG3⬘ and 5⬘CCCAGGAGCTTGAAGTTCTC3⬘. PCR products (242 bp) were digested with BslI to differentiate amplicons from h1 (242 bp) and h0 (131 bp and 111 bp) cDNA. For this assay in cells that are D/S, the total h1 signal from the S allele (the S allele lacks h0 because of a natural deletion) and the D allele was divided by 2 to represent the h1 transcripts from one allele. Primers for h2 expression were 5⬘GTGCTGCCACTGAAGGTA3⬘ and 5⬘CTCAAAAGCAGCTTGCAGTG3⬘. Primers for h3 expression were 5⬘ACTTTGGCAAGGAATTCAA3⬘ and 5⬘GGCCTCTGTGGTACTTGTG3⬘. Primers are perfect matches for h3 and imperfect matches for Ey, and the products can be differentiated by restriction digest. Protein assays of -like globin components in primitive and definitive erythroid cells Circulating primitive blood was collected from embryonic day 10.5 (e10.5) wild-type or mutant embryos. As described previously, HPLC analyses were performed with a 3-step acetonitrile gradient ranging from 35% to approximately 55% after treatment of the samples with cystamine.17 Protein identification by LC-FTMS Soluble protein samples were digested with trypsin (Promega, Madison, WI) in ammonium bicarbonate buffer (50 mM) overnight at 37°C, followed by acidification with 5% formic acid and desalting on STAGE tips.18 Liquid chromatography–tandem mass spectrometry (LC-MS/MS) was performed using an LTQFT hybrid linear (2-D) ion trap-Fourier transform ion cyclotron resonance (FTICR) mass spectrometer (ThermoElectron, San Jose, CA) as described previously.19,20 Results Production of the double embryonic gene promoter deletion mice Mice were generated with the promoter regions of Ey and h1 deleted in cis through sequential homologous recombination (Figure 1A). Each deleted region roughly measured 1.1 kbp, spanning from 700 bp 5⬘ to the transcription start site to near the 3⬘ end of exon 2 of each gene.15 One of the ES clones previously targeted to replace the h1 promoter with neo (⌬h1neo) was retargeted with the construct that replaced the Ey promoter with hygro (⌬Eyhygro). ES clones were screened for targeting of Ey, and Southern blots were used to identify clones that were targeted on both alleles in cis rather than in trans (Figure 1B). Mice derived from double-promoter replacement ES cells (⌬Eyhygro⌬h1neo) were generated by standard techniques and bred with CMV-Cre transgenic mice to delete the selectable marker. The deletion was efficient and generated 2 new strains, denoted ⌬Ey⌬h1 and ⌬Ey(inv)⌬h1 (Figure 1C). Because 2 Lox P sites in opposing orientations were retained in the locus, the Cre recombinase induced an additional inversion of the intergenic sequence between Ey and h1, which is flanked by the 2 Lox P From www.bloodjournal.org by guest on August 11, 2017. For personal use only. 2212 HU et al Figure 1. Deletion and Southern blot strategies to generate ⌬Ey⌬h1 promoter deletion mice. (A, I) Schematic map of the Hbb(d) allele. (arrows) LCR hypersensitive sites. (f) -like globin genes. (II) Ey and h1 genes with exons marked. Deleted regions from each gene are indicated by solid lines under the gene names. (III) Ey promoter was replaced by PGK-hygro, and h1 promoter was replaced by PGK-neo. (Œ) Selectable markers were each flanked by 2 convergent lox P sites and were removed by Cre recombinase-mediated deletion. (arrows) Selectable marker transcriptional start and orientation (IV). Cre recombinase also mediated an additional inversion of DNA between the 2 LoxP sites left from the deletion of the selectable markers and resulted in 2 double-promoter deletion alleles, ⌬Ey⌬h1 and ⌬Ey(inv)⌬h1. (arrows) Transcriptional orientation of h0 on each allele. (B) Southern blot strategies and representative Southern blot used to screen for ⌬Eyhygro⌬h1neo ES clones modified in cis after homologous recombination. Restriction sites for SpeI are marked as S. The probe is denoted as a short line under each map. Note that the expected band for wild-type Hbb(d) measures 42.2 kb, which is not shown on the gel. Each lane represents a single ES clone. (C) Southern blot strategies and representative Southern blot to screen for ⌬Ey⌬h1 and ⌬Ey(inv)⌬h1 promoter deletion alleles in mice after Cre-mediated selectable marker deletion in vivo. Restriction sites for Nsi I are marked as N, and the probe used is a line underneath each allele. Expected band sizes for each genotype are marked accordingly. sites to produce ⌬Ey(inv)⌬ h1. In the ⌬Ey(inv)⌬ h1 strain, the h0 gene was relocated 5 kbp further from the LCR and was transcribed in the direction opposite that of the endogenous gene (Figure 1A). To maintain genotype stability, ⌬Ey⌬h1 and ⌬Ey(inv)⌬ h1 mice were bred with 129 SvJ mice, and offspring were screened for the Cre gene by PCR. Only Cre-negative mice were used to generate mice for subsequent studies Because the major embryonic -like globins are not expressed from the ⌬Ey⌬h1 allele, it was possible that thalassemia would develop in homozygous embryos in utero. Sibling matings of each of the promoter deletion strains were set up to test the viability of homozygous mutant mice. Both ⌬Ey⌬h1 and ⌬Ey(inv)⌬h1 homozygous mice are born at normal Mendelian frequency and are viable through adulthood. Transcription of other -type globin genes in the Ey and h1 promoter-deleted embryos Viability of homozygous ⌬Ey⌬h1 mutants suggests that other -like globin genes are up-regulated during primitive erythropoiesis. HPLC analysis of -like globin protein content in primitive BLOOD, 1 MARCH 2007 䡠 VOLUME 109, NUMBER 5 erythroid cells was performed on heterozygous mice to investigate the identity of expressed globin chains. Levels of -major and -minor in ⌬Ey⌬h1/S embryos increased from less than 3% (below detection) to 14% of the total -like globin output. In addition, a prominent unidentified protein peak composing more than 24% of the total -like globin output from the mutant allele was observed (Figure 2B-C). HPLC characteristics suggest that this peak is a novel embryonic -like globin chain. Based on DNA sequence and gene structure, 3 -like globin genes—h0, h2, and h3—have been predicted in the mouse D allele; however, these putative genes have not been analyzed extensively. h0 is located 3⬘ of Ey, whereas h2 and h3 are located 3⬘ of h1 (Figure 3A). Low-level expression of h0 has been observed,21 but no expression of h2 or h3 has been reported and they have been considered pseudogenes, though their intron/ exon structure is that of a normal globin gene. To determine whether the new protein peak is encoded by any of these genes, we designed RT-PCR assays to examine their potential transcription. Gene-specific PCR primers designed to assay h2 are in different putative exons; thus, amplified cDNA is distinguishable from genomic DNA by its smaller size. As shown in Figure 3B, the h2 gene-specific primers did not detect spliced h2 mRNA from e10.5 yolk sac and only detected contaminating genomic DNA or background bands that were not the expected size and did not show different levels with different mouse genotypes. Thus, h2 was not expressed in any of the mutant mice. To detect h3 cDNA, a pair of primers was designed to perfectly match and amplify h3. When these primers were used under normal annealing conditions, no products were amplified from the cDNA of wild-type or mutant mouse e10.5 yolk sacs. Primers contained mismatches for Ey (2 mismatches on each primer), and, by lowering the annealing temperature, cDNA was amplified from all samples. Any h3 amplicon should be digested with NcoI but not with PvuII, whereas amplified Ey cDNA should be digested with PvuII but not NcoI. As Figure 2. HPLC assays identify a new peak in peripheral primitive erythroid cells from ⌬Ey⌬h1 embryos. (A) HPLC of cell lysate of e10.5 circulating blood from wild-type D/S embryo shows identified elution peaks from the wild-type D and S alleles. Ey1 is from the S allele, and Ey2 is from the D allele. The h1 peak includes protein from D and S, and alpha and zeta are ␣-like globin chains. (B) HPLC of cell lysate of d10.5 circulating blood from ⌬Ey⌬h1/S embryo. Identified elution peaks include alpha and zeta and from the S allele, Ey1, and h1. The Ey2 peak from D is missing. A peak represents -major and -minor (beta), and a new peak (?) represents a novel -like globin chain. (C) HPLC of cell lysate of mixed e10.5 circulating blood from wild-type D/S and ⌬Ey⌬h1/S embryos shows that the new peak (?) is distinguished from Ey1 and Ey2. From www.bloodjournal.org by guest on August 11, 2017. For personal use only. BLOOD, 1 MARCH 2007 䡠 VOLUME 109, NUMBER 5 MURINE -GLOBIN TRANSCRIPTIONAL INTERFERENCE 2213 4C) but not in ⌬h1/S animals (Figure 4D). The activation of h0 correlated with deletion of the Ey promoter, and, when activated, its transcription level was comparable to that of h1 because the h0/h1 ratio was close to 1 (Figure 4E). The h0 expression level in ⌬Ey and ⌬Ey⌬h1 was more than 20-fold higher than in wild-type mice. In the ⌬Ey/S mutants, h0 expression was similar to the level in ⌬Ey⌬h1/S mutants. These results demonstrated that the activation of h0 was caused by the deletion of the Ey promoter and that the deletion of the h1 promoter did not have a detectable influence on h0 transcription. Transcription of h0 is inversely proportional to transcription levels of Ey Figure 3. h2 and h3 are not expressed in any of the promoter-deletion embryos. (A) Schematic map of the D allele with the highly expressed -like globin genes as dark bars and genes potentially expressed at low levels as white bars. (B) RT-PCR analysis of h2 transcription in cDNA from e10.5 yolk sac. Lanes with genomic DNA (50 ng) are labeled G, marker lanes are labeled M, and genotypes of yolk sac samples are labeled. Expected sizes of PCR products from the h2 cDNA and genomic DNA are marked. Genomic bands verify the ability to amplify the h2 cDNA if it was present. (C) RT-PCR analysis of h3 transcription in cDNA from e10.5 wild-type D/S (lanes 1-3), ⌬h1/S (lanes 4, 5), ⌬Ey/S (lanes 6, 7), and ⌬Ey⌬h1/S (lanes 8, 9) yolk sac. G represents genomic DNA. PCR primers preferentially amplified cDNA from h3 and, less efficiently, from Ey (2 mismatches on both primers). Uncut bands from any gene measured 96 bp. h3 can be distinguished from Ey because the h3 amplicon cut with NcoI to 64 bp but not with PvuII and the Ey amplicons cut with PvuII to 75 bp but not with NcoI. It has been reported, by us and by others,22-24 that the transcription of one gene can suppress the transcription of other genes linked in cis through direct transcriptional interference (TI), which could involve multiple mechanisms. The physical relationship of the genes involved in TI influences the degree of suppression of each gene.22 It is possible that transcription from Ey suppresses h0 through direct transcriptional interference rather than competition for the LCR. If direct transcriptional interference were involved, any change in cis or trans that resulted in reduced Ey transcription would increase the level of h0. Recently, Tanabe et al (O.T., Yannan Shen, Shoko Kobayashi, David McPhee, William Brandt, Xia Jang, Andrew D. Campbell, Yei-Tsung Chen, Chawnshang Chang, Masayuki Yamamoto, Keiji Tanimoto, and J.D.E., manuscript submitted) generated mice overexpressing the orphan receptors TR2 and TR4. These orphan receptors form a complex that suppresses Ey but does not suppress the h1 or adult -globin genes in primitive erythrocytes (O. Tanabe et al, manuscript shown in Figure 3C, the amplification product was not digestible with NcoI and was completely digestible with PvuII, indicating that amplified cDNA was from Ey and that no transcription from h3 was detected. Activated transcription of h0 correlates with deletion of the Ey promoter h0 is highly homologous to h1 in the coding and the promoter regions. To distinguish the transcription of h0 from that of h1, we designed primers to perfectly match h0 and h1 cDNA. Primers recognized h1 from either the D or the S haplotype, and the S haplotype had a deletion of the promoter and the first exon of h0. The amplified region contained an RFLP at which BslI uniquely digested the PCR product from h0. This RFLP allowed us to quantify PCR products from h0 relative to h1 after BslI digestion (Figure 4A). RT-PCR analysis of e10.5 yolk sac cDNA generated from wild-type D/S and ⌬Ey⌬h1/S embryos showed that h0 was activated in the ⌬Ey⌬h1 mutant primitive erythroid cells (Figure 4B). The distinct increase in h0 transcription, along with a lack of detectable transcript from any of the other potentially expressed genes, suggested that the novel HPLC peak in ⌬Ey⌬h1 embryos was h0 protein and that h0 mRNA could be translated into a stable globin protein. To further dissect the mechanism underlying h0 regulation, we assayed h0 expression in our single-promoter deletion mutants, ⌬Ey and ⌬h1. As reported previously,15 the transcription of h1 was not changed by the deletion of the Ey promoter. Hence, the transcription level of h0 could be compared with that of h1 directly, even on the ⌬Ey allele. Assays of ⌬Ey/S and ⌬h1/S animals showed that h0 was activated in ⌬Ey/S animals (Figure Figure 4. h0 is activated exclusively during primitive erythropoiesis in embryos with the promoter of Ey deleted. (A) Steady state RT-PCR strategy to detect and quantitate transcription from h0. PCR primers were perfect matches for h0 and h1 cDNA. (asterisk) The amplified region contained one restriction enzyme site in h0 (Bsl I) that was not present in h1 cDNA. Amplified cDNA from e10.5 yolk sacs of wild-type D/S and (B) ⌬Ey⌬h1/S, (C) ⌬Ey/S, and (D) ⌬h1/S. All samples were digested with Bsl I. (E) Quantitation of h0 expression in each mutant genotype comparing the ratio of h1 (uncut) and h0 (cut), adjusted for the number of active h1 alleles. Error bars represent SD of at least 3 embryos of that genotype in a litter. From www.bloodjournal.org by guest on August 11, 2017. For personal use only. 2214 HU et al BLOOD, 1 MARCH 2007 䡠 VOLUME 109, NUMBER 5 submitted). Consistent with this, 2 independent transgenic TR2/ TR4 lines expressing elevated levels of TR2 and TR4 displayed correspondingly lowered accumulation of Ey mRNA. We found that h0 is also activated in the yolk sac of those transgenic mice (Figure 5) and that the transcript level of h0 is inversely proportional to the level of Ey expression. Line 1, which expresses less of the TR2/TR4 transgene than line 2, has 2-fold higher levels of Ey and half the amount of h0 than line 2. Therefore, a trans alteration that reduced the transcription of Ey increased the transcription of h0 inversely to the reduction of Ey. We generated mice in which the Ey promoter was replaced by the PGK-hygro selectable marker transcribed away from h0. In this strain, the expression of h0 in yolk sac was well above the amount expressed from a wild-type allele but approximately 60% of the level expressed from an allele with the Ey promoter deleted and in which the selectable marker was removed (Figure 6A). Previous studies with human transgenic loci have shown that changing the distance of a -like gene from the LCR could affect its developmental expression pattern.8,9,25,26 It is less clear whether distance from the LCR directly affected expression level. During the removal of the selectable markers by Cre, mice were generated with an inversion of the region between Ey and h1, including the h0 gene. In the ⌬Ey(inv)⌬h1 mutants, the h0 gene is relocated 5 kbp further from the LCR compared with its wild-type location and is transcribed in the reverse direction. To determine how these alterations in location and transcriptional orientation might affect gene expression, we assayed h0 expression in e10.5 yolk sac from the ⌬Ey(inv)⌬h1 mutants (Figure 6B). Compared with h0 transcription in ⌬Ey and ⌬Ey⌬h1mutants (Figure 6C), transcription of h0 in ⌬Ey(inv)⌬h1 was reduced approximately 2.5-fold. Figure 6C summarizes the levels of h0 expression in all genotypes of mice assayed. Bh0 protein is produced and forms a complex with ␣-globin The demonstration that h0 message is increased by at least 20-fold after deletion of the Ey promoter strongly suggests that the unknown protein peak in Figure 2 is h0. Experiments using mass spectrometry in conjunction with HPLC were undertaken to definitively determine whether h0 was expressed at the protein level and corresponded to the unknown peak in Figure 2. Protein extracts of homozygous ⌬Ey⌬h1 circulating e10.5 primitive cells were run on a nondenaturing isoelectric focusing gel, and the complexes that were visually revealed by staining with o-dianisidine were cut out and eluted from that gel. Three novel bands were analyzed by mass spectrometry. Band 1 contained h0 as a major component. The protein in this band was then analyzed by HPLC (Figure S2, available on the Blood website; see the Supplemental Figures link at the top of the online article), and results were compared with those from HPLC analysis of protein Figure 6. Activation of h0 transcription is influenced by multiple parameters in mice with reduced Ey transcription. (A) Schematic map of ⌬Eyhygro allele. (o) Selectable marker gene PGK-Hygro. (arrow) Its transcriptional direction. Representative gel and quantitation of h0 expression in e10.5 wild-type D/S and ⌬Eyhygro/S yolk sacs. Error bars represent SD of at least 3 littermates with the genotype marked throughout. (B) Schematic map of ⌬Ey(inv)⌬h1 allele. (■) h0 gene that was relocated 5 kb further away from the LCR on the mutant allele compared with the wild-type allele. (arrow) Inversion also changed the transcription direction of the h0 gene on this mutant allele. Representative gel and quantitation of h0 expression in e10.5 wild-type D/S and ⌬Ey⌬h1(inv)/S yolk sacs. (C) Comparative summary of h0 transcription in various mutants in which it has increased transcription. from circulating primitive erythrocytes of ⌬Ey⌬h1 mice (Figure S3). Band 1 contained the same peak found in homozygous and heterozygous ⌬Ey⌬h1 mice; thus, this peak was definitively identified as h0. In band 1, h0 and ␣-globin were found in roughly the same amount as h0 (Figure S2), demonstrating that h0 can form a complex with ␣-globin. No -globin was found in band 1, and bands 2 and 3 did not have significant amounts of h0. Hence, it appeared that h0 did not form a complex with -globin. Deletion of the Ey or h1 gene promoters induces -major and -minor expression in primitive erythroid cells Figure 5. Transcription level of Ey directly regulates h0. (A) Representative gel of h0 expression in e10.5 wild-type and TR2/TR4 transgenic yolk sacs. Genotype of each sample is marked above the gel, and 2 TR2/TR4 transgenic lines are noted as line 1s and 2. All samples were digested with Bsl I. (B) Quantitation of h0 expression in e10.5 wild-type and 2 different TR2/TR4 transgenic lines. Error bars represent SD of at least 3 embryos of that genotype. To test the hypothesis that transcription of the embryonic -globin genes suppresses transcription of the fetal/adult -globin genes during embryonic erythropoiesis, we analyzed the transcription and translation of the murine fetal/adult -major and -minor genes in the yolk sac primitive erythroid cells from the embryonic gene promoter deletion embryos. Transcription of -major and -minor from the wild-type D allele or the mutant D allele was normalized to the transcription of s and t from the wild-type S allele. Results revealed that the From www.bloodjournal.org by guest on August 11, 2017. For personal use only. BLOOD, 1 MARCH 2007 䡠 VOLUME 109, NUMBER 5 MURINE -GLOBIN TRANSCRIPTIONAL INTERFERENCE 2215 Discussion Figure 7. Deletion of either or both embryonic gene promoter(s) increased transcription of -major/minor in primitive erythroid cells. (A) Representative RT-PCR/RFLP assay of -major/minor transcription in e10.5 ⌬Ey/S, ⌬h1/S, and ⌬Ey⌬h1/S yolk sac primitive erythroid cells. Sample genotypes are marked above the gel. (B) Quantitation of -major/minor transcription in yolk sac of promoter deletion mutants. Each pair of bars represents data from 2 litters, with a total of at least 12 embryos with error bars denoting SD. Mutations assayed and days of gestation are indicated below the graph. Wild-type ratios from e10.5 and e11.5 were close to 1 and were normalized to 1, and the mutant ratio was similarly adjusted. Wild-type ratios from e9.5 were not normalized and are represented as simple D/S ratios from each genotype. All mutant ratios are statistically different from wild-type ratios (P ⬎ .05) for e10.5 and e11.5 but not e9.5. (C) Representative RT-PCR/RFLP assay and (D) quantitation of -major/minor transcription in ⌬Ey/S, ⌬h1/S, and ⌬Ey⌬h1/S adult peripheral blood. Genotype of each sample is marked above the gel. Each pair of bars represents data from least 5 adult mice. Wild-type D/S ratios were normalized to 1. deletion of both embryonic gene promoters (⌬Ey⌬h1/S) or the deletion of a single embryonic gene promoter (⌬Ey/S or ⌬h1/S) increased the transcription of -major and -minor from the mutant alleles in e10.5 primitive erythrocytes (Figure 7A-B). HPLC quantitation of the -like globin chains in e10.5 ⌬Ey⌬h1/S and wild-type D/S primitive erythroid cells showed that the level of adult -globin chains in ⌬Ey⌬h1/S primitive erythroid cells increased to 14% of total -like globin chains (from a possible 50% of total -like globin chains that can derive from one allele) compared with less than 5% in wild-type D/S primitive erythroid cells (Figure 2). The increase was not apparent in e9.5 day postcoital (dpc) red blood cells. In these cells, very high D/S ratios were identical between wild-type and promoter deletion mice. For clarity, all ratios in wild-type mice except those from e9.5 embryos were normalized to 1. Embryonic globin genes were not expressed in definitive cells of the murine fetus or the adult. No effect of embryonic promoter deletion on -major and -minor transcription in definitive cells was observed in the ⌬Ey⌬h1/S mutants (Figure 7C-D). Protein quantification by HPLC analysis confirmed the results of RT-PCR assays (data not shown). Transcriptional interference (TI) is a broad term that describes situations in which the transcription of one gene suppresses the transcription of nearby genes. A variety of mechanisms can be involved in transcriptional interference. It has been reported, primarily from studies of human transgenes in mice, that the transcription of one gene at the -globin locus can suppress the transcription of other genes. The physical arrangement of genes at the locus is thought to be important for developmental gene regulation through transcriptional interference. The prevalent hypothesis regarding TI among genes at the -globin locus is that -like globin genes compete for LCR interaction. It is hypothesized that LCR–promoter interaction is accomplished by a looping mechanism that brings the LCR and the activated promoter in contact in a physical interaction required for transcriptional activation.27 Other possible mechanisms proposed for the TI effects include tracking28 or linking29 of proteins from the LCR and direct transcriptional interference.30 Results reported here suggest that multiple mechanisms are involved in TI among the -like globin genes and that the mechanisms influencing the embryonic genes differ from those influencing the fetal/adult genes. It has been shown that high-level transcriptional activation of the embryonic genes at the endogenous locus requires the LCR.35 Therefore, if all the murine embryonic -like globin genes competed for LCR interaction, deletion of one embryonic gene would increase transcription of the other embryonic -like globin genes, but this was not the case. As reported previously and reiterated here, deletion of the Ey promoter did not increase h1 transcription, and deletion of h1 did not increase Ey transcription. Deletion of the Ey promoter did dramatically increase h0 transcription, but deletion of h1 had no effect on h0. Although these data demonstrated no direct competition between Ey and h1, Ey transcription interfered with h0. The observed h0 suppression by Ey could have occurred through 2 possible mechanisms, directionally polar LCR competition or direct transcriptional interference. Given that Ey is upstream of h0, any of the 3 LCR–gene interaction models could potentially explain how Ey suppresses h0. However, because all the LCR–gene interaction models predicted favored LCR interaction and, therefore, transcription of the LCR proximal gene, they all faced the dilemma of why h0—which is LCR proximal compared with h1—was suppressed by Ey transcription whereas the LCR distal h1 was not affected by Ey transcription. Given that the gene promoters of h1 and h0 were almost identical (Figure S3) and that they had similar transcription levels after the removal of the Ey promoter, it was unlikely that the preference resulted from intrinsic properties of different promoters. A plausible alternative explanation is that Ey did not suppress h0 by competing for the LCR but by direct transcriptional interference. This explanation is consistent with the fact that neither Ey nor h1 transcriptionally interfered with the other. The finding that the specific reduction in Ey by transgenic overexpression of TR2/TR4 also stimulated h0 expression supports the model that direct transcriptional interference accounted for the suppression of h0 by Ey. Clearly, multiple molecular mechanisms account for transcriptional interference, and they are poorly understood. Because of the proximity and tandem arrangement of the Ey and h0 genes, we propose that transcription from Ey disrupts the recruitment of transcriptional regulatory factors and transcription machinery to the h0 promoter (promoter occlusion), as has been demonstrated From www.bloodjournal.org by guest on August 11, 2017. For personal use only. 2216 BLOOD, 1 MARCH 2007 䡠 VOLUME 109, NUMBER 5 HU et al in other models.23,31 This possibility is related to the fact that mammalian polII proceeds past the polyA site and does not have a specific termination site (for a review, see Rosonina et al32). The data showing that PGK-hygro, which replaced the Ey promoter and was transcribed in the opposite direction, only mildly suppressed h0 supported the hypothesis that direct transcriptional interference by promoter occlusion was the primary mechanism by which Ey suppressed h0. Acknowledgments This work was supported by National Institutes of Health– National Institute of Diabetes and Digestive and Kidney Diseases grant RO1 DK54071 (S.F.) and by a Burroughs-Wellcome Fund Career Award (M.B.). We thank the staff at the Dartmouth Transgenic Mouse Facility of the Norris Cotton Cancer Center for producing the transgenic mice and Sandra Warner for assisting with ES cell culture. Authorship Contribution: X.H. designed and performed the research and wrote the paper; S.E. designed and performed the research; N.P. performed the research; E.E.B. designed and performed the research and wrote the paper; J.F. performed the research; O.T. contributed new reagents; S.A.G. designed and performed the research; M.B. designed and performed the research and wrote the paper; J.D.E. designed the research, contributed new reagents, and wrote the paper; M.G. designed the research and wrote the paper; and S.F. designed and performed the research and wrote the paper. Conflict of interest disclosure: The authors declare no competing financial interests. Correspondence: Steven Fiering, Department of Microbiology/ Immunology and Norris Cotton Cancer Center, 622 Rubin, Dartmouth Hitchcock Medical Center, Dartmouth Medical School, Lebanon, NH 03756; e-mail: [email protected]. References 1. Stamatoyannopoulos G, Grosveld F. Hemoglobin switching. In: Stamatoyannopoulos G, Majerus PW, Perlmutter RM, Varmus H, eds. The Molecular Basis of Blood Diseases. Philadelphia, PA: WB Saunders; 2001:135-182. 12. Gaensler K, Zhang Z, Lin C, Yang S, Hardt K, Flebbe-Rewahldt L. Sequences in the A␥-␦ intergenic region are not required for the stage-specific regulation of the human -globin locus. Proc Nat Acad U S A. 2003;100:3374-3379. 2. Raich N, Enver T, Nakamoto B, Josephson B, Papayannopoulou T, Stamatoyannopoulos G. Autonomous developmental control of human embryonic globin gene switching in transgenic mice. Science. 1990;250:1147-1149. 13. Alami R, Greally J, Tanimoto K, et al. -Globin YAC transgenes exhibit uniform expression levels but position effect variegation in mice. Human Mol Genet. 2000;9:631-636. 23. Martens JA, Wu PY, Winston F. Regulation of an intergenic transcript controls adjacent gene transcription in Saccharomyces cerevisiae. Genes Dev. 2005;19:2695-2704. 14. Skow L, Burkhart B, Johnson F, et al. A mouse model for -thalassemia. Cell. 1983;34:10431052. 24. Proudfoot N. Transcriptional interference and termination between duplicated ␣-globin gene constructs suggests a novel mechanism for gene regulation. Nature. 1986;322:562-565. 3. Epner E, Reik A, Cimbora D, et al. The -globin LCR is not necessary for an open chromatin structure or developmentally regulated transcription of the native mouse -globin locus. Mol Cell. 1998;2:447-455. 4. Starck J, Sarkar R, Romana M, et al. Developmental regulation of human gamma- and -globin genes in the absence of the locus control region. Blood. 1994;84:1656-1665. 5. Bender M, Bulger M, Close J, Groudine M. -Globin gene switching and DNaseI sensitivity of the endogenous -globin locus in mice do not require the locus control region. Mol Cell. 2000;5:387393. 6. Behringer RR, Hammer RE, Brinster RL, Townes TM. Human gamma to beta-globin switching in transgenic mice. Genes Dev. 1990;4:380-389. 7. Enver T, Raich N, Ebens AJ, Papayannopoulou T, Costantini F, Stamatoyannopoulos G. Developmental regulation of human fetal-to-adult globin gene switching in transgenic mice. Nature. 1990; 344:309-313. 8. Dillon N, Trimborn T, Strouboulis J, Fraser P, Grosveld F. The effect of distance on long-range chromatin interactions. Mol Cell. 1997;1:131-139. 9. Tanimoto K, Liu Q, Bungert J, Engel J. Effects of altered gene order or orientation of the locus control region on human -globin gene expression in mice. Nature. 1999;398:344-347. 10. Choi OR, Engel JD. Developmental regulation of -globin gene switching. Cell. 1988;55:17-26. 11. Kaufman RM, Pham CT, Ley TJ. Transgenic analysis of a 110-kb human -globin cluster-containing DNA fragment propagated as a bacterial artificial chromosome. Blood. 1999;94:3178-3184. 15. Hu X, Bulger M, Roach JN, et al. Promoters of the murine embryonic -like globin genes Ey and h1 do not compete for interaction with the -globin locus control region. Proc Natl Acad Sci U S A. 2003;100:1111-1115. 16. Fiering S, Epner E, Robinson K, et al. Targeted deletion of 5’HS2 of the murine -globin locus reveals that it is not essential for proper regulation of the -globin locus. Genes Dev. 1995;9: 2203-2213. 17. Alami R, Bender M, Feng YQ, et al. Deletions within the mouse -globin locus control region preferentially reduce -minor globin gene expression. Genomics. 2000;63:417-424. 18. Rappsilber J, Ishihama Y, Mann M. Stop and go extraction tips for matrix-assisted laser desorption/ionization, nanoelectrospray and LC/MS sample pretreatment in proteomics. Anal Chem. 2003;75:663-670. 19. Dieguez-Acuna FJ, Gerber SA, Kodama S, et al. Characterization of mouse spleen cells by subtractive proteomics. Mol Cell Proteomics. 2005;4: 1459-1470. 20. Everley PA, Bakalarski CE, Elias JE, et al. Enhanced analysis of metastatic prostate cancer using stable isotopes and high mass accuracy instrumentation. J Proteome Res. 2006;5:12241231. 21. Farace MG, Brown BA, Raschella G, et al. The mouse beta h1 gene codes for the z chain of embryonic hemoglobin. J Biol Chem. 1984;259: 7123-7128. 22. Eszterhas S, Bouhassira E, Martin DIK, Fiering S. Transcriptional interference by independently regulated genes occurs in any relative arrangement of the genes and is influenced by chromosomal integration position. Mol Cell Biol. 2002;22: 469-479. 25. Hanscombe O, Whyatt D, Fraser P, et al. Importance of globin gene order for correct developmental expression. Genes Dev. 1991;5:13871394. 26. Peterson KR, Stamatoyannopoulos G. Role of gene order in developmental control of human gamma- and beta-globin synthesis. Mol Cell Biol. 1993;13:4836-4843. 27. Foley KP, Engel JD. Individual stage selector element mutations lead to reciprocal changes in beta- vs. epsilon-globin gene transcription: genetic confirmation of promoter competition during globin gene switching. Genes Dev. 1992;6:730744. 28. Ling J, Ainol L, Zhang L, Yu X, Pi W, Tuan D. HS2 enhancer function is blocked by a transcriptional terminator inserted between the enhancer and the promoter. J Biol Chem. 2004;279:5170451713. 29. Bulger M, Groudine M. Looping vs. linking: toward a model for long-distance gene activation. Genes Dev. 1999;13:2465-2477. 30. Martin DIK, Fiering S, Groudine M. Regulation of -globin gene expression: straightening out the locus. Curr Opin Genet Dev. 1996;6:488-495. 31. Greger I, Demarchi F, Giacca M, Proudfoot N. Transcriptional interference perturbs the binding of Sp1 to the HIV-1 promoter. Nucl Acids Res. 1998;26:1294-1300. 32. Rosonina E, Kaneko S, Manley J. Terminating the transcript: breaking up is hard to do. Genes Dev. 2006;20:1050-1056. From www.bloodjournal.org by guest on August 11, 2017. For personal use only. 2007 109: 2210-2216 doi:10.1182/blood-2006-06-029868 originally published online October 31, 2006 Transcriptional interference among the murine β-like globin genes Xiao Hu, Susan Eszterhas, Nicolas Pallazzi, Eric E. Bouhassira, Jennifer Fields, Osamu Tanabe, Scott A. Gerber, Michael Bulger, James Douglas Engel, Mark Groudine and Steven Fiering Updated information and services can be found at: http://www.bloodjournal.org/content/109/5/2210.full.html Articles on similar topics can be found in the following Blood collections Gene Expression (1086 articles) Red Cells (1159 articles) Information about reproducing this article in parts or in its entirety may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests Information about ordering reprints may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#reprints Information about subscriptions and ASH membership may be found online at: http://www.bloodjournal.org/site/subscriptions/index.xhtml Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036. Copyright 2011 by The American Society of Hematology; all rights reserved.