* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Supplement Supporting Materials and Methods Site
Magnesium transporter wikipedia , lookup
Hedgehog signaling pathway wikipedia , lookup
Cell encapsulation wikipedia , lookup
Histone acetylation and deacetylation wikipedia , lookup
Cellular differentiation wikipedia , lookup
List of types of proteins wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Supplement Supporting Materials and Methods Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter were independently generated using a two-step PCR method. The Smad4 binding site (SBE) was mutated to TTTT. shRNA expression constructs. shRNAs targeting P300 and CBP were synthesized: P300 shRNA, sense 5'TGCCTCTCCTCTTCAGCACCATTCAAGAGATGGTGCTGAAGAGGAGAGGTT TTTT-3', antisense 5'GATCAAAAAACCTCTCCTCTTCAGCACCATCTCTTGAATGGTGCTGAAGAG GAGAGGCA-3'; CBP shRNA, sense 5'TGTAGTAACTCTGGCCATAGCTTCAAGAGAGCTATGGCCAGAGTTACTATTT TTT-3', antisense 5'GATCAAAAAATAGTAACTCTGGCCATAGCTCTCTTGAAGCTATGGCCAGAG TTACTACA-3' 1 Figure S1 A, The inhibitory efficiency of the shRNA directed against Smad4 or YY1. At 48 h after shRNA transfection, total cell lysates were prepared and normalized for protein concentration. The expression of GAPDH was used as an internal control. Results shown are representative of three independent experiments. B,C, P19 cells were transfected with either wild type or mutant Gat1 gene promoter construct, together with the indicated shRNA expression constructs. Transfected cells were then treated with BMP2 (C), nor not (B). The activity of Gat1 promoter construct co-transfected with control shRNA obtained in vechile has been set equal to 1. Results are shown as mean ±S.D. for at least three experiments. *, p<0.05, compared to control shRNA (ANOVA and Bonferroni correction). 2 Figure S2 Figure. S2 Transcriptional activity of mutant Gat1 promoter constructs. A, Sequence of the BMP2-responsive element of mouse Gat1 gene promoter. Smad4 (SBE) and YY1 consensus binding sites are labeled. B, P19 cells were transfected with -5377/luc or mutant Gat1 promoter constructs containing mutated SBE: SBE1-4m, together with Smad4 shRNA expression constructs. Transfected cells were 3 then stimulated with BMP2 for 24 h before measuring luciferase activity. The activity of wild type Gat1 promoter constructs co-transfected with control shRNA has been set equal to 1. Results are expressed as means ±S.D. (n=3).The experiments were performed for at least three times. *, p<0.05, compared to control shRNA (Student’s t-test). C, YY1 shRNA failed to induced the activity of Gat1 promoter construct with functional SBE mutated. Gat1 promoter constructs were transfected into NSCs, together with YY1 shRNA expression constructs. The activity of wild type Gat1 promoter constructs co-transfected with control shRNA has been set equal to 1. Results are expressed as means ±S.D. (n=3).The experiments were performed for at least three times. *, p<0.05, compared to control shRNA (Student’s t-test). 4 Figure S3 Figure S3 EMSA was performed using biotin-labeled oligonucleotide from Gat1 gene promoter from -333 to -288. Nuclear protein was isolated from NSCs (A) or P19 cells (B). For the experiments in lane 1, free probe; lane 2, no competitor was added; lane 3-4, unlabeled wild-type probe (A) or mutant probe A (ASBE3m) with the functional SBE mutant were used as competitors; lane 5-6, unlabeled wild-type SBE oligonucleotides were used as competitors; lane 7-8, unlabeled mutant SEB oligonucleotides were used as competitors. Indicated are the specific complex (solid arrow), non-specific complexes (open arrows). Results shown in the figure are representative of at least three independent experiments. 5 Figure S4 Figure S4. Up-regulation of TSA, a HDAC inhibitor on transcription activity of Gat1 gene promoter constructs. P19 cells were transfected with -5377/luc or -5377m/luc construct. Twenty-four hours prior to analysis, the indicated concentrations of TSA were added. Luciferase activity is presented as the increase in activity induced by TSA in cells transfected with -5377/luc relative to cells transfected with -5377m/luc. The activity obtained in the absence of TSA has been set equal to 1. Results are shown as mean ±S.D. for at least three experiments. 6 Figure S5 Figure S5. Role of P300 and CBP in the BMP2-response of Gat1 promoter activity. A, The inhibitory efficiency of the shRNA directed against P300 or CBP evaluated by Western blot analysis. At 48 h after shRNA transfection, total cell lysates were prepared and normalized for protein concentration. The expression of gapdh was used to control equal protein loading. Results shown are representative of three independent experiments. B, P300 shRNA or CBP shRNA abolished the BMP2 induction of Gat1 promoter constructs activity. P19 cells were transfected with the -5377/luc reporter together with P300 shRNA, CBP shRNA or control shRNA. Cells were treated with or without BMP2 at the concentrations indicated. The activity obtained in the absence of BMP2 has been set equal to 1. Results are shown as mean ±S.D. for at least three experiments. (C) ChIP assays of P300 and CBP binding to Gat1 gene promoter, in response to BMP2 stimuli. Electrophoresed PCR products from the analysis of anti-P300, anti-CBP or IgG as indicated on the right. The nature of the samples (Input or ChIP; BMP2 treated or not) is annotated above each lane. 7 The experiment shown is representative for at least two independent experiments giving similar results. 8