Download Supplement Supporting Materials and Methods Site

Supplement
Supporting Materials and Methods
Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter
were independently generated using a two-step PCR method. The Smad4 binding site
(SBE) was mutated to TTTT.
shRNA expression constructs. shRNAs targeting P300 and CBP were synthesized:
P300 shRNA, sense 5'TGCCTCTCCTCTTCAGCACCATTCAAGAGATGGTGCTGAAGAGGAGAGGTT
TTTT-3', antisense 5'GATCAAAAAACCTCTCCTCTTCAGCACCATCTCTTGAATGGTGCTGAAGAG
GAGAGGCA-3'; CBP shRNA, sense 5'TGTAGTAACTCTGGCCATAGCTTCAAGAGAGCTATGGCCAGAGTTACTATTT
TTT-3', antisense 5'GATCAAAAAATAGTAACTCTGGCCATAGCTCTCTTGAAGCTATGGCCAGAG
TTACTACA-3'
1
Figure S1
A, The inhibitory efficiency of the shRNA directed against Smad4 or YY1. At 48 h
after shRNA transfection, total cell lysates were prepared and normalized for protein
concentration. The expression of GAPDH was used as an internal control. Results
shown are representative of three independent experiments. B,C, P19 cells were
transfected with either wild type or mutant Gat1 gene promoter construct, together
with the indicated shRNA expression constructs. Transfected cells were then treated
with BMP2 (C), nor not (B). The activity of Gat1 promoter construct co-transfected
with control shRNA obtained in vechile has been set equal to 1. Results are shown as
mean ±S.D. for at least three experiments. *, p<0.05, compared to control shRNA
(ANOVA and Bonferroni correction).
2
Figure S2
Figure. S2 Transcriptional activity of mutant Gat1 promoter constructs.
A, Sequence of the BMP2-responsive element of mouse Gat1 gene promoter. Smad4
(SBE) and YY1 consensus binding sites are labeled. B, P19 cells were transfected
with -5377/luc or mutant Gat1 promoter constructs containing mutated SBE:
SBE1-4m, together with Smad4 shRNA expression constructs. Transfected cells were
3
then stimulated with BMP2 for 24 h before measuring luciferase activity. The activity
of wild type Gat1 promoter constructs co-transfected with control shRNA has been set
equal to 1. Results are expressed as means ±S.D. (n=3).The experiments were
performed for at least three times. *, p<0.05, compared to control shRNA (Student’s
t-test). C, YY1 shRNA failed to induced the activity of Gat1 promoter construct with
functional SBE mutated. Gat1 promoter constructs were transfected into NSCs,
together with YY1 shRNA expression constructs. The activity of wild type Gat1
promoter constructs co-transfected with control shRNA has been set equal to 1.
Results are expressed as means ±S.D. (n=3).The experiments were performed for at
least three times. *, p<0.05, compared to control shRNA (Student’s t-test).
4
Figure S3
Figure S3
EMSA was performed using biotin-labeled oligonucleotide from Gat1 gene promoter
from -333 to -288. Nuclear protein was isolated from NSCs (A) or P19 cells (B). For
the experiments in lane 1, free probe; lane 2, no competitor was added; lane 3-4,
unlabeled wild-type probe (A) or mutant probe A (ASBE3m) with the functional SBE
mutant were used as competitors; lane 5-6, unlabeled wild-type SBE oligonucleotides
were used as competitors; lane 7-8, unlabeled mutant SEB oligonucleotides were used
as competitors. Indicated are the specific complex (solid arrow), non-specific
complexes (open arrows). Results shown in the figure are representative of at least
three independent experiments.
5
Figure S4
Figure S4. Up-regulation of TSA, a HDAC inhibitor on transcription activity of Gat1
gene promoter constructs.
P19 cells were transfected with -5377/luc or -5377m/luc construct. Twenty-four hours
prior to analysis, the indicated concentrations of TSA were added. Luciferase activity
is presented as the increase in activity induced by TSA in cells transfected with
-5377/luc relative to cells transfected with -5377m/luc. The activity obtained in the
absence of TSA has been set equal to 1. Results are shown as mean ±S.D. for at least
three experiments.
6
Figure S5
Figure S5. Role of P300 and CBP in the BMP2-response of Gat1 promoter activity.
A, The inhibitory efficiency of the shRNA directed against P300 or CBP evaluated by
Western blot analysis. At 48 h after shRNA transfection, total cell lysates were
prepared and normalized for protein concentration. The expression of gapdh was used
to control equal protein loading. Results shown are representative of three
independent experiments. B, P300 shRNA or CBP shRNA abolished the BMP2
induction of Gat1 promoter constructs activity. P19 cells were transfected with the
-5377/luc reporter together with P300 shRNA, CBP shRNA or control shRNA. Cells
were treated with or without BMP2 at the concentrations indicated. The activity
obtained in the absence of BMP2 has been set equal to 1. Results are shown as mean
±S.D. for at least three experiments. (C) ChIP assays of P300 and CBP binding to
Gat1 gene promoter, in response to BMP2 stimuli. Electrophoresed PCR products
from the analysis of anti-P300, anti-CBP or IgG as indicated on the right. The nature
of the samples (Input or ChIP; BMP2 treated or not) is annotated above each lane.
7
The experiment shown is representative for at least two independent experiments
giving similar results.
8