Download molecular cloning and expression of the proliferating cell nuclear

J. Phycol. 38, 164–173 (2002)
MOLECULAR CLONING AND EXPRESSION OF THE
PROLIFERATING CELL NUCLEAR ANTIGEN GENE FROM THE
COCCOLITHOPHORID PLEUROCHRYSIS CARTERAE (HAPTOPHYCEAE)1
Senjie Lin2
Department of Marine Sciences, University of Connecticut, Groton, Connecticut 06340, USA
and
Paul L. A. M. Corstjens
Laboratory for Cytochemistry and Cytometry, Department of Molecular Cell Biology,
Leiden University Medical Center, Wassenaarseweg 72, 2333 AL Leiden, The Netherlands
2000), viruses (O’Reilly et al. 1989, Ahrens et al.
1997), to archaea (reviewed by Iwai et al. 2000). The
gene sequences and protein structures are highly conserved (Kelman 1997). PCNA is required for DNA
replication (Prelich et al. 1987) and repair (Celis and
Madsen 1986, Li et al. 1994). The function as an accessory factor for DNA replication has been elucidated for organisms, including higher plants (Matsumoto et al. 1994, Markley et al. 1997), yeast (Gibbs et
al. 1997), and humans (Prelich et al. 1987). Biochemical evidence has demonstrated interaction of PCNA
with DNA replication molecules such as DNA polymerase and replication factor C (RFC). The interaction of PCNA with pol has been mapped to the Nterminus of human pol and an internal domain of
PCNA (Zhang et al. 1995), whereas the binding site of
RFC is localized to the C-terminus of PCNA (Mossi et
al. 1997). Recently, PCNA was found to be involved in
cell cycle control via association with a D type cyclin
(Xiong et al. 1992), cyclin dependent kinases (Loor et
al. 1997), and the CDC2 kinase inhibitor p21 WAF1
(Waga et al. 1994, Cayrol et al. 1998). It regulates
DNA replication through competitive interaction with
p21WAF1 and pol in both humans and higher plants
(Warbrick et al. 1995, Ball and Lane 1996).
Because of its association with DNA replication and
hence cell proliferation (Celis and Celis 1985, Onelli
et al. 1997), PCNA has also drawn considerable attention as a marker of tumor and cancer development
(e.g. Sasaki et al. 1994). PCNA is associated with entry
to the S phase from G1 or G0 of the cell cycle in plants
(Kodama et al. 1991). Analogously, PCNA can potentially be a marker of growth phase for marine phytoplankton (Lin et al. 1995). PCNA and its corresponding gene have only recently been described for
phytoplankton (Lin et al. 1994, Cheng et al. 1997, Lin
and Carpenter 1998), and its application to growth
studies has been hampered largely by a scarcity of
comparative information and appropriate probes for
the genetically diverse phytoplankton.
Pleurochrysis carterae is one of the coccolithophorid
phytoplankton producing intracellular calcite plates
that contribute to removal of sea surface CO2 and
deposition of CaCO3 to marine sediment (Holligan et
The gene encoding proliferating cell nuclear antigen (PCNA) was isolated from the marine coccolithophorid microalga Pleurochrysis carterae (Braarud et
Fagerland) Christensen (Haptophyceae). Two mRNAs
(Pcpcna1 and Pcpcna2) were identified and contained
an identical coding region for 222 amino acid residues and an untranslated sequence of 302 base pair
(Ut1) and 246 base pair (Ut2), respectively. Comparison between PCR-derived genomic DNA fragments
and cDNA sequences revealed five introns. The coding region of Pcpcna is similar to counterparts in
other organisms and contains highly conserved functional domains. Phylogenetic analyses indicated clustering of Pcpcna with pcna in its haptophyte relative
Isochrysis galbana Parke. A recombinant fusion protein of Pcpcna, overexpressed in Escherichia coli, was
recognized by the PC10 antibody against rat PCNA.
Using RT-PCR and Western blotting, Pcpcna was
found to be highly transcribed and translated during
the exponential growth phase relative to the stationary growth phase, with a positive correlation between
gene expression and growth rate. It can be concluded that the pcna is conserved in this coccolithophorid phytoplankton and that its expression is growth
stage related.
Key index words: alga; growth rate; immunofluorescence; intron; PCNA; phytoplankton; Pleurochrysis
carterae; proliferating cell nuclear antigen
Abbreviations: pcna, gene encoding proliferating cell
nuclear antigen (PCNA); Pcpcna, gene coding for
PCNA in P. carterae; RFC, replication factor C
Proliferating cell nuclear antigen (PCNA) is a processivity factor of DNA polymerase- and - in eukaryotic cells (Bravo et al. 1987, Burgers 1991, Zhang et al.
1998). It occurs in all organisms examined so far,
ranging from humans (Almendral et al. 1987), higher
plants (Markley et al. 1992), protozoa (Guerini et al.
1Received
2Author
24 May 2001. Accepted 15 November 2001.
for correspondence: e-mail [email protected].
164
165
PCNA IN COCCOLITHOPHORID PLEUROCHRYSIS
al. 1983). Recently, molecular mechanisms of calcite
plate formation by coccolithophorids have begun to
be elucidated (e.g. Corstjens et al. 2001). Molecular
components of the cell cycle and growth regulation
need to be characterized to establish relationships between growth phase, cell cycle, calcite formation, and
hence the biogeochemical role of this species. In this
study, we isolated pcna from P. carterae and studied its
expression pattern at the mRNA and protein levels.
materials and methods
Algal culture. Pleurochrysis carterae strain 136 (Plymouth Marine Biological Laboratory, UK) was grown in 2 L of f/2 medium prepared with 28% seawater unless specified otherwise
(15% seawater was also used for an experiment). Illumination
was provided with cool white fluorescent lights, with a photon
flux of 100 mol photonm2s1 and a photocycle of 12:12-h
light:dark unless indicated otherwise. Determination of growth
rate was followed by daily cell counts using a Sedgwick-Rafter
counting chamber.
Sample collection and nucleic acid extraction. Samples from different growth phases were collected around 3 h before the end
of the light period and centrifuged with 3000 g at 4 C. The cell
pellets were stored at 80 C immediately for DNA extraction
or after being suspended in Trizol Reagent (GIBCO BRL,
Gaithersburg, MD) for RNA extraction. DNA and RNA were
purified essentially following Lin and Carpenter (1998).
Primer sequences. New primers designed and used in this
study are listed in Table 1. Two previously published primers,
PCNA1 and PCNA2 (Lin and Carpenter 1998), were also used
in this study.
cDNA cloning. cDNA was synthesized using 2.5 g of total
RNA with a PCNA-specific primer (PCNA1), as described previously (Lin and Carpenter 1998). One microliter of the 20- L
cDNA was PCR amplified using primers PCNA1 and PCNA2.
The PCR product was cloned using vector pCR2.1 (Invitrogen,
Carlsbad, CA). Four clones were sequenced for both strands using an ABI Prism automated sequencer. Gene sequences were
analyzed using GeneTool and PepTool (BioTools, Edmonton,
Canada).
Total DNA from a cDNA library of P. carterae (Corstjens et
al. 2001) was used as a template in a PCR using primers derived
from vector and pcna sequences: T7/PCNA2 (for 3-end) and
T3/PCNA5R (for 5-end). The resulting PCNA fragments were
cloned and sequenced as described above.
To confirm the assembled sequence from separate fragments, nested primers flanking nearly the whole compiled
cDNA fragment were designed and used in PCR to clone the
whole cDNA fragment. The primer sets used were PLPCNA5F-
Table 1.
PLPCNA6R and PLPCNA5F-PLCPNA7R. To verify presence of
a shorter form of mRNA (see Results), another reverse primer,
PLPCNA8R (Table 1), was designed to cover the poly-A tail and
a 6-nt sequence upstream of the tail. PCR products were cloned
and sequenced as described above.
Genomic DNA cloning. Primers PLPCNA5F, PLPCNA6R, and
PLPCN7R were used to PCR amplify genomic DNA corresponding to Pcpcna1 and Pcpcna2 mRNA species. The PCR
products were cloned and sequenced.
Phylogenetic analyses. Amino acid sequences of pcna from
representatives of major groups of organisms were aligned using ClustalX 1.8. A neighbor-joining tree was constructed with
1000 replicates of bootstrap using Kimura’s model of evolution
(Kimura 1980).
Overexpression of the recombinant PCNA fusion protein. A ligationindependent cloning kit (Stratagene, La Jolla, CA) was used according to the manufacturer’s instructions to clone, express, and
purify a PcPCNA fusion protein. The primers used, PLPCNA2F
and PLPCNA2R (Table 1, Fig. 2), were designed to flank 156
codons of PcPCNA. Several clones obtained were grown and
PcPCNA recombinant fusion protein was induced by adding
IPTG. The recombinant fusion protein was purified using calmodulin affinity resin.
RT-PCR. One-tube RT-PCR was performed using RNA samples from different growth phases with primer sets of PLPCNA5FPLPCNA6R and PLPCNA5F-PLPCNA7R. Two microliters of
RNA from each sample (equivalent to 8 104 cells) was used
for both pcna and -actin (using primers plactin1F and
plactin2R) in this procedure. A previously published protocol
was followed (Zhang et al. 2000). Briefly, RNA was mixed with
18 L of a buffer containing 62.5 nM of each primer, 0.84X MMLV Reaction Buffer (Promega, Madison, WI), and denatured.
Then the RT and PCR reagents were added, and the tubes were
incubated in the PCR thermocycler for 50 min at 42 C immediately followed by 30 cycles of 94 C for 30 s, 60 C for 45 s, 72 C
for 45 s, and a final cycle at 72 C for 10 min. Pcpcna1, Pcpcna2,
and -actin were amplified in separate tubes to prevent interference as observed when three genes were RT-PCR amplified in
one tube (not shown). At the end, 3 L from each of the reactions (equivalent to about 1.2 104 cells) was mixed and electrophoresed. Preliminary experiments showed that under the
PCR conditions described, all three gene fragments were barely
visible within 25 cycles, increased exponentially within 30 cycles, and became saturated at cycle 35 (not shown). DNA band
intensities were quantified using the UVP gel documentation
system (UVP, Upland, CA) and the standard calibration mode.
Western blotting. A commercial antibody, PC10 monoclonal
anti-rat-PCNA (Oncogene, Cambridge, MA), was tested for reactivity with the recombinant PcPCNA fusion protein. Protein
samples prepared in Laemmli buffer and boiled were separated
using SDS-PAGE and Western blotted as described in Lin et al.
(1994). The PC10 antibody was also used to determine expres-
Primers used in this study.
Name
Sequence (5 → 3)
Application
T7
T3
PCNA5Ra
PLPCNA5Fa
PLPCNA6Ra
PLPCNA7Ra
PLPCNA8Ra
PLPCNA2Fa
PLPCNA2Ra
Plactin1Fc
Plactin2Rc
GTAATACGACTCACTATAGGGC
AATTAACCCTCACTAAAGGG
CATGAGCTTGAGSTCAAARTCAGA
GCCATGGACTCGAGCCACGTCTCG
GTTGTGCTCCCGCAGGTCAGGCGAC
GGCCAAAATTCTCCAGCCATGAGACGC
TTTTTTTTTTTTTTTTTTTTTTGGACAG
GAC GAC GAC AAG AAG TGC TGC AAC AAC GAG GAC b
GG AAC AAG ACC CGT TCA CGG CAC GTC CTT GGA GAG b
TCCCCGCCAACCTGGCGTGATGGTG
GGCAGCTCGTACGACTTCTCGACG
Cloning
Cloning
Cloning
Cloning, expression
Cloning, expression
Cloning, expression
Cloning, expression
Overexpression
Overexpression
Expression
Expression
a
See Figure 2 for the location of these primers. F, forward; R, reverse.
Underlined are adaptor sequences to facilitate cloning, and the bold nt’s are the inserted stop codon.
c Primers designed from a published sequence (Corstjens and Gonzalez 1999).
b
166
SENJIE LIN AND PAUL L. A. M. CORSTJENS
sion of native PCNA. Protein was extracted from algal samples,
separated using SDS-PAGE, and blotted. After immunodetection of PCNA, the protein blots were stripped of PC10 and used
again for detection of -tubulin (Lin et al. 1994). Protein band
intensity on the resulting autoradiographs was measured using
the UVP gel documentation system mentioned above.
Immunofluorescence. Cell samples were fixed, permeablized,
and immunolabeled as previously described (Lin and Carpenter 1996). PC10 was used at a dilution of 1:40. Stained samples
were examined under an epifluorescence microscope (Axioskop) with a 100 objective. Photographs were taken using a
Minolta camera with Kodak TMAX 400 film (Fisher Scientific,
Springfield, NJ) at an exposure time of 20 s for PCNA immunolabeling and 5 s for DAPI counterstaining.
results
Gene sequence and phylogenetic tree. RT-PCR with PCNA1
and PCNA2 generated a cDNA fragment of 592 base
pair (bp) (Fig. 1A). Primers designed from this fragment allowed isolation of two nearly full-length
cDNAs using the cDNA library. These two cDNAs
(Pcpcna1 and Pcpcna2) contained an identical coding
region for 222 amino acids (Fig. 2) but differed in size
of their 3-UTR. The nucleotide sequence of the two
untranslated regions, Ut1 and Ut2, respectively, was
the same except that a 57-bp sequence preceding the
poly-A tail in Ut1 was absent from Ut2 (Fig. 2).
The whole cDNA fragment was also cloned directly
from RT-PCR on RNA samples, using PLPCNA5F,
PLPCNA6R, and PLPCNA7R primers. PLPCNA5F and
PLPCNA6R yielded the long form of pcna (Pcpcna1),
whereas PLPCNA5F and PLPCNA7R produced a
shorter cDNA (Fig. 1B). Sequencing of these fragments
verified their identity as pcna cDNA fragments. Furthermore, RT-PCR using the primer set of PLPCNA5FPLPCNA8R generated a DNA fragment (Fig. 1C), whose
Fig. 1. Agarose gel of PCR-amplified Pcpcna cDNA and genomic DNA fragments. (A) A cDNA fragment that was amplified using the primer set PCNA2 and PCNA1. (B) A cDNA fragment that was amplified using the primer sets of PLPCNA5FPLPCNA6R (lane 1) and PLPCNA5F-PLPCNA7R (lane 2). (C)
A cDNA fragment that was amplified using primer set of
PLPCNA5F-PLPCNA8R. (D) A genomic DNA fragment amplified using primer sets of PLPCNA5F-PLPCNA6R (lane 1) and
PLPCNA5F-PLPCNA7R (lane 2). Lane M is a 1-kb DNA marker
(A, B, and D) or a 100-bp DNA ladder (C); some molecular
sizes (1 and 2 kb) are indicated on the left of each panel. The
arrows on the right indicate the specific PCR products.
sequence confirmed its identity as the shorter form of
pcna (Pcpcna2) containing an authentic poly-A tail.
Use of primers PLPCNA5F/PLPCNA6R and
PLPCNA5F/PLPCNA7R with genomic DNA as templates also yielded two DNA fragments that were substantially longer than their corresponding cDNA fragments (Fig. 1D). Five introns, 156–282 bp in length,
were identified by comparing the cDNA with the genomic DNA sequences (Fig. 2). The overlapping region of the longer and shorter genomic DNA sequences, including introns, were identical. These
introns were delineated from exons with the universal
exon–intron junction dinucleotides (GT and AG)
with one exception. In intron II a deviation was found
resulting in GC/AG as the splicing site.
Alignment of the deduced amino acids sequence
revealed that the 5-end is probably incomplete (Fig.
3). It further showed that PcPCNA was closest to
PCNA in a haptophyte relative Isochrysis galbana (Lin
and Carpenter 1998), followed by that in the chlorophyte Tetraselmis chui (Cheng et al. 1997), with an
identity of 81% and 64%, respectively. Similar identities were found between amino acid sequences in P.
carterae and Dunaliella tertiolecta (61%), higher plants
(64%–65%), and animals (61–63%). Yeast shared
lower identity (54% for Schizosaccharomyces pomb and
38% for Saccharomyces cerevisiae). Further analysis
showed that Pcpcna contained several highly conserved domains of typical PCNA. One of these was the
competitive binding sites of DNA polymerase and
the p21 inhibitor of the cylin-dependent kinases (Ball
and Lane 1996) (DS-SHV -, box D1 in Fig. 3). Another
was the basic helix-loop-helix DNA binding motifs
(box D2, Fig. 3) in which only two amino acid residues differed compared with counterparts in other
organisms. A third conserved domain was the epitope
of the PC10 antibody directed against rat PCNA, corresponding to amino acids residues 112–120 in rat
PCNA (box D3 in Fig. 3) in which there was one residue unique to algae examined so far (L in chlorophyceae and haptophyceae and M in other organisms
in the fifth position). A fourth conserved motif was
YLAPK near the C-terminus (box D4 in Fig. 3), apparently a site essential for proper folding and the binding site of RFC (Mossi et al. 1997).
In the amino acid sequence-derived, neighbor-joining, phylogenetic tree, P. carterae was clustered closely
with the haptophyte relative I. galbana but less closely
with other algae (Fig. 4). The general topology of the
tree was as expected: green algae were closer to higher
plants, whereas animals and yeast formed independent
clades from which P. carterae was clearly separated.
Growth stage-dependent variation in Pcpcna transcription. RT-PCR results showed growth phase-related
variation in Pcpcna expression. Although the same
number of cells were used in each RT-PCR reaction,
both Pcpcna1 and Pcpcna2 mRNA were more abundant in exponential growth phase and much less
abundant or completely disappeared in stationary
phase for both cultures grown at 28% and 15% salini-
PCNA IN COCCOLITHOPHORID PLEUROCHRYSIS
167
Fig. 2. The nucleotide and deduced amino acid sequence of Pcpcna. The five introns (I–V) in the genomic DNA and untranslated sequences in the two cDNAs (Ut1 and Ut2) are shown in small letters. The specific primers used for further PCR with cDNA and
genomic DNA are shown in boxes, whereas primers used (PLPCNA2F and PLPCNA2R) for fusion protein expression are underlined.
The genomic DNA and the two cDNA sequences are deposited in GenBank under the accession numbers AF366058, AF052392, and
AF368193, respectively.
168
SENJIE LIN AND PAUL L. A. M. CORSTJENS
PCNA IN COCCOLITHOPHORID PLEUROCHRYSIS
Fig. 4. Neighbor-joining tree constructed with PCNA
amino acid sequences from major groups of organisms. Numbers at nodes indicate bootstrap confidence values based on
1000 replicates; only values 50% are shown. The scale indicates substitutions per site. Species abbreviation and accession
numbers are as follows: Bra, Brassica napus (Q43124); Scere:
Saccharomyces cerevisiae (P15873); see Fig. 3 legend for the abbreviations of the other species.
ties (Fig. 5). The same trend was found when Pcpcna
mRNAs were normalized to actin mRNA (see below).
Furthermore, Pcpcna1 transcript appeared to decrease
more quickly from exponential to stationary growth
phase than Pcpcna2 (Fig. 5, A and B), as shown by the
dramatic decrease in the ratio of Pcpcna1 to the sum
of Pcpcna1 and Pcpcna2 (Fig. 5B). The ratio decreased
from exponential growth phase to stationary phase in
both cultures (0.62 to nearly 0 for the 28% culture
and 0.78 to 0.15 for the 15% culture).
Overexpression of recombinant PcPCNA and reactivity
with the PC10 antibody. A 28-kDa fusion protein containing 41 amino acid residues encoded by vector sequences and 156 amino acids of PcPCNA was overproduced upon induction by IPTG (Fig. 6). Vector
sequences encoded the region necessary for calmodulin affinity purification. After affinity chromatography, the fusion protein appeared largely pure as a 28kDa Coomassie Brilliant Blue-stained band on SDS-
169
Fig. 5. Growth stage-related variation in Pcpcna transcription. (A) The growth curves of cultures grown at a salinity of
28‰ and 15‰. The samples collected at different growth
phases for mRNA analysis are shown with small letters. (B) The
RT-PCR for samples as shown in A. The RT-PCR product derived from the same number of cells (8 104) was loaded in
each lane. The arrows at the left indicate bands of the amplified gene fragments. The boxed inset in B shows ratios of band
intensities for Pcpcna1 (from primer PLPCNA5F-PLPCNA6R)
and Pcpcna1 Pcpcna2 (from primer PLPCNA5F-PLPCNA7R).
The upper row corresponds to lanes a, c, e, and g and lower
row to lanes b, d, f, and h; lane labels correspond to the sample
identities shown in A.
PAGE (Lane 5, Fig. 6A). Western blotting showed that
the PC10 antibody strongly reacted with PcPCNA,
both in the mixture with bacterial protein (unpurified) and in the pure form. The reaction with PC10 as
found in the noninduced samples (Lanes 2 and 4, Fig.
6B) is a background derived from transcriptional activity of the promoter without IPTG induction.
Growth stage-related PcPCNA expression. In crude cell
lysates a PC10 reactive protein was detected with an
apparent molecular mass of about 36 kDa (the typical
Fig. 3. An alignment of amino acid sequences of PCNA from various organisms. Black-shaded, gray-shaded, and nonshaded letters indicate identical, similar, and dissimilar amino acids residues, respectively. Highly conserved domains are boxed: D1, binding
site of Pol and p21; D2, the basic helix-loop-helix DNA binding motifs; D3, the epitope of the PC10 antibody; D4, RFC binding domain. Species abbreviation and GenBank Accession numbers: Arath, Arabidopsis thaliana (AF083220); Dun, Dunaliella tertiolecta
(AF034201); Human (P12004); Iso, Isochrysis galbana (AF034202), Pleu, Pleurochrysis carterae (this study, AF052392); Tet, Tetraselmis
chui (AF012212); Rat (P04961); Rice (P17070); Schpo, Schizosaccharomyces pomb (Q03392); Xen, Xenopus laevis (P18248). Overlined
are regions used for designing the degenerate primers for initial PCR-based cloning of the pcna fragment.
170
SENJIE LIN AND PAUL L. A. M. CORSTJENS
Fig. 6. SDS-PAGE (A) and Western blotting (B) analyses
of PcPCNA recombinant fusion protein expressed in Escherichia
coli. PC10 was used for immunoblot detection. Lanes 1–4 contain a bacterial crude extract after (1 and 3) and before (2 and
4) IPTG induction. Lane 5 contains a purified fusion protein of
PcPCNA.
size of PCNA). The abundance of this PCNA homolog
was highest in the exponential growth phase and diminished in the stationary growth phase (Fig. 7, A and
B). The growth phase-dependent protein expression
pattern was observed both when PcPCNA was normalized to the total amount of protein (indicated by
-tubulin; Lin et al. 1994) and to cell number (Fig.
7C) and when the culture was grown at 15 C (data
not shown).
Correlation between growth rate and Pcpcna transcript
and protein abundance. Pcpcna transcript and protein
abundance was correlated with growth rate (Fig. 8). A
positive correlation was found between the mRNA
abundance and growth rate (Fig. 8, A and B) and between PcPCNA protein abundance and growth rate
(Fig. 8, C and D). The correlation existed both when
expressed Pcpcna was normalized to the abundance of
total mRNA (represented by actin mRNA; Fig. 8A) or
protein (represented by tubulin; Fig. 8C) and number
of cells (Fig. 8, C and D), although cell number-specific correlation appeared stronger.
Intracellular localization of PcPCNA. Immunolabeling
with PC10 indicated that PcPCNA was localized in the
nucleus where DNA was stained by DAPI (Fig. 9).
discussion
Uniqueness and homology of Pcpcna. PCNA is universal
and highly conserved in eukaryotes (Kelman 1997). It
is no surprise, therefore, that a PCNA-coding gene
Fig. 7. The variation in PcPCNA abundance with growth
phase. (A) The growth curve of a culture grown at a salinity of
28‰. The numbers and arrows indicate samples taken for Western blot analysis. (B) An autoradiograph of the PCNA immunoblot using PC10 antibody. Each lane contains the same amount
of total protein (60 g; upper panel) or amount of protein
equivalent to the same number of cells (8 104; lower
panel). Both the PcPCNA and the -tubulin (indicator of total
protein) are shown in each panel. The molecular mass of each
protein is shown on the right. (C) A graph of relative PcPCNA
abundance in the course of the culture. PcPCNA abundance
was measured as the band intensities of the immunoblots
shown in B normalized to the abundance of -tubulin and the
number of cells.
was identified in P. carterae, the coccolithophorid phytoplankton, and that the protein has the same molecular mass and intracellular localization as in other eukaryotes. It is somewhat striking, however, that this
alga has two transcripts of Pcpcna that share a 100%
identical coding region. Because PCR primers specific
PCNA IN COCCOLITHOPHORID PLEUROCHRYSIS
171
Fig. 8. The correlation between growth
rate and the abundance of Pcpcna transcript
and protein. (A and B) The abundance of
Pcpcna mRNA normalized to the abundance of
-actin mRNA (A; error bars are SD from triplicates) and the number of cells (B). (C and
D) The abundance of PcPCNA protein normalized to the abundance of -tubulin (C)
and the number of cells (D). r2 shown is the
squared correlation coefficient for the linear
regression shown by the lines.
for the longer transcript (Pcpcna1) and common for
both transcripts generated identical genomic sequences
including the five introns, the two transcripts are
likely from one single gene and may have resulted
from a posttranscriptional process. However, that the
shorter transcript-specific primer (PLPCNA8R, Table
1) directly amplified Pcpcna2 transcript from total
RNA (Fig. 1D) clearly indicates the shorter transcript
was neither an immature mRNA species nor a cDNA
derived from nonspecific priming of poly-(dT) to a
non-poly-A region during first-strand cDNA synthesis
for cDNA library construction. Although two copies of
pcna have been found in various organisms (e.g. Hata
et al. 1992, Guerini et al. 2000), to our knowledge two
pcna mRNAs differing only in length of the 3 UTR
have not been reported. Interestingly, 3 UTRs of dif-
Fig. 9. A micrograph of PCNA immunofluorescence. (A) The immunofluorescent labeling of PCNA (green in original color) using the PC10 antibody at 1:40 dilution. (B) A fluorescent image of DNA staining by DAPI for the same cells as shown in A. White arrows indicate cells stained for both PCNA (A) and DNA (B), whereas black arrows indicate cells stained for DNA but not for PCNA,
despite some autofluorescence (small white dots, orange in original color).
172
SENJIE LIN AND PAUL L. A. M. CORSTJENS
ferent lengths have been reported for another highly
conserved gene of the same organism P. carterae (vap,
GenEMBL no. U81519). The mechanism by which
the two transcripts are expressed and the function of
the two transcripts warrant further studies.
The high identity of the Pcpcna amino acid sequence
to counterparts in other organisms is consistent with
the finding that pcna is highly conserved. Furthermore, the high similarity of this gene across the phylogenetic spectrum suggests that the function of this
protein in eukaryotes is conserved. The universal function of PCNA is manifested by the conservation of several functional domains in this protein, including the
basic helix-loop-helix DNA binding motifs, competitive binding region for DNA polymerase and p21WAF1,
and the RFC binding domain (Fig. 3). p21WAF1 is an
inhibitor of CDK1, a key component of the universal
cell cycle regulation machinery of eukaryotes, whereas
RFC is required for cell proliferation in eukaryotes
(Mossi et al. 1997). The presence of these conserved
domains suggests the possible presence of their corresponding cell cycle-regulating molecules in P. carterae.
Growth stage-related expression. Earlier studies have
shown that PCNA is actively synthesized in dividing
mammalian cells (e.g. Celis and Celis 1985, Sasaki et
al. 1994). In higher plants, pcna expression is high in
proliferating cells and diminished in quiescent, starved,
and stationary phase cells (G0/G1) (Kodama et al.
1991, Markley et al. 1992, Citterio et al. 1992). In the
few phytoplankton species examined, PCNA is also
abundant in the exponential growth phase and declines to undetectable levels in the stationary phase
(Lin et al. 1994). In the present study, there appears
to be a positive relationship of pcna expression with
the active growth phase of P. carterae.
The association of Pcpcna expression with cell proliferation is also demonstrated by the quantitative correlation between the growth rate and the cellular content of Pcpcna transcript and protein abundance (Fig.
8). The correlation provides a potential method for
studying the growth rate of this phytoplankter, which
is important in marine biogeochemistry. Thus, it is of
interest to establish a robust correlation under various
environmental conditions in future studies.
Differential expression of the two transcripts. Although
our limited data demonstrate that the Pcpcna1 and
Pcpcna2 vary differentially in the stationary growth
phase in P. carterae, the function of the two transcripts
and the regulation of their differential expression are
unclear. Pcna has been found to be differentially expressed in plant tissues through upstream regulatory
regions. For example, the promoter elements, sites IIa
and IIb, in the rice PCNA gene appears to be essential
for meristematic tissue-specific expression through
binding by two proteins, PCF1 and PCF2 (Kosugi and
Ohashi 1997). In HeLa cells, two forms of immunochemically identical PCNA were found to be localized differentially in the nucleus of the cells (Bravo
and Macdonald-Bravo 1987). In this cell type, one
form of PCNA is diffusely distributed in the nucleo-
plasm and can be extracted by organic solvents such
as dimethylsulfoxide. The other form is tightly associated with the DNA replication site, which cannot be
extracted by organic solvents. Further studies are required to examine the upstream regulatory region of
Pcpcna and cytochemical characteristics of the encoded protein. It is noteworthy that PCNA is known to
be involved in DNA repair (Li et al. 1994), which
poses a question whether one of the two transcripts
are involved in this function. Our RT-PCR results did
not show a correlation of the abundance of both transcripts with UV damage to the culture (not shown),
suggesting that if Pcpcna is involved in the repair of
UV-induced DNA damage, the involvement may exist
posttranscriptionally.
We thank Dr. H. Zhang for his kind assistance with some cloning and sequencing. Some RT-PCR work was done in the laboratory of Dr. E. L. Gonzalez at the University of California,
Los Angeles. Supported by U.S. National Science Foundation
OCE9529970 and NOAA-ECOHAB grant NA860P0491.
Ahrens, C. A., Russell, R. R., Funk, C. J., Evans, J., Harwood, S. &
Rohrmann, G. F. 1997. The sequence of the Orgyia pseudotsugata multinucleocapsid nuclear polyhedrosis virus genome. Virology 229:381–99.
Almendral, J. M., Huebsch, D., Blundell, P. A., Macdonald-Bravo,
H. & Bravo, R. 1987. Cloning and sequence of the human nuclear protein cyclin: homology with DNA-binding proteins.
Proc. Natl. Acad. Sci. USA 84:1575–9.
Ball, K. L. & Lane, D. P. 1996. Human and plant proliferating-cell
nuclear antigen have a highly conserved binding for the p53inducible gene product p21WAF1. Eur. J. Biochem. 237:854–61.
Bravo, R., Frank, R., Blundell, P. A. & Macdonald-Bravo, H. 1987.
Cyclin/PCNA is the auxiliary protein of DNA polymerase-.
Nature 326:515–7.
Bravo, R. & Macdonald-Bravo, H. 1987. Existence of two populations of cyclin/proliferating cell nuclear antigen during the
cell cycle: association with DNA replication sties. J. Cell Biol.
105:1549–54.
Burgers, P. M. J. 1991. Saccharomyces cerevisiae replication factor C.
II. Formation and activity of complexes with proliferating cell
nuclear antigen and with DNA polymerase and . J. Biol.
Chem. 266:22698–706.
Cayrol, C., Knibiehler, M. & Ducommun, B. 1998. P21 binding to
PCNA causes G1 and G2 cell cycle arrest in p53-deficient cells.
Oncogene 16:311–20.
Celis, J. E. & Celis, A. 1985. Cell cycle-dependent variations in the
distribution of the nuclear protein cyclin proliferating cell nuclear antigen in cultured cells: subdivision of S phase. Proc.
Natl. Acad. Sci. USA 82:3262–6.
Celis, J. E. & Madsen, P. 1986. Increased nuclear cyclin/PCNA antigen staining of non S-phase transformed human amnion cells
engaged in nucleotide excision DNA repair. FEBS Lett. 209:
277–83.
Cheng, L.-C., Hwang, S.-P. L. & Chang, J. 1997. Gene sequence and
expression of an analog of proliferating cell nuclear antigen
(PCNA) in the alga Tetraselmis chui and detection of the encoded protein with anti-rat PCNA monoclonal antibody. Appl.
Environ. Microbiol. 63:4010–4.
Citterio, S., Sgorbati, S., Levi, M., Colombo, B. M. & Sparvoli, E.
1992. PCNA and total nuclear protein content as markers of
cell proliferation in pea tissue. J. Cell Sci. 102:71–8.
Corstjens, P. L. A. M. & Gonzalez, E. L. 1999. Isolation and molecular analysis of four actin encoding cDNA clones (accession nos.
AF144403, AF144404, AF144405, AF144406) from the coccolithophorid Pleurochrysis carterae (Prymnesiophyceae). Plant Physiol. 120:933.
PCNA IN COCCOLITHOPHORID PLEUROCHRYSIS
Corstjens, P. L. A. M., Araki, Y. & Gonzalez, E. L. 2001. A coccolithophorid calcifying vesicle with a vacuolar-type ATPase proton pump: cloning and immunolocalization of the V0 subunit
c. J. Phycol. 37:71–8.
Gibbs, E., Kelman, Z., Gulbis, J. M., O’Donnell, M., Kuriyan, J.,
Burgers, P. M. J. & Hurwitz, J. 1997. The influence of the proliferating cell nuclear antigen-interacting domain of the
p21CIP1 on DNA synthesis catalyzed by the human and Saccharomyces cerevisiae polymerase holoenzymes. J. Biol. Chem.
272:2373–81.
Guerini, M. N., Que, X., Reed, S. L. & White, M. W. 2000. Two genes
encoding unique proliferating-cell-nuclear-antigens are expressed in Toxoplasma gondii. Mol. Biochem. Parasitol. 109:121–31.
Hata, S., Kouchi, H., Tanaka, Y., Minami, E., Matsumoto, T., Suzuka, I. & Hashimoto, J. 1992. Identification of carrot cDNA
clones encoding a second putative proliferating cell nuclear
antigen, DNA polymerase- auxiliary protein. Eur. J. Biochem.
198:367–71.
Holligan, P. M., Voillier, M., Harbour, D. S., Camus, P. & Champagne-Philippe, M. 1983. Satellite and ship studies of coccolithophore production along a continental shelf edge. Nature
304:339–42.
Iwai, T., Kurosawa, N., Itoh, Y. H. & Horiuchi, T. 2000. Phylogenetic analysis of archaeal PCNA homologues. Extremophiles 4:
357–64.
Kelman, Z. 1997. PCNA: structure, functions and interactions. Oncogene 14:629–40.
Kimura, M. 1980. A simple method for estimating evolutionary
rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16:111–20.
Kodama, H., Ito, M., Ohnishi, N., Suzuka, I. & Domamine, A. 1991.
Molecular cloning of the gene for plant proliferating-cell nuclear antigen and expression of this gene during the cell cycle
in synchronized cultures of Catharanthus rosues cells. Eur. J. Biochem. 197:495–503.
Kosugi, S. & Ohashi, Y. 1997. PCF1 and PCF2 specifically bind to cis
elements in the rice proliferating cell nuclear antigen gene.
Plant Cell 9:1607–19.
Li, R., Waga, S., Hannon, G. J., Beach, D. & Stillman, B. 1994. Differential effects by the p21 CDK inhibition on PCNA-dependent DNA replication and repair. Nature 371:534–7.
Lin, S. & Carpenter, E. J. 1996. An empirical protocol of immunofluorescence for marine phytoplankton. J. Phycol. 32:1083–94.
Lin, S. & Carpenter, E. J. 1998. Detection and preliminary characterization of PCNA gene in Dunaliella tertiolecta and Isochrysis
galbana. Mar. Mol. Biol. Biotech. 7:62–71.
Lin, S., Chang, J. & Carpenter, E. J. 1994. Detection of proliferating
cell nuclear antigen analog in four species of marine phytoplankton. J. Phycol. 30:449–56.
Lin, S., Chang, J. & Carpenter, E. J. 1995. Growth characteristics of
phytoplankton determined by cell cycle proteins: PCNA immunostaining of Dunaliella tertiolecta. J. Phycol. 31:388–95.
Loor, G., Zhang, S.-J., Zhang, P., Toomey, N. T. & Lee, M. Y. W. T.
173
1997. Identification of DNA replication and cell cycle proteins
that interact with PCNA. Nucleic Acid Res. 25:5041–6.
Markley, N.-A., Bonham-Smith, P. C. & Moloney, M. M. 1992. Molecular cloning and expression of a cDNA encoding the proliferating cell nuclear antigen from Brassica napus (oilseed rape).
Genome 36:459–66.
Markley, N.-A., Yong, D., Laquel, P., Castroviejo, M. & Moloney, M.
M. 1997. Molecular genetic and biochemical analysis of Brassica napus proliferating cell nuclear antigen function. Plant
Mol. Biol. 34:693–700.
Matsumoto, T., Hata, S., Suzuka, I. & Hashimoto, J. 1994. Expression of functional proliferating-cell nuclear antigen from rice
(Oryza sativa) in Escherichia coli: activity in association with human DNA polymerase delta. Eur. J. Biochem. 223:179–87.
Mossi, R., Jonsson, Z. O., Allen, B. L., Harding, S. H. & Hubscher,
U. 1997. Replication factor C interacts with the C-terminal
side of proliferating cell nuclear antigen. J. Biol. Chem. 272:
1769–76.
Onelli, E., Citterio, S., O’Connor, J. E., Levi, M. & Sgorbati, S. 1997.
Flow cytometry, sorting and immunocharacterization with proliferating cell nuclear antigen of cycling and non-cycling cells
in synchronized pea root tips. Planta 202:188–95.
O’Reilly, D. R., Crawford, A. M. & Miller, L. K. 1989. Viral proliferating cell nuclear antigen. Nature 337:606.
Prelich, G., Kostura, M., Marshak, D. R. & Mathews, M. B. 1987.
The cell-cycle regulated proliferating cell nuclear antigen is required for SV40 DNA replication in vitro. Nature 326:471–5.
Sasaki, K., Kurose, A., Ishika, Y. & Matsuta, M. 1994. Estimation of
S-phase fraction in tumor tissue sections by immunohistochemical staining of PCNA. J. Histochem. Cytochem. 42:957–60.
Waga, S., Hannon, G. J., Beach, D. & Stillman, B. 1994. The p21 inhibitor of cyclin-dependent kinases controls DNA replication
by interaction with PCNA. Nature 369:574–7.
Warbrick, E., Lane, D. P., Glover, D. M. & Cox, L. S. 1995. A small
peptide inhibitor of DNA replication defines the site of interaction between the cyclin-dependent kinase inhibitor p21 and
proliferating cell nuclear antigen. Curr. Biol. 5:275–82.
Xiong, Y., Zhang, H. & Beach, D. 1992. D type cyclins associate with
multiple protein kinases and the DNA replication and repair
factor PCNA. Cell 71:505–14.
Zhang, S. J., Zeng, X. R., Zhang, P., Toomey, N. L., Chuang, R. Y.,
Chang, L. S. & Lee, M. Y. W. T. 1995. A conserved region in the
amino terminus of DNA polymerase delta is involved in proliferating cell nuclear antigen binding. J. Biol. Chem. 270:7988–92.
Zhang, H., Futami, K., Horie, N., Okamura, A., Utoh, T., Mikawa,
N., Yamada, Y., Tanaka, S. & Okamoto, N. 2000. Molecular
cloning of fresh water and deep-sea rod opsin genes from Japanese eel Anguilla japonica and expressional analyses during sexual maturation. FEBS Lett. 469:39–43.
Zhang, P., Sun, Y., Hsu, H., Zhang, L., Zhang, Y. & Lee, M. Y. W. T.
1998. The interdomain connector loop of human PCNA is involved in a direct interaction with human polymerase . J. Biol.
Chem. 273:713–9.