Download Transcriptional interference among the murine β

From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
RED CELLS
Transcriptional interference among the murine ␤-like globin genes
Xiao Hu,1 Susan Eszterhas,1 Nicolas Pallazzi,2 Eric E. Bouhassira,2 Jennifer Fields,1 Osamu Tanabe,3 Scott A. Gerber,4
Michael Bulger,5 James Douglas Engel,3 Mark Groudine,6 and Steven Fiering1,4
1Department of Microbiology/Immunology and Norris Cotton Cancer Center, Dartmouth Medical School, Hanover, NH; 2Department of Medicine, Division of
Hematology, Albert Einstein College of Medicine, Bronx, NY; 3Department of Cell and Developmental Biology, University of Michigan Medical School, Ann Arbor;
4Department of Genetics and Norris Cotton Cancer Center, Dartmouth Medical School, Hanover, NH; 5Center for Human Genetics and Molecular Pediatric
Disease and Department of Biophysics and Biochemistry, University of Rochester, NY; 6Basic Sciences Division, Fred Hutchinson Cancer Research Center,
Seattle, WA
Mammalian ␤-globin loci contain multiple
genes that are activated at different developmental stages. Studies have suggested
that the transcription of one gene in a
locus can influence the expression of the
other locus genes. The prevalent model
to explain this transcriptional interference is that all potentially active genes
compete for locus control region (LCR)
activity. To investigate the influence of
transcription by the murine embryonic
genes on transcription of the other ␤-like
genes, we generated mice with deletions
of the promoter regions of Ey and ␤h1
and measured transcription of the remaining genes. Deletion of the Ey and ␤h1
promoters increased transcription of ␤major and ␤minor 2-fold to 3-fold during
primitive erythropoiesis. Deletion of Ey
did not affect ␤h1 nor did deletion of ␤h1
affect Ey, but Ey deletion uniquely activated transcription from ␤h0, a ␤-like
globin gene immediately downstream of
Ey. Protein analysis showed that ␤h0
encodes a translatable ␤-like globin protein that can pair with alpha globin. The
lack of transcriptional interference between Ey and ␤h1 and the gene-specific
repression of ␤h0 did not support LCR
competition among the embryonic genes
and suggested that direct transcriptional
interference from Ey suppressed ␤h0.
(Blood. 2007;109:2210-2216)
© 2007 by The American Society of Hematology
Introduction
The mammalian ␤-globin loci consist of multiple genes that are
activated at different developmental stages in a tissue-specific
manner. In the mouse, 2 “embryonic” ␤-like globin genes, Ey and
␤h1, are transcribed at high levels only during primitive erythropoiesis in the embryonic yolk sac. The “adult” expressed ␤-type globin
genes—␤-major and ␤-minor—are expressed at low levels in
embryos and at high levels during fetal and adult definitive
erythropoiesis. This developmental up-regulation of the adult
␤-like globin genes is coincident with the silencing of the
embryonic ␤-like globin genes and is hypothesized to be mechanistically related to the silencing of the embryonic genes.
Regulatory elements of each ␤-like globin gene include a
promoter and associated gene proximal cis-regulatory elements
bound by multiple-tissue specific or ubiquitous transcription factors. High-level expression of all the genes at the locus requires a
gene distal cis-regulatory element, the locus control region (LCR),
which is located 5 to 22 kb upstream of the embryonic Ey gene in
the mouse locus (for a review, see Stamatoyannopoulos and
Grosveld1). The role, if any, of the LCR in the developmental
regulation of individual genes within the locus is unclear.
Previous studies of ␤-globin gene regulation in transgenic mice
carrying portions of the human ␤-globin locus have suggested that
developmental expression of the embryonic and adult genes is
regulated through different mechanisms. For the embryonic genes,
the developmental silencing is gene autonomous and is achieved
through binding or dissociation of specific transcription factors to
or from the gene proximal cis-regulatory elements. When directly
linked to the LCR, the human embryonic ⑀ is expressed only at
embryonic stages.2 When the LCR is deleted from the murine
endogenous locus or from the human transgenic locus, all the genes
are expressed at a very low level, yet tissue specificity and
developmental silencing of the genes are maintained.3-5
The human ␤-globin gene is not autonomously suppressed in
the embryo. When directly linked to the LCR or inserted in place of
the endogenous embryonic gene in a transgene containing the
entire human locus, the adult ␤ gene is activated at all developmental stages.6-9 Therefore, neither gene proximal cis-elements nor
trans-acting factors in primitive erythroid cells directly suppress
transcription of the adult ␤-globin gene during the embryonic
stage. However, insertion of a ␥ gene (which as a transgene is
expressed during embryonic erythropoiesis) between the LCR and
the adult ␤-globin gene results in suppression of the adult ␤ gene
during embryonic erythropoiesis.6,7 Based on these and other
observations, the prevalent model for the developmental silencing
of the adult ␤-globin gene is an LCR competition model10 (for a
review, see Stamatoyannopoulos and Grosveld1). These and other
studies have led to models in which all ␤-like globin genes compete
for a rate-limiting interaction with the LCR. Proximity to the LCR
is thought to favor LCR–promoter interaction, and the geneautonomous silencing of the LCR-proximal embryonic genes is
proposed to block interaction of the earlier stage genes with the
LCR and thereby stimulate fetal or adult gene transcription.
LCR–gene interaction and gene competition studies have been
performed with small LCR–gene constructs or human ␤-globin
Submitted June 20, 2006; accepted October 12, 2006. Prepublished online
as Blood First Edition Paper, October 31, 2006; DOI 10.1182/blood-200606-029868.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 USC section 1734.
The online version of this article contains a data supplement.
© 2007 by The American Society of Hematology
2210
BLOOD, 1 MARCH 2007 䡠 VOLUME 109, NUMBER 5
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
BLOOD, 1 MARCH 2007 䡠 VOLUME 109, NUMBER 5
YAC constructs in which the general organization of the locus has
been altered. This disturbance of the locus structure complicates
the interpretation of those studies. Furthermore, because even
large, intact, wild-type human b-globin YAC transgenes can
occasionally have little or no expression11,12 or experience some
degree of variegation at a higher frequency,13 concerns remain that
the YACs do not, in fact, harbor the full cis-regulatory requirements
of the endogenous human locus. Therefore, it is important to reexamine
the conclusions drawn from transgene constructs at the endogenous
mouse locus with minimal disturbance of the overall structure.
In addition, none of these experiments explicitly addressed how
genes expressed at the same developmental stage influence one
another. Given that the mouse genome can be modified through
homologous recombination (HR) in embryonic stem (ES) cells to
generate mutant mice and that there are multiple genes for each
development stage, the murine ␤-globin locus provides an excellent alternative system to study the interactions among the ␤-like
globin genes. Previous studies in our laboratory and in others have
found that when the endogenous ␤major⌬ gene was deleted by
random mutation from the mouse endogenous locus (Thal-1
mutation), expression of the downstream ␤minor⌬ gene increased14 (J. Roach, S.F., unpublished observations, October 2001).
To investigate the gene interaction mechanisms at the endogenous locus, we previously produced and reported analyses of the
individual deletions of the promoters of each of the 2 major murine
embryonic genes, Ey (⌬Ey) and ␤h1 (⌬␤h1), in ES cells and in
mice bearing these mutations.15 In the current study, the promoters
of both major embryonic genes were simultaneously deleted, and
the phenotype was analyzed in mice. Results reveal that the
deletion of Ey, ␤h1, or both increases ␤major and ␤minor
expression in the embryo, consistent with the LCR competition
model. However, deletion of Ey did not affect the transcription of
␤h1 nor did the transcription of ␤h1 affect the deletion of Ey, which
is not consistent with the LCR competition model. Moreover,
deletion of Ey greatly increases transcription of ␤h0 (a weakly
expressed embryonic gene), without affecting ␤h1, whereas deletion of ␤h1 had no effect on either Ey or ␤h0. These results are
consistent with direct transcriptional interference of Ey on ␤h0.
Materials and methods
Generation of Ey and ␤h1 promoter replacement and deletion mice
Targeting constructs used for Ey promoter deletion (pEyprd-Hygro) and for
␤h1 promoter deletion (p␤h1prd-Neo) have been described.15 To generate
mice with Ey and ␤h1 promoters deleted in cis, embryonic stem cell (ES)
clones with the ␤h1 promoter targeted by p␤h1prd-Neo were electroporated
with the pEyprd-Hygro construct. ES clones correctly targeted in cis with
both promoter replacements were used to generate promoter replacement
chimeric mice.
Southern blot assay for ES cell and mouse genotyping
Mouse tail DNA was prepared with the PureGene DNA Isolation kit
(catalog no. D-70KB; Gentra Systems, Minneapolis, MN). The probe used
for Southern blotting is a 0.7-kb BamHI/XbaI fragment located upstream of
␤h1 (BamH1 site is 7633 bp and XbaI site is 8307 bp from the transcription
start site of Ey).
RT-PCR assay of expression of ␤-like globin genes
The assay system uses polymorphisms in the gene-coding regions between
mice with the diffuse Hbb(d), (D) haplotype, on which the mutations are
made, and mice with the single Hbb(s), (S) haplotype of ␤-like globin. The
MURINE ␤-GLOBIN TRANSCRIPTIONAL INTERFERENCE
2211
assay compares expression from the S allele to expression from the D allele
in D/S heterozygous mice that are either wild-type or mutant at the D allele.
The PCR primers and the system for the assay of Ey, ␤h1, ␤-major, and
␤-minor have been described.16 In short, the primers are exact matches for
genes from the D and S haplotypes, but within the amplified region of the
cDNA is a restriction site found in one haplotype but not the other.
Amplified products were labeled with radioactive nucleotides during the
last cycle of the PCR, digested with the appropriate restriction enzyme, and
separated by size on an acrylamide gel, and the product of each allele was
quantitated. Each product was amplified and assayed by itself with no
multiplexing, and each gene-specific PCR had its own optimized number of
cycles, as reported.16 The ␤h0 expression was achieved with RT-PCR to
amplify the ␤h0 and the ␤h1 cDNA and with RFLP differences between the
amplified regions to compare levels of ␤h0 with levels of ␤h1. Primers for
␤h0 expression were 5⬘CTCTGGGAAGGCTCCTGATTG3⬘ and 5⬘CCCAGGAGCTTGAAGTTCTC3⬘. PCR products (242 bp) were digested with
BslI to differentiate amplicons from ␤h1 (242 bp) and ␤h0 (131 bp and 111
bp) cDNA. For this assay in cells that are D/S, the total ␤h1 signal from the
S allele (the S allele lacks ␤h0 because of a natural deletion) and the D allele
was divided by 2 to represent the ␤h1 transcripts from one allele. Primers
for ␤h2 expression were 5⬘GTGCTGCCACTGAAGGTA3⬘ and 5⬘CTCAAAAGCAGCTTGCAGTG3⬘. Primers for ␤h3 expression were 5⬘ACTTTGGCAAGGAATTCAA3⬘ and 5⬘GGCCTCTGTGGTACTTGTG3⬘. Primers are perfect matches for ␤h3 and imperfect matches for Ey, and the
products can be differentiated by restriction digest.
Protein assays of ␤-like globin components in primitive and
definitive erythroid cells
Circulating primitive blood was collected from embryonic day 10.5 (e10.5)
wild-type or mutant embryos. As described previously, HPLC analyses
were performed with a 3-step acetonitrile gradient ranging from 35% to
approximately 55% after treatment of the samples with cystamine.17
Protein identification by LC-FTMS
Soluble protein samples were digested with trypsin (Promega, Madison,
WI) in ammonium bicarbonate buffer (50 mM) overnight at 37°C, followed
by acidification with 5% formic acid and desalting on STAGE tips.18 Liquid
chromatography–tandem mass spectrometry (LC-MS/MS) was performed
using an LTQFT hybrid linear (2-D) ion trap-Fourier transform ion
cyclotron resonance (FTICR) mass spectrometer (ThermoElectron, San
Jose, CA) as described previously.19,20
Results
Production of the double embryonic gene promoter deletion mice
Mice were generated with the promoter regions of Ey and ␤h1
deleted in cis through sequential homologous recombination (Figure 1A). Each deleted region roughly measured 1.1 kbp, spanning
from 700 bp 5⬘ to the transcription start site to near the 3⬘ end of
exon 2 of each gene.15 One of the ES clones previously targeted to
replace the ␤h1 promoter with neo (⌬␤h1neo) was retargeted with
the construct that replaced the Ey promoter with hygro (⌬Eyhygro). ES clones were screened for targeting of Ey, and Southern
blots were used to identify clones that were targeted on both alleles
in cis rather than in trans (Figure 1B).
Mice derived from double-promoter replacement ES cells
(⌬Eyhygro⌬␤h1neo) were generated by standard techniques and
bred with CMV-Cre transgenic mice to delete the selectable
marker. The deletion was efficient and generated 2 new strains,
denoted ⌬Ey⌬␤h1 and ⌬Ey(inv)⌬␤h1 (Figure 1C). Because 2 Lox
P sites in opposing orientations were retained in the locus, the Cre
recombinase induced an additional inversion of the intergenic
sequence between Ey and ␤h1, which is flanked by the 2 Lox P
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
2212
HU et al
Figure 1. Deletion and Southern blot strategies to generate ⌬Ey⌬␤h1 promoter
deletion mice. (A, I) Schematic map of the Hbb(d) allele. (arrows) LCR hypersensitive sites. (f) ␤-like globin genes. (II) Ey and ␤h1 genes with exons marked. Deleted
regions from each gene are indicated by solid lines under the gene names. (III) Ey
promoter was replaced by PGK-hygro, and ␤h1 promoter was replaced by PGK-neo.
(Œ) Selectable markers were each flanked by 2 convergent lox P sites and were
removed by Cre recombinase-mediated deletion. (arrows) Selectable marker transcriptional start and orientation (IV). Cre recombinase also mediated an additional
inversion of DNA between the 2 LoxP sites left from the deletion of the selectable
markers and resulted in 2 double-promoter deletion alleles, ⌬Ey⌬␤h1 and
⌬Ey(inv)⌬␤h1. (arrows) Transcriptional orientation of ␤h0 on each allele. (B)
Southern blot strategies and representative Southern blot used to screen for
⌬Eyhygro⌬␤h1neo ES clones modified in cis after homologous recombination.
Restriction sites for SpeI are marked as S. The probe is denoted as a short line under
each map. Note that the expected band for wild-type Hbb(d) measures 42.2 kb, which
is not shown on the gel. Each lane represents a single ES clone. (C) Southern blot
strategies and representative Southern blot to screen for ⌬Ey⌬␤h1 and ⌬Ey(inv)⌬␤h1
promoter deletion alleles in mice after Cre-mediated selectable marker deletion in
vivo. Restriction sites for Nsi I are marked as N, and the probe used is a line underneath
each allele. Expected band sizes for each genotype are marked accordingly.
sites to produce ⌬Ey(inv)⌬ ␤h1. In the ⌬Ey(inv)⌬ ␤h1 strain, the
␤h0 gene was relocated 5 kbp further from the LCR and was
transcribed in the direction opposite that of the endogenous gene
(Figure 1A). To maintain genotype stability, ⌬Ey⌬␤h1 and
⌬Ey(inv)⌬ ␤h1 mice were bred with 129 SvJ mice, and offspring
were screened for the Cre gene by PCR. Only Cre-negative mice
were used to generate mice for subsequent studies
Because the major embryonic ␤-like globins are not expressed
from the ⌬Ey⌬␤h1 allele, it was possible that thalassemia would
develop in homozygous embryos in utero. Sibling matings of each
of the promoter deletion strains were set up to test the viability of
homozygous mutant mice. Both ⌬Ey⌬␤h1 and ⌬Ey(inv)⌬␤h1
homozygous mice are born at normal Mendelian frequency and are
viable through adulthood.
Transcription of other ␤-type globin genes in the Ey and
␤h1 promoter-deleted embryos
Viability of homozygous ⌬Ey⌬␤h1 mutants suggests that other
␤-like globin genes are up-regulated during primitive erythropoiesis. HPLC analysis of ␤-like globin protein content in primitive
BLOOD, 1 MARCH 2007 䡠 VOLUME 109, NUMBER 5
erythroid cells was performed on heterozygous mice to investigate
the identity of expressed globin chains. Levels of ␤-major and
␤-minor in ⌬Ey⌬␤h1/S embryos increased from less than 3%
(below detection) to 14% of the total ␤-like globin output. In
addition, a prominent unidentified protein peak composing more
than 24% of the total ␤-like globin output from the mutant allele
was observed (Figure 2B-C). HPLC characteristics suggest that this
peak is a novel embryonic ␤-like globin chain.
Based on DNA sequence and gene structure, 3 ␤-like globin
genes—␤h0, ␤h2, and ␤h3—have been predicted in the mouse D
allele; however, these putative genes have not been analyzed
extensively. ␤h0 is located 3⬘ of Ey, whereas ␤h2 and ␤h3 are
located 3⬘ of ␤h1 (Figure 3A). Low-level expression of ␤h0 has
been observed,21 but no expression of ␤h2 or ␤h3 has been reported
and they have been considered pseudogenes, though their intron/
exon structure is that of a normal globin gene. To determine
whether the new protein peak is encoded by any of these genes, we
designed RT-PCR assays to examine their potential transcription.
Gene-specific PCR primers designed to assay ␤h2 are in
different putative exons; thus, amplified cDNA is distinguishable
from genomic DNA by its smaller size. As shown in Figure 3B, the
␤h2 gene-specific primers did not detect spliced ␤h2 mRNA from
e10.5 yolk sac and only detected contaminating genomic DNA or
background bands that were not the expected size and did not show
different levels with different mouse genotypes. Thus, ␤h2 was not
expressed in any of the mutant mice. To detect ␤h3 cDNA, a pair of
primers was designed to perfectly match and amplify ␤h3. When
these primers were used under normal annealing conditions, no
products were amplified from the cDNA of wild-type or mutant
mouse e10.5 yolk sacs. Primers contained mismatches for Ey (2
mismatches on each primer), and, by lowering the annealing
temperature, cDNA was amplified from all samples. Any ␤h3
amplicon should be digested with NcoI but not with PvuII, whereas
amplified Ey cDNA should be digested with PvuII but not NcoI. As
Figure 2. HPLC assays identify a new peak in peripheral primitive erythroid
cells from ⌬Ey⌬␤h1 embryos. (A) HPLC of cell lysate of e10.5 circulating blood
from wild-type D/S embryo shows identified elution peaks from the wild-type D and S
alleles. Ey1 is from the S allele, and Ey2 is from the D allele. The ␤h1 peak includes
protein from D and S, and alpha and zeta are ␣-like globin chains. (B) HPLC of cell
lysate of d10.5 circulating blood from ⌬Ey⌬␤h1/S embryo. Identified elution peaks
include alpha and zeta and from the S allele, Ey1, and ␤h1. The Ey2 peak from D is
missing. A peak represents ␤-major and ␤-minor (beta), and a new peak (?)
represents a novel ␤-like globin chain. (C) HPLC of cell lysate of mixed e10.5
circulating blood from wild-type D/S and ⌬Ey⌬␤h1/S embryos shows that the new
peak (?) is distinguished from Ey1 and Ey2.
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
BLOOD, 1 MARCH 2007 䡠 VOLUME 109, NUMBER 5
MURINE ␤-GLOBIN TRANSCRIPTIONAL INTERFERENCE
2213
4C) but not in ⌬␤h1/S animals (Figure 4D). The activation of ␤h0
correlated with deletion of the Ey promoter, and, when activated,
its transcription level was comparable to that of ␤h1 because the
␤h0/␤h1 ratio was close to 1 (Figure 4E). The ␤h0 expression level
in ⌬Ey and ⌬Ey⌬␤h1 was more than 20-fold higher than in
wild-type mice. In the ⌬Ey/S mutants, ␤h0 expression was similar
to the level in ⌬Ey⌬␤h1/S mutants. These results demonstrated
that the activation of ␤h0 was caused by the deletion of the Ey
promoter and that the deletion of the ␤h1 promoter did not have a
detectable influence on ␤h0 transcription.
Transcription of ␤h0 is inversely proportional to transcription
levels of Ey
Figure 3. ␤h2 and ␤h3 are not expressed in any of the promoter-deletion
embryos. (A) Schematic map of the D allele with the highly expressed ␤-like globin
genes as dark bars and genes potentially expressed at low levels as white bars. (B)
RT-PCR analysis of ␤h2 transcription in cDNA from e10.5 yolk sac. Lanes with
genomic DNA (50 ng) are labeled G, marker lanes are labeled M, and genotypes of
yolk sac samples are labeled. Expected sizes of PCR products from the ␤h2 cDNA
and genomic DNA are marked. Genomic bands verify the ability to amplify the ␤h2
cDNA if it was present. (C) RT-PCR analysis of ␤h3 transcription in cDNA from e10.5
wild-type D/S (lanes 1-3), ⌬␤h1/S (lanes 4, 5), ⌬Ey/S (lanes 6, 7), and ⌬Ey⌬␤h1/S
(lanes 8, 9) yolk sac. G represents genomic DNA. PCR primers preferentially
amplified cDNA from ␤h3 and, less efficiently, from Ey (2 mismatches on both
primers). Uncut bands from any gene measured 96 bp. ␤h3 can be distinguished from
Ey because the ␤h3 amplicon cut with NcoI to 64 bp but not with PvuII and the Ey
amplicons cut with PvuII to 75 bp but not with NcoI.
It has been reported, by us and by others,22-24 that the transcription
of one gene can suppress the transcription of other genes linked in
cis through direct transcriptional interference (TI), which could
involve multiple mechanisms. The physical relationship of the
genes involved in TI influences the degree of suppression of each
gene.22 It is possible that transcription from Ey suppresses ␤h0
through direct transcriptional interference rather than competition
for the LCR.
If direct transcriptional interference were involved, any change
in cis or trans that resulted in reduced Ey transcription would
increase the level of ␤h0. Recently, Tanabe et al (O.T., Yannan
Shen, Shoko Kobayashi, David McPhee, William Brandt, Xia Jang,
Andrew D. Campbell, Yei-Tsung Chen, Chawnshang Chang,
Masayuki Yamamoto, Keiji Tanimoto, and J.D.E., manuscript
submitted) generated mice overexpressing the orphan receptors
TR2 and TR4. These orphan receptors form a complex that
suppresses Ey but does not suppress the ␤h1 or adult ␤-globin
genes in primitive erythrocytes (O. Tanabe et al, manuscript
shown in Figure 3C, the amplification product was not digestible
with NcoI and was completely digestible with PvuII, indicating that
amplified cDNA was from Ey and that no transcription from ␤h3
was detected.
Activated transcription of ␤h0 correlates with deletion
of the Ey promoter
␤h0 is highly homologous to ␤h1 in the coding and the promoter
regions. To distinguish the transcription of ␤h0 from that of ␤h1,
we designed primers to perfectly match ␤h0 and ␤h1 cDNA.
Primers recognized ␤h1 from either the D or the S haplotype, and
the S haplotype had a deletion of the promoter and the first exon of
␤h0. The amplified region contained an RFLP at which BslI
uniquely digested the PCR product from ␤h0. This RFLP allowed
us to quantify PCR products from ␤h0 relative to ␤h1 after BslI
digestion (Figure 4A). RT-PCR analysis of e10.5 yolk sac cDNA
generated from wild-type D/S and ⌬Ey⌬␤h1/S embryos showed
that ␤h0 was activated in the ⌬Ey⌬␤h1 mutant primitive erythroid
cells (Figure 4B). The distinct increase in ␤h0 transcription, along
with a lack of detectable transcript from any of the other potentially
expressed genes, suggested that the novel HPLC peak in ⌬Ey⌬␤h1
embryos was ␤h0 protein and that ␤h0 mRNA could be translated
into a stable globin protein.
To further dissect the mechanism underlying ␤h0 regulation, we
assayed ␤h0 expression in our single-promoter deletion mutants,
⌬Ey and ⌬␤h1. As reported previously,15 the transcription of ␤h1
was not changed by the deletion of the Ey promoter. Hence, the
transcription level of ␤h0 could be compared with that of ␤h1
directly, even on the ⌬Ey allele. Assays of ⌬Ey/S and ⌬␤h1/S
animals showed that ␤h0 was activated in ⌬Ey/S animals (Figure
Figure 4. ␤h0 is activated exclusively during primitive erythropoiesis in
embryos with the promoter of Ey deleted. (A) Steady state RT-PCR strategy to
detect and quantitate transcription from ␤h0. PCR primers were perfect matches for
␤h0 and ␤h1 cDNA. (asterisk) The amplified region contained one restriction enzyme
site in ␤h0 (Bsl I) that was not present in ␤h1 cDNA. Amplified cDNA from e10.5 yolk
sacs of wild-type D/S and (B) ⌬Ey⌬␤h1/S, (C) ⌬Ey/S, and (D) ⌬␤h1/S. All samples
were digested with Bsl I. (E) Quantitation of ␤h0 expression in each mutant genotype
comparing the ratio of ␤h1 (uncut) and ␤h0 (cut), adjusted for the number of active
␤h1 alleles. Error bars represent SD of at least 3 embryos of that genotype in a litter.
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
2214
HU et al
BLOOD, 1 MARCH 2007 䡠 VOLUME 109, NUMBER 5
submitted). Consistent with this, 2 independent transgenic TR2/
TR4 lines expressing elevated levels of TR2 and TR4 displayed
correspondingly lowered accumulation of Ey mRNA. We found
that ␤h0 is also activated in the yolk sac of those transgenic mice
(Figure 5) and that the transcript level of ␤h0 is inversely
proportional to the level of Ey expression. Line 1, which expresses
less of the TR2/TR4 transgene than line 2, has 2-fold higher levels
of Ey and half the amount of ␤h0 than line 2. Therefore, a trans
alteration that reduced the transcription of Ey increased the
transcription of ␤h0 inversely to the reduction of Ey.
We generated mice in which the Ey promoter was replaced by
the PGK-hygro selectable marker transcribed away from ␤h0. In
this strain, the expression of ␤h0 in yolk sac was well above the
amount expressed from a wild-type allele but approximately 60%
of the level expressed from an allele with the Ey promoter deleted
and in which the selectable marker was removed (Figure 6A).
Previous studies with human transgenic loci have shown that
changing the distance of a ␤-like gene from the LCR could affect
its developmental expression pattern.8,9,25,26 It is less clear whether
distance from the LCR directly affected expression level. During
the removal of the selectable markers by Cre, mice were generated
with an inversion of the region between Ey and ␤h1, including the
␤h0 gene. In the ⌬Ey(inv)⌬␤h1 mutants, the ␤h0 gene is relocated
5 kbp further from the LCR compared with its wild-type location
and is transcribed in the reverse direction. To determine how these
alterations in location and transcriptional orientation might affect
gene expression, we assayed ␤h0 expression in e10.5 yolk sac from
the ⌬Ey(inv)⌬␤h1 mutants (Figure 6B). Compared with ␤h0
transcription in ⌬Ey and ⌬Ey⌬␤h1mutants (Figure 6C), transcription of ␤h0 in ⌬Ey(inv)⌬␤h1 was reduced approximately 2.5-fold.
Figure 6C summarizes the levels of ␤h0 expression in all genotypes
of mice assayed.
Bh0 protein is produced and forms a complex with ␣-globin
The demonstration that ␤h0 message is increased by at least
20-fold after deletion of the Ey promoter strongly suggests that the
unknown protein peak in Figure 2 is ␤h0. Experiments using mass
spectrometry in conjunction with HPLC were undertaken to
definitively determine whether ␤h0 was expressed at the protein
level and corresponded to the unknown peak in Figure 2.
Protein extracts of homozygous ⌬Ey⌬␤h1 circulating e10.5
primitive cells were run on a nondenaturing isoelectric focusing
gel, and the complexes that were visually revealed by staining with
o-dianisidine were cut out and eluted from that gel. Three novel
bands were analyzed by mass spectrometry. Band 1 contained ␤h0
as a major component. The protein in this band was then analyzed
by HPLC (Figure S2, available on the Blood website; see the
Supplemental Figures link at the top of the online article), and
results were compared with those from HPLC analysis of protein
Figure 6. Activation of ␤h0 transcription is influenced by multiple parameters in
mice with reduced Ey transcription. (A) Schematic map of ⌬Eyhygro allele. (o)
Selectable marker gene PGK-Hygro. (arrow) Its transcriptional direction. Representative gel and quantitation of ␤h0 expression in e10.5 wild-type D/S and ⌬Eyhygro/S
yolk sacs. Error bars represent SD of at least 3 littermates with the genotype marked
throughout. (B) Schematic map of ⌬Ey(inv)⌬␤h1 allele. (■) ␤h0 gene that was
relocated 5 kb further away from the LCR on the mutant allele compared with the
wild-type allele. (arrow) Inversion also changed the transcription direction of the ␤h0
gene on this mutant allele. Representative gel and quantitation of ␤h0 expression in
e10.5 wild-type D/S and ⌬Ey⌬␤h1(inv)/S yolk sacs. (C) Comparative summary of ␤h0
transcription in various mutants in which it has increased transcription.
from circulating primitive erythrocytes of ⌬Ey⌬␤h1 mice (Figure
S3). Band 1 contained the same peak found in homozygous and
heterozygous ⌬Ey⌬␤h1 mice; thus, this peak was definitively
identified as ␤h0. In band 1, ␤h0 and ␣-globin were found in
roughly the same amount as ␤h0 (Figure S2), demonstrating that
␤h0 can form a complex with ␣-globin. No ␨-globin was found in
band 1, and bands 2 and 3 did not have significant amounts of ␤h0.
Hence, it appeared that ␤h0 did not form a complex with ␨-globin.
Deletion of the Ey or ␤h1 gene promoters induces ␤-major and
␤-minor expression in primitive erythroid cells
Figure 5. Transcription level of Ey directly regulates ␤h0. (A) Representative gel
of ␤h0 expression in e10.5 wild-type and TR2/TR4 transgenic yolk sacs. Genotype of
each sample is marked above the gel, and 2 TR2/TR4 transgenic lines are noted as
line 1s and 2. All samples were digested with Bsl I. (B) Quantitation of ␤h0 expression
in e10.5 wild-type and 2 different TR2/TR4 transgenic lines. Error bars represent SD
of at least 3 embryos of that genotype.
To test the hypothesis that transcription of the embryonic ␤-globin
genes suppresses transcription of the fetal/adult ␤-globin genes
during embryonic erythropoiesis, we analyzed the transcription and
translation of the murine fetal/adult ␤-major and ␤-minor genes in
the yolk sac primitive erythroid cells from the embryonic gene
promoter deletion embryos.
Transcription of ␤-major and ␤-minor from the wild-type D
allele or the mutant D allele was normalized to the transcription of
␤s and ␤t from the wild-type S allele. Results revealed that the
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
BLOOD, 1 MARCH 2007 䡠 VOLUME 109, NUMBER 5
MURINE ␤-GLOBIN TRANSCRIPTIONAL INTERFERENCE
2215
Discussion
Figure 7. Deletion of either or both embryonic gene promoter(s) increased
transcription of ␤-major/minor in primitive erythroid cells. (A) Representative
RT-PCR/RFLP assay of ␤-major/minor transcription in e10.5 ⌬Ey/S, ⌬␤h1/S, and
⌬Ey⌬␤h1/S yolk sac primitive erythroid cells. Sample genotypes are marked above
the gel. (B) Quantitation of ␤-major/minor transcription in yolk sac of promoter
deletion mutants. Each pair of bars represents data from 2 litters, with a total of at
least 12 embryos with error bars denoting SD. Mutations assayed and days of
gestation are indicated below the graph. Wild-type ratios from e10.5 and e11.5 were
close to 1 and were normalized to 1, and the mutant ratio was similarly adjusted. Wild-type
ratios from e9.5 were not normalized and are represented as simple D/S ratios from each
genotype. All mutant ratios are statistically different from wild-type ratios (P ⬎ .05) for e10.5
and e11.5 but not e9.5. (C) Representative RT-PCR/RFLP assay and (D) quantitation
of ␤-major/minor transcription in ⌬Ey/S, ⌬␤h1/S, and ⌬Ey⌬␤h1/S adult peripheral
blood. Genotype of each sample is marked above the gel. Each pair of bars
represents data from least 5 adult mice. Wild-type D/S ratios were normalized to 1.
deletion of both embryonic gene promoters (⌬Ey⌬␤h1/S) or the
deletion of a single embryonic gene promoter (⌬Ey/S or ⌬␤h1/S)
increased the transcription of ␤-major and ␤-minor from the
mutant alleles in e10.5 primitive erythrocytes (Figure 7A-B).
HPLC quantitation of the ␤-like globin chains in e10.5 ⌬Ey⌬␤h1/S
and wild-type D/S primitive erythroid cells showed that the level of
adult ␤-globin chains in ⌬Ey⌬␤h1/S primitive erythroid cells
increased to 14% of total ␤-like globin chains (from a possible 50%
of total ␤-like globin chains that can derive from one allele)
compared with less than 5% in wild-type D/S primitive erythroid
cells (Figure 2). The increase was not apparent in e9.5 day
postcoital (dpc) red blood cells. In these cells, very high D/S ratios
were identical between wild-type and promoter deletion mice. For
clarity, all ratios in wild-type mice except those from e9.5 embryos
were normalized to 1.
Embryonic globin genes were not expressed in definitive cells
of the murine fetus or the adult. No effect of embryonic promoter
deletion on ␤-major and ␤-minor transcription in definitive cells
was observed in the ⌬Ey⌬␤h1/S mutants (Figure 7C-D). Protein
quantification by HPLC analysis confirmed the results of RT-PCR
assays (data not shown).
Transcriptional interference (TI) is a broad term that describes
situations in which the transcription of one gene suppresses the
transcription of nearby genes. A variety of mechanisms can be
involved in transcriptional interference. It has been reported,
primarily from studies of human transgenes in mice, that the
transcription of one gene at the ␤-globin locus can suppress the
transcription of other genes. The physical arrangement of genes at
the locus is thought to be important for developmental gene
regulation through transcriptional interference. The prevalent hypothesis regarding TI among genes at the ␤-globin locus is that
␤-like globin genes compete for LCR interaction. It is hypothesized
that LCR–promoter interaction is accomplished by a looping
mechanism that brings the LCR and the activated promoter in
contact in a physical interaction required for transcriptional activation.27 Other possible mechanisms proposed for the TI effects
include tracking28 or linking29 of proteins from the LCR and direct
transcriptional interference.30 Results reported here suggest that
multiple mechanisms are involved in TI among the ␤-like globin
genes and that the mechanisms influencing the embryonic genes
differ from those influencing the fetal/adult genes.
It has been shown that high-level transcriptional activation of
the embryonic genes at the endogenous locus requires the LCR.35
Therefore, if all the murine embryonic ␤-like globin genes
competed for LCR interaction, deletion of one embryonic gene
would increase transcription of the other embryonic ␤-like globin
genes, but this was not the case. As reported previously and
reiterated here, deletion of the Ey promoter did not increase ␤h1
transcription, and deletion of ␤h1 did not increase Ey transcription.
Deletion of the Ey promoter did dramatically increase ␤h0
transcription, but deletion of ␤h1 had no effect on ␤h0. Although
these data demonstrated no direct competition between Ey and
␤h1, Ey transcription interfered with ␤h0.
The observed ␤h0 suppression by Ey could have occurred
through 2 possible mechanisms, directionally polar LCR competition or direct transcriptional interference. Given that Ey is upstream
of ␤h0, any of the 3 LCR–gene interaction models could potentially explain how Ey suppresses ␤h0. However, because all the
LCR–gene interaction models predicted favored LCR interaction
and, therefore, transcription of the LCR proximal gene, they all
faced the dilemma of why ␤h0—which is LCR proximal compared
with ␤h1—was suppressed by Ey transcription whereas the LCR
distal ␤h1 was not affected by Ey transcription. Given that the gene
promoters of ␤h1 and ␤h0 were almost identical (Figure S3) and
that they had similar transcription levels after the removal of the Ey
promoter, it was unlikely that the preference resulted from intrinsic
properties of different promoters. A plausible alternative explanation is that Ey did not suppress ␤h0 by competing for the LCR but
by direct transcriptional interference. This explanation is consistent
with the fact that neither Ey nor ␤h1 transcriptionally interfered
with the other. The finding that the specific reduction in Ey by
transgenic overexpression of TR2/TR4 also stimulated ␤h0 expression supports the model that direct transcriptional interference
accounted for the suppression of ␤h0 by Ey.
Clearly, multiple molecular mechanisms account for transcriptional interference, and they are poorly understood. Because of the
proximity and tandem arrangement of the Ey and ␤h0 genes, we
propose that transcription from Ey disrupts the recruitment of
transcriptional regulatory factors and transcription machinery to
the ␤h0 promoter (promoter occlusion), as has been demonstrated
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
2216
BLOOD, 1 MARCH 2007 䡠 VOLUME 109, NUMBER 5
HU et al
in other models.23,31 This possibility is related to the fact that
mammalian polII proceeds past the polyA site and does not have a
specific termination site (for a review, see Rosonina et al32). The
data showing that PGK-hygro, which replaced the Ey promoter and
was transcribed in the opposite direction, only mildly suppressed
␤h0 supported the hypothesis that direct transcriptional interference by promoter occlusion was the primary mechanism by which
Ey suppressed ␤h0.
Acknowledgments
This work was supported by National Institutes of Health–
National Institute of Diabetes and Digestive and Kidney Diseases
grant RO1 DK54071 (S.F.) and by a Burroughs-Wellcome Fund
Career Award (M.B.).
We thank the staff at the Dartmouth Transgenic Mouse Facility
of the Norris Cotton Cancer Center for producing the transgenic
mice and Sandra Warner for assisting with ES cell culture.
Authorship
Contribution: X.H. designed and performed the research and wrote
the paper; S.E. designed and performed the research; N.P. performed the research; E.E.B. designed and performed the research
and wrote the paper; J.F. performed the research; O.T. contributed
new reagents; S.A.G. designed and performed the research; M.B.
designed and performed the research and wrote the paper; J.D.E.
designed the research, contributed new reagents, and wrote the
paper; M.G. designed the research and wrote the paper; and S.F.
designed and performed the research and wrote the paper.
Conflict of interest disclosure: The authors declare no competing financial interests.
Correspondence: Steven Fiering, Department of Microbiology/
Immunology and Norris Cotton Cancer Center, 622 Rubin, Dartmouth Hitchcock Medical Center, Dartmouth Medical School,
Lebanon, NH 03756; e-mail: [email protected].
References
1. Stamatoyannopoulos G, Grosveld F. Hemoglobin
switching. In: Stamatoyannopoulos G, Majerus
PW, Perlmutter RM, Varmus H, eds. The Molecular Basis of Blood Diseases. Philadelphia, PA:
WB Saunders; 2001:135-182.
12. Gaensler K, Zhang Z, Lin C, Yang S, Hardt K,
Flebbe-Rewahldt L. Sequences in the A␥-␦ intergenic region are not required for the stage-specific regulation of the human ␤-globin locus. Proc
Nat Acad U S A. 2003;100:3374-3379.
2. Raich N, Enver T, Nakamoto B, Josephson B,
Papayannopoulou T, Stamatoyannopoulos G.
Autonomous developmental control of human
embryonic globin gene switching in transgenic
mice. Science. 1990;250:1147-1149.
13. Alami R, Greally J, Tanimoto K, et al. ␤-Globin
YAC transgenes exhibit uniform expression levels
but position effect variegation in mice. Human
Mol Genet. 2000;9:631-636.
23. Martens JA, Wu PY, Winston F. Regulation of an
intergenic transcript controls adjacent gene transcription in Saccharomyces cerevisiae. Genes
Dev. 2005;19:2695-2704.
14. Skow L, Burkhart B, Johnson F, et al. A mouse
model for ␤-thalassemia. Cell. 1983;34:10431052.
24. Proudfoot N. Transcriptional interference and termination between duplicated ␣-globin gene constructs suggests a novel mechanism for gene
regulation. Nature. 1986;322:562-565.
3. Epner E, Reik A, Cimbora D, et al. The ␤-globin
LCR is not necessary for an open chromatin
structure or developmentally regulated transcription of the native mouse ␤-globin locus. Mol Cell.
1998;2:447-455.
4. Starck J, Sarkar R, Romana M, et al. Developmental regulation of human gamma- and ␤-globin
genes in the absence of the locus control region.
Blood. 1994;84:1656-1665.
5. Bender M, Bulger M, Close J, Groudine M. ␤-Globin gene switching and DNaseI sensitivity of the
endogenous ␤-globin locus in mice do not require
the locus control region. Mol Cell. 2000;5:387393.
6. Behringer RR, Hammer RE, Brinster RL, Townes
TM. Human gamma to beta-globin switching in
transgenic mice. Genes Dev. 1990;4:380-389.
7. Enver T, Raich N, Ebens AJ, Papayannopoulou T,
Costantini F, Stamatoyannopoulos G. Developmental regulation of human fetal-to-adult globin
gene switching in transgenic mice. Nature. 1990;
344:309-313.
8. Dillon N, Trimborn T, Strouboulis J, Fraser P,
Grosveld F. The effect of distance on long-range
chromatin interactions. Mol Cell. 1997;1:131-139.
9. Tanimoto K, Liu Q, Bungert J, Engel J. Effects of
altered gene order or orientation of the locus control region on human ␤-globin gene expression in
mice. Nature. 1999;398:344-347.
10. Choi OR, Engel JD. Developmental regulation of
␤-globin gene switching. Cell. 1988;55:17-26.
11. Kaufman RM, Pham CT, Ley TJ. Transgenic analysis of a 110-kb human ␤-globin cluster-containing DNA fragment propagated as a bacterial artificial chromosome. Blood. 1999;94:3178-3184.
15. Hu X, Bulger M, Roach JN, et al. Promoters of the
murine embryonic ␤-like globin genes Ey and ␤h1
do not compete for interaction with the ␤-globin
locus control region. Proc Natl Acad Sci U S A.
2003;100:1111-1115.
16. Fiering S, Epner E, Robinson K, et al. Targeted
deletion of 5’HS2 of the murine ␤-globin locus
reveals that it is not essential for proper regulation of the ␤-globin locus. Genes Dev. 1995;9:
2203-2213.
17. Alami R, Bender M, Feng YQ, et al. Deletions
within the mouse ␤-globin locus control region
preferentially reduce ␤-minor globin gene expression. Genomics. 2000;63:417-424.
18. Rappsilber J, Ishihama Y, Mann M. Stop and go
extraction tips for matrix-assisted laser desorption/ionization, nanoelectrospray and LC/MS
sample pretreatment in proteomics. Anal Chem.
2003;75:663-670.
19. Dieguez-Acuna FJ, Gerber SA, Kodama S, et al.
Characterization of mouse spleen cells by subtractive proteomics. Mol Cell Proteomics. 2005;4:
1459-1470.
20. Everley PA, Bakalarski CE, Elias JE, et al. Enhanced analysis of metastatic prostate cancer
using stable isotopes and high mass accuracy
instrumentation. J Proteome Res. 2006;5:12241231.
21. Farace MG, Brown BA, Raschella G, et al. The
mouse beta h1 gene codes for the z chain of embryonic hemoglobin. J Biol Chem. 1984;259:
7123-7128.
22. Eszterhas S, Bouhassira E, Martin DIK, Fiering S.
Transcriptional interference by independently
regulated genes occurs in any relative arrangement of the genes and is influenced by chromosomal integration position. Mol Cell Biol. 2002;22:
469-479.
25. Hanscombe O, Whyatt D, Fraser P, et al. Importance of globin gene order for correct developmental expression. Genes Dev. 1991;5:13871394.
26. Peterson KR, Stamatoyannopoulos G. Role of
gene order in developmental control of human
gamma- and beta-globin synthesis. Mol Cell Biol.
1993;13:4836-4843.
27. Foley KP, Engel JD. Individual stage selector element mutations lead to reciprocal changes in
beta- vs. epsilon-globin gene transcription: genetic confirmation of promoter competition during
globin gene switching. Genes Dev. 1992;6:730744.
28. Ling J, Ainol L, Zhang L, Yu X, Pi W, Tuan D. HS2
enhancer function is blocked by a transcriptional
terminator inserted between the enhancer and
the promoter. J Biol Chem. 2004;279:5170451713.
29. Bulger M, Groudine M. Looping vs. linking: toward a model for long-distance gene activation.
Genes Dev. 1999;13:2465-2477.
30. Martin DIK, Fiering S, Groudine M. Regulation of
␤-globin gene expression: straightening out the
locus. Curr Opin Genet Dev. 1996;6:488-495.
31. Greger I, Demarchi F, Giacca M, Proudfoot N.
Transcriptional interference perturbs the binding
of Sp1 to the HIV-1 promoter. Nucl Acids Res.
1998;26:1294-1300.
32. Rosonina E, Kaneko S, Manley J. Terminating the
transcript: breaking up is hard to do. Genes Dev.
2006;20:1050-1056.
From www.bloodjournal.org by guest on August 11, 2017. For personal use only.
2007 109: 2210-2216
doi:10.1182/blood-2006-06-029868 originally published
online October 31, 2006
Transcriptional interference among the murine β-like globin genes
Xiao Hu, Susan Eszterhas, Nicolas Pallazzi, Eric E. Bouhassira, Jennifer Fields, Osamu Tanabe,
Scott A. Gerber, Michael Bulger, James Douglas Engel, Mark Groudine and Steven Fiering
Updated information and services can be found at:
http://www.bloodjournal.org/content/109/5/2210.full.html
Articles on similar topics can be found in the following Blood collections
Gene Expression (1086 articles)
Red Cells (1159 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.