* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download B Cell–Specific MHC Class II Deletion Reveals Multiple
Survey
Document related concepts
Transcript
B Cell−Specific MHC Class II Deletion Reveals Multiple Nonredundant Roles for B Cell Antigen Presentation in Murine Lupus This information is current as of August 9, 2017. Josephine R. Giles, Michael Kashgarian, Pandelakis A. Koni and Mark J. Shlomchik J Immunol 2015; 195:2571-2579; Prepublished online 12 August 2015; doi: 10.4049/jimmunol.1500792 http://www.jimmunol.org/content/195/6/2571 References Subscription Permissions Email Alerts http://www.jimmunol.org/content/suppl/2015/08/12/jimmunol.150079 2.DCSupplemental This article cites 43 articles, 28 of which you can access for free at: http://www.jimmunol.org/content/195/6/2571.full#ref-list-1 Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Downloaded from http://www.jimmunol.org/ by guest on August 9, 2017 Supplementary Material The Journal of Immunology B Cell–Specific MHC Class II Deletion Reveals Multiple Nonredundant Roles for B Cell Antigen Presentation in Murine Lupus Josephine R. Giles,*,† Michael Kashgarian,‡ Pandelakis A. Koni,x,{ and Mark J. Shlomchik*,† S ystemic lupus erythematosus (SLE) is a chronic autoimmune disease with multiple immunologic and clinical manifestations. A hallmark of SLE is the presence of autoantibodies to ubiquitous self-Ags. Ab deposition in kidneys of lupus patients underpins the long-held notion that autoantibodies play a major part in disease pathogenesis. Indeed, B cells have been shown to play a central role in SLE, with the first direct evidence coming from genetic ablation in lupus-prone MRL.Faslpr mice (1). In the absence of B cells, there was a complete amelioration of glomerulonephritis. Strikingly, in these mice there was no development of interstitial nephritis, which is largely comprised of a T cell infiltrate. Furthermore, there was a marked reduction in CD4 and CD8 T cell activation as well as lymphadenopathy and splenomegaly, suggesting direct effects of B cells on T cells and that these effects contributed to end organ damage. These effects were Ab independent, as demonstrated by MRL.Faslpr mice engineered to have B cells that do not secrete Ig. Such mice still developed many features of SLE, including extensive T cell activation and renal disease (2). Together, these experiments indicated that B cells have both Ab-dependent and -independent functions in murine SLE. *Department of Immunobiology, Yale University School of Medicine, New Haven, CT 06519; †Department of Immunology, University of Pittsburgh School of Medicine, Pittsburgh, PA 15261; ‡Department of Pathology, Yale University School of Medicine, New Haven, CT 06519; xCancer Research Center, Georgia Regents University, Augusta, GA 30192; and {Department of Medicine, Georgia Regents University, Augusta, GA 30192 Received for publication April 2, 2015. Accepted for publication July 17, 2015. This work was supported by National Institutes of Health Grants R01-AR044077 (to M.J.S.) and T32-AI07019 (to J.R.G.). Address correspondence and reprint requests to Dr. Mark J. Shlomchik, University of Pittsburgh School of Medicine, W1052 Biomedical Science Tower, 200 Lothrop Street, Pittsburgh, PA 15261. E-mail address: [email protected] The online version of this article contains supplemental material. Abbreviations used in this article: AFC, Ab-forming cell; DC, dendritic cell; GC, germinal center; MHCII, MHC class II; RF, rheumatoid factor; SLE, systemic lupus erythematosus; Sm, Smith Ag; TEFH, T extrafollicular helper cell. Copyright Ó 2015 by The American Association of Immunologists, Inc. 0022-1767/15/$25.00 www.jimmunol.org/cgi/doi/10.4049/jimmunol.1500792 Although B cells can present Ag to T cells, the importance of this function in lupus has not been directly demonstrated. In particular, it remains controversial whether B cells can initiate responses by presenting to naive T cells. Classically, dendritic cells (DCs) are considered primary APCs and are arguably essential for initiating adaptive immune responses. However, DC-deficient MRL.Faslpr mice (3) had relatively minimal alterations in the activation, expansion, and differentiation of peripheral T cells. Instead, DCs appeared to be critical for local T cell expansion and differentiation in target organs, as these DC-deficient mice had significantly fewer renal infiltrates and improved kidney function. These findings might suggest that other APCs are more important in initial activation of autoreactive T cells, and DCs play a critical role in downstream events leading to disease pathology. However, results from DC-deficient mice do not exclude that B cells normally play only a secondary and redundant role, but that B cells are sufficient when DCs are absent. Given the strong paradigm that DCs must be the primary APC to initiate an immune response, this is an important question that remains to be addressed. The potential importance of B cell APC function in promoting autoimmunity is highlighted by recent findings that B cells specific for self-Ags that contain TLR7 or TLR9 ligands can be activated by coengagement of their BCR and TLRs (4, 5), bypassing, in part, the need for T cell help (6, 7). This type of autonomous activation also suggests that, once activated by BCR and TLR signals alone, B cells may be the initial APCs to break tolerance in the T cell compartment at the outset of the anti-self response (8–10). Notably, when T cells are present in vivo, they do amplify this BCR/TLR-driven activation, which is evidence of productive B–T interactions. Furthermore, B cells are likely to be particularly relevant APCs in an autoimmune response due to their ability to concentrate very small amounts of Ag though selective uptake of the BCR—endowing them with the potential to active low-affinity autoreactive T cells (11–14). Nonetheless, despite theories that B cell APC function is critical in systemic autoimmunity (1, 2, 10, 15), this has never been directly demonstrated. Nor is it known whether such APC function is nonredundant and whether it is, at least in part, upstream of DCdependent T cell activation. In the current studies, we sought to Downloaded from http://www.jimmunol.org/ by guest on August 9, 2017 B cells have both Ab-dependent and Ab-independent functions in systemic autoimmune diseases, including systemic lupus erythematosus (SLE). Ab-independent functions are known to be important, because mice with B cells but no secreted Ig have severe disease. These functions could include roles in lymphoid development, cytokine secretion, and Ag presentation; however, these possibilities have not been directly tested in SLE models. In this study, we show by lineage-specific ablation of MHC class II (MHCII) that B cell Ag presentation plays a nonredundant role in CD4+ T cell activation and effector differentiation in the MRL.Faslpr mouse model of SLE. MHCII-mediated interactions between B and T cells further promote B cell proliferation and differentiation, and, in fact, inefficient MHCII deletion on B cells led to strong selection of escaped cells in activated and plasmablast compartments, further underscoring the central role of B cell Ag presentation. Despite the leakiness in the system, B cell–specific MHCII deletion resulted in substantially ameliorated clinical disease. Hence, B cell Ag presentation is critical for T and B cell activation and differentiation, as well as target organ damage. The Journal of Immunology, 2015, 195: 2571–2579. 2572 formally address whether B cell APC function is in fact important in both disease and T cell activation by specifically deleting MHC class II (MHCII) on B cells in MRL.Faslpr mice. Materials and Methods Mice CD19-Cre and MHCIIfl/fl mice (16) were backcrossed 10 generations onto the Fas-deficient, lupus-prone MRL-MpJ-Faslpr/J strain (Jackson; referred to as MRL.Faslpr). These mice were intercrossed to generate CD19-Cre+/2 MHCIIfl/fl MRL.Faslpr mice. CD19-Cre+/2 MHCIIfl/fl MRL.Faslpr mice and MHCIIfl/fl MRL.Faslpr mice were bred together to generate experimental mice. All mice were analyzed at 12 wk of age. For BrdU labeling, mice were given an i.p. injection of 1 mg BrdU in sterile PBS 1 h before sacrifice. All animals were maintained under specific pathogen-free conditions and handled according to protocols approved by the Institutional Animal Care and Use Committee at Yale and the University of Pittsburgh. Evaluation of renal disease Kidneys were formalin fixed, paraffin embedded, and stained with H&E. Glomerular and interstitial nephritis were scored blindly by a pathologist (M.K.), as described (17). Proteinuria was assessed with Bayer Albustix strips. All surface staining was performed in ice-cold PBS with 3% calf serum and FcR blocking Ab, 24G.2, except for CXCR4 staining, which was done at room temperature. Ab clones used for surface staining were as follows: anti-CD19 (1D3), anti-CD22 (Cy34.1), anti-CD138 (281-2), anti-CD44 (1M7), anti-IE/IA (M5/114), anti–TCR-b (H57-597), anti-CD4 (GK1.5), anti-CD8 (TIA 105), anti-CD62L (Mel-14), anti–P-selectin glycoprotein ligand-1 (PSGL-1, 2PH1), anti-CXCR4 (2B11), anti-CD11c (N418), anti-CD11b (M1/70), anti-F4/80 (BM8), anti-BST2 (927), anti-Siglec H (eBio440c), antiLy6G/Ly6C (RB6-8C5), anti-Ly6C (HK1.4), anti–peanut agglutinin (Vector Laboratories), and anti-CD38 (90). Bcl6 staining used the eBioscience FoxP3/Transcription Factor Staining Buffer Set and the K112-91 clone. All other intracellular staining used the BD Cytofix/Cytoperm and Permwash buffers. Plasmablasts were detected with intracellular anti-k (187.1) and anti-IgM (B7-6). For intracellular cytokine staining, 4 3 106 splenocytes were stimulated with PMA (20 ng/ml) and ionomycin (750 ng/ml) for 4–6 h at 37˚C; brefeldin A (10 mg/ml) was added after the first 2 h. IFN-g was detected with clone XMG1.2; IL-21 was detected with a mouse rIL-21R subunit/human IgG1 Fc chimera (R&D Systems) and goat anti-human Fcg conjugated to PE (Jackson ImmunoResearch). Ethidium monoazidewas used for live-dead discrimination (Invitrogen); the cells were incubated under foil for 10 min and under a bright fluorescent light for 10 min. BrdU incorporation was detected, as previously described (18). Quantitative PCR To quantitate the deletion efficiency of MHCII, genomic DNA was extracted from FACS-purified cells. For each sample, the D cycle threshold was calculated by comparing MHCII and the unaffected gene, IL-10 (19). The DD cycle threshold was calculated by comparing each sorted subset (naive, activated, and plasmablasts) from CD19-Cre mice to control mice. IL-10 was amplified with forward primer, (59-39) GCTCTTACTGACTGGCATGAG and reverse primer, CGCAGCTCTAGGAGCATGTG. MHCII was amplified with forward primer, CCTGGTGACTGCCATTACCT, and reverse primer, AGGGTCCCTCAGAACACGAC. Cytokine message in FACS-purified DCs was measured, as previously described (19). Quantitative RT-PCR was performed with the Agilent Brilliant II SYBR Green QPCR kit on a Stratagene Mx3000P instrument. pared with MHCIIfl/fl littermate controls. In CD19-Cre mice, an average of 85% of the B cell population had undetectable surface MHCII expression (Fig. 1). Negligible loss of MHCII expression was observed in conventional DCs, plasmacytoid DCs, macrophages, and neutrophils (data not shown). Interestingly, there was an increase in the total number of conventional DCs in the CD19-Cre mice, and this population had an increase in surface expression of MHCII (Supplemental Fig. 1A, 1B). However, there was a decrease in CD86 expression (Supplemental Fig. 1C) and no detectable differences in cytokine message for IL-1b, IL-6, p35, or p40 by quantitative PCR (data not shown), indicating the conventional DCs were not in a more activated state. To directly assess the effect of MHCII expression on B cell activation and differentiation, we sorted naive B cells, activated B cells, and plasmablasts from the same CD19-Cre animals (Fig. 2A). Because MHCII is downregulated as B cells differentiate into AFCs, we used quantitative PCR to determine the amount of deletion within each population. Deletion efficiency among naive B cells was 95%. In stark contrast, only 29% of alleles were deleted in sorted plasmablasts (Fig. 2B). Activated B cells exhibited an intermediate genotype with 75% deletion. Because germinal center (GC) B cells normally express MHCII, we could assess deletion efficiency in this population by flow cytometry (Fig. 2C). In CD19-Cre mice, ∼75% of GC B cells expressed MHCII (Fig. 2D). Thus, although 95% of naive B cells and the majority of activated B cells lacked MHCII expression, the B cells that were able to form Ag-specific interactions with T cells had a significant advantage in further differentiation into both plasmablasts and GC B cells. The presence of these activated MHCII+ B cells in the CD19-Cre mice, however, does limit the impact of genetic deletion of MHCII in the CD19-Cre mice. Because there is only a partial loss of MHCII expression and such loss is further attenuated upon differentiation, any observed phenotypes would be minimal approximations of what would be achieved by complete deletion of MHCII on all B cells. MHCII-positive B cells have a significant proliferation advantage To assess the dependence of B cell proliferation on MHCII expression, we performed a 1-h BrdU pulse, which labels cells in S phase. There were ∼50% fewer splenic BrdU+ B cells in the CD19Cre mice compared with littermate controls (Fig. 3A). Strikingly, within the BrdU+ population in CD19-Cre mice, 65% of the cells were MHCII positive. In contrast, only 10% of the BrdU2 cells expressed MHCII (Fig. 3B). In contrast, there was no difference in the percentage of BrdU+ cells within the plasmablast compart- ELISPOT, ELISA, and Luminex Ab-forming cells (AFCs) were analyzed by ELISPOT, as previously described (19). Antinucleosome (20), anti-RNA (17), and anti-Smith Ag (Sm) (21) serum titers were determined by specific ELISAs, as previously described. The total serum Ig of IgM, IgG2a, IgG1, and IgAwas analyzed using Luminex assay (Millipore), according to the manufacturer’s instructions. Results Effects of selective deletion of MHCII in B cells To study the role of Ag presentation by B cells in lupus, we generated mice carrying both CD19-Cre and homozygous loxP-flanked MHCII (MHCIIfl/fl) alleles, hereafter called CD19-Cre mice, on the MRL.Faslpr background. The mice were aged to 12 wk and com- FIGURE 1. Deletion of MHCII in B cells. (A) Representative histograms of MHCII staining of splenic B cells from control, MHCIIfl/fl, and CD19-Cre MHCIIfl/fl mice. Cells were first gated as ethidium monoazide2 TCR-b2, then CD19highCD1382. (B) Frequency of MHCII+ splenic B cells, identified as in (A), in the experimental cohorts. Data are pooled from six independent cohorts of 12-wk-old mice; control n = 30 and CD19-Cre n = 32. Data are represented as mean 6 SEM. Statistics were calculated by two-tailed Mann– Whitney U test. ****p , 0.0001. Downloaded from http://www.jimmunol.org/ by guest on August 9, 2017 Flow cytometry B CELL–SPECIFIC MHCII DELETION IN LUPUS The Journal of Immunology ment between CD19-Cre and control animals (Fig. 3C), most likely reflective of the fact that essentially all plasmablasts must harbor at least one intact MHCII allele (given the ∼25% deletion frequency; Fig. 2B) and were thus able to engage T cell help at some point during their evolution. Expression of MHCII is critical for B cell differentiation Although there was clearly strong selection for cells that escaped deletion of MHCII during the progression of B cell activation, in the CD19-Cre mice there were nevertheless fewer total CD19high CD1382 B cells, a population that most likely included a combination of activated, naive, and memory B cells (Fig. 4A, 4B). This was probably, at least in part, due to the observed difference in proliferation (Fig. 3A). There were also decreases in the transitional and marginal zone B cell compartments, but no alterations were found in the bone marrow (data not shown). The total number of plasmablasts (CD19 IntCD138+ CD44highintracellular-khigh) per spleen was also reduced in CD19-Cre mice compared with littermate controls (Fig. 4A, 4C), probably due to decreased differentiation, as proliferation within the plasmablast compartment was similar between genotypes (Fig. 3C). Furthermore, the ratio of isotype-switched to nonswitched plasmablasts was significantly reduced in CD19-Cre mice (Fig. 4A, 4D). Similarly, GC B cells were also drastically reduced in CD19-Cre mice (Fig. 4E, 4F). CD19-Cre mice did not have significantly reduced IgM AFC numbers as measured by ELISPOT, but, commensurate with flow FIGURE 3. MHCII+ B cells have a significant proliferation advantage. One hour before sacrifice, mice were injected with 1 mg BrdU i.p. (A) Splenic B cells (ethidium monoazide2 TCR-b2CD22+) were evaluated for BrdU incorporation by flow cytometry. Data are represented as mean 6 SEM. (B) Representative staining plot of MHCII expression and BrdU incorporation of B cells from a CD19-Cre mouse. The bar graph represents the percentage of MHCII+ B cells within the BrdU2 and BrdU+ B cell populations as the mean 6 SEM. (C) Plasmablasts (ethidium monoazide2 TCR-b2CD22IntCD138+) were evaluated for BrdU incorporation by flow cytometry. Data are represented as mean 6SEM. Data are pooled from two independent experiments; control n = 21, CD19-Cre n = 20. Statistics were calculated by two-tailed Mann–Whitney U test. ****p , 0.0001. cytometry data on plasmablasts, IgG2a and IgG1 AFCs were decreased (Fig. 5A). These differences were reflected in the total serum Ig titers (Fig. 5B). Total serum IgG2a and IgG1 correlated with the percentage of residual MHCII+ B cells (Supplemental Fig. 2A, 2B). These findings agree with previous data that rheumatoid factor (RF) B cell AFC differentiation in T cell–deficient hosts showed a strong effect on isotype-switched AFCs, but no effect on IgM AFCs (7). The results support a critical role for cognate interactions with MHCII-restricted T cells in B cell differentiation and isotype switch. Specific autoantibodies differ in their dependence on B cell MHCII expression Although serum IgG is generally thought to be generated by GCderived long-lived plasma cells, at least some autoantibodies are largely produced by short-lived plasmablasts, which may be less dependent on MHCII expression and T cell help (22, 23). To assess the effects of B cell MHCII expression on the titers of serum autoantibodies, we performed specific ELISAs for antinucleosome, anti-RNA, and anti-Sm. Antinucleosome IgM titers were significantly reduced in CD19-Cre mice; however, there was not a statistically significant difference between CD19-Cre and control mice in isotypeswitched antinucleosome titers (Fig. 6A). Anti-RNA autoantibodies exhibited the opposite pattern: no difference in the IgM titer, but lower titers of anti-RNA IgG (Fig. 6B) in CD19-Cre mice, which correlated with the percentage of residual MHCII+ B cells (Supplemental Fig. 2C). Anti-Sm exhibited the greatest dependence on B cell MHCII expression; both IgM and IgG anti-Sm titers were lower in the CD19-Cre mice (Fig. 6C); IgG correlated with the percentage of residual MHCII+ B cells (Supplemental Fig. 2D). These results are likely a reflection of the differential abilities of the particular self-Ags to induce autonomous B cell activation without the initial need for T cells. In particular, B cells specific for Ags with strong BCR and TLR ligand Downloaded from http://www.jimmunol.org/ by guest on August 9, 2017 FIGURE 2. Selective differentiation of residual MHCII+ B cells in CD19-Cre mice. (A) FACS strategy to identify naive B cells, activated B cells, and plasmablasts. The cells were first gated as ethidium monoazide2 TCR-b2 CD11c2 CD11b2. (B) Deletion efficiency of MHCII in the three sorted cell populations was determined by quantitative RT-PCR. Deletion efficiency was calculated with the equation (1 2 residual MHCII) 3 100. Residual MHCII was calculated as 22DDCt. Data represent a total of nine CD19-Cre mice from two independent experiments; each dot is an individual mouse. Horizontal bars mark the mean. (C) Representative staining plots of MHCII staining on total B cells (ethidium monoazide2 TCR-b2CD22+) and GC B cells (ethidium monoazide2 TCR-b2 CD22+ CD38Int peanut agglutinin+) from one CD19-Cre mouse. (D) Summary data are represented as mean 6 SEM. Data are pooled from two independent cohorts of 12-wk-old mice; control n = 16 and CD19-Cre n = 16. Statistics were calculated by two-tailed Mann–Whitney U test. **p , 0.01, ****p , 0.0001. 2573 2574 B CELL–SPECIFIC MHCII DELETION IN LUPUS activities may not depend as greatly on T cell help for activation and differentiation. B cell Ag presentation plays a nonredundant role in T cell activation and differentiation Thegreater reduction innumbers ofactivated and memoryphenotype T cells previously reported in B cell–deficient versus DC-deficient MRL.Faslpr mice suggests that B cells may be more important in initial Ag presentation and activation (1, 3, 24). We assessed the FIGURE 5. Isotype switch in AFCs is dependent on MHCII. (A) Total numbers of AFCs per spleen were determined by ELISPOT for IgM, IgG2a, and IgG1. Each dot is an individual mouse. Bars show geometric means. Data are pooled from six independent cohorts of 12-wk-old mice; control n = 29 and CD19-Cre n = 32. (B) Serum Ig concentrations determined by multiplex ELISAs. Data are represented as mean 6 SEM. Data are pooled from seven independent cohorts of 12-wk-old mice; control n = 35 and CD19-Cre n = 32. Statistics were calculated by two-tailed Mann–Whitney U test. *p , 0.05, ****p , 0.0001. T cell compartment in CD19-Cre mice to directly test whether B cell APC function is needed for optimal T cell activation and expansion. CD19-Cre mice had no reduction in the total number of splenic T cells (Fig. 7A). However, the percentage of activated T cells in CD19-Cre mice was significantly lower in both the CD4 and CD8 populations (Fig. 7B, 7C). There was a concurrent increase in naive phenotype cells that correlated with the percentage of residual MHCII+ B cells (Fig. 7B, 7C, Supplemental Fig. 2E, 2F). There was a consistent decrease in frequencies of IFN-g+ CD4 T cells, but not Downloaded from http://www.jimmunol.org/ by guest on August 9, 2017 FIGURE 4. Expression of MHCII is critical for plasmablast and GC B cell differentiation. (A) Representative staining plots of plasmablast and B cell gating. Cells were first gated as ethidium monoazide2 TCR-b2. (B) Total number of B cells and (C) plasmablasts per spleen determined by flow cytometry. Data are represented as mean 6 SEM. (D) Isotype-switched plasmablasts (IgM2) were normalized to the nonswitched (IgM+). Data are represented as mean 6 SEM. Data are pooled from six independent cohorts of 12-wk-old mice; control n = 30 and CD19-Cre n = 32. (E) Representative staining plots of GC B cell gating from one control mouse and one CD19-Cre mouse. Cells were first gated on ethidium monoazide2 TCR-b2CD22+. (F) Total number of GC B cells per spleen identified as in (E). Data are represented as mean 6 SEM. Data are pooled from two independent cohorts of 12-wk-old mice; control n = 26 and CD19-Cre n = 16. Statistics were calculated by two-tailed Mann–Whitney U test. ***p , 0.001, ****p , 0.0001. The Journal of Immunology 2575 in IFN-g+ CD8 T cells, upon PMA/ionomycin restimulation in vitro, which also correlated with the percentage of residual MHCII+ B cells (Fig. 7D, 7E, Supplemental Fig. 2G). Hence, there is a nonredundant role for B cell–MHCII expression in the activation and subsequent differentiation of T cells in lupus. As discussed above, the incomplete deletion and preferential activation of escaped MHCII+ B cells could have led to the large number of activated effectors observed in the CD19-Cre mice. A more complete deletion almost certainly would have resulted in a more profound effect in the T cell compartment, possibly approaching that seen in the total B cell knockout. It is also possible that other professional APCs could have compensated in the absence of B cell–expressed MHCII. Decrease in Th cells in CD19-Cre mice T extrafollicular helper cells (TEFH) comprise in both lupus-prone and normal mice a Bcl6-expressing B-helper CD4 T cell subset that is present extrafollicularly, presumably as a result of CXCR4, rather than CXCR5, expression (25–29). Work from our laboratory has found a near-complete loss of these cells in B cell–deficient MRL.Faslpr mice (30). There was a significant decrease in the number of splenic TEFH cells in the CD19-Cre mice (Fig. 8A, 8B). However, the frequency of IL-21–producing cells within the CD4 T cell compartment, which include TEFH as well as other more numerous effector populations, was similar between CD19-Cre and control mice (Fig. 8C). MHCII on B cells significantly affects clinical disease Perhaps the most important aspect of our studies was the opportunity to directly test whether the development of clinical disease would depend on the ability of B cells to present Ag to CD4 T cells. Critically, and despite inefficient B cell MHCII deletion, CD19-Cre mice had significantly less interstitial and glomerular FIGURE 7. B cell Ag presentation plays a nonredundant role in T cell activation and differentiation. (A) Total numbers of CD4, CD8, DN, and T cells enumerated by flow cytometry. Frequency of naive (CD442CD62L+) and activated (CD44+CD62L2) (B) CD4 and (C) CD8 T cells determined by flow cytometry. Representative intracellular IFN-g staining histograms and numbers of (D) CD4 and (E) CD8 T cells stimulated with PMA and ionomycin. Control mice are shown in bold. Data are represented as mean 6 SEM. Data are pooled from six independent cohorts of 12-wk-old mice; control n = 30 and CD19-Cre n = 32. Statistics were calculated by two-tailed Mann–Whitney U test. **p , 0.01, ***p , 0.001, ****p , 0.0001. Downloaded from http://www.jimmunol.org/ by guest on August 9, 2017 FIGURE 6. Specific autoantibodies differ in their dependence on B cell MHCII expression. (A) Serum concentration of antinucleosome IgM and IgG, (B) anti-RNA IgM and IgG, and (C) anti-Sm IgM and IgG was determined by ELISA. Bars show geometric means. Data are pooled from seven independent cohorts of 12-wk-old mice; control n = 35 and CD19-Cre n = 39. Statistics were calculated by two-tailed Mann–Whitney U test. *p , 0.05, **p , 0.01, ***p , 0.001, ****p , 0.0001. 2576 B CELL–SPECIFIC MHCII DELETION IN LUPUS nephritis than littermate controls (Fig. 9A). These histological differences were reflected in the improved kidney function as measured by proteinuria (Fig. 9B). CD19-Cre mice had substantially reduced lymph node weight and a small but significant decrease in spleen weight compared with controls (Fig. 9C, 9D). These findings demonstrate a nonredundant role for Ag presentation by B cells in end-organ damage and overall pathogenesis (Fig. 10). Discussion B cells play central and multiple roles in systemic autoimmune diseases (31). Although autoantibody production was originally thought to be the main contribution of B cells, accumulating data support that B cells have important Ab-independent functions. It is critical to distinguish putative functions that were suggested or inferred in discussions of data derived from complete B cell deletion or receptor restriction from those that have been directly tested and proven (32–35). Subsequent work has addressed these various functions in turn. Ab-independent roles in autoimmunity have been demonstrated by the observation of persistent disease in mice with B cells that cannot secrete Abs (2). Potential roles in lymphoid tissue development were addressed by depletion of B cells in adult mice, which did partially ameliorate disease, demonstrating that at least some aspects by which B cells promote disease are independent of developmental issues (36, 37). However, although a role for Ag presentation may have been inferred, in our view it could not have been addressed without directly impairing Ag presentation on B cells, which in turn would be most convincingly achieved by cell-specific deletion of MHCII. An important role for B cells as APCs has been implicated in other autoimmune diseases. A role for B cell–specific Ag presentation was recently shown in myelin oligodendrocyte glycoprotein–induced experimental autoimmune encephalomyelitis, in which heterologous Ag given in CFA induces a transient T cell autoimmune syndrome (38). In the NOD mice, MHCII expression on B cells was necessary for the development of spontaneous destructive diabetes (39). To our knowledge, the importance of B cell presentation has yet to be directly tested in any model of SLE. In this study, we report the outcome in mice carrying CD19-Cre and MHCIIfl/fl genotypes that were fully backcrossed onto the lupus-prone MRL.Faslpr background. These results provide direct evidence that Ag presentation by B cells does have a nonredundant role in T cell activation, Th1 differentiation, and Th cell differentiation in a murine model of lupus. We also found that the cognate, MHCII-mediated interactions between B and T cells are important for B cell activation, proliferation, and differentiation. Given the robust response of the escapee B cells in our system, it is notable that there was a clear biologically and statistically significant effect on clinical disease—including kidney disease, lymphadenopathy, and splenomegaly—indicating a requisite role for B cell APC function in these processes. Complete deletion of MHCII in the B cell compartment almost certainly would have led to an even more profound effect. These results, in combination with previous studies, formally demonstrate that B cells are key APCs in systemic autoimmune disease and highlight the importance FIGURE 9. Deletion of MHCII on B cells ameliorates clinical disease. (A) Glomerular and interstitial nephritis (GN and IN) were scored from 0 to 6. (B) Proteinuria was scored from 0 to 5. Each dot represents an individual mouse. Horizontal lines represent the medians. (C) Weights of combined axillary lymph nodes and (D) spleen were measured. Data are represented as median 6 SEM. Data are pooled from six independent cohorts of 12-wk-old mice; control n = 30 and CD19-Cre n = 32. Statistics were calculated by two-tailed Mann–Whitney U test. *p , 0.05, ***p , 0.001. Downloaded from http://www.jimmunol.org/ by guest on August 9, 2017 FIGURE 8. TEFH cells are decreased in CD19-Cre mice. (A) Representative staining plots of TEFH gating. Cells are first gated on ethidium monoazide2 CD192 . Percentage is the mean of TEFH of CD4 T cells in CD19-Cre mice. (B) The number of TEFH cells per spleen, as identified in (A). Data are pooled from two independent cohorts; control n = 9, CD19-Cre n = 12. (C) Representative intracellular IL-21 staining plots of CD4 T cells unstimulated (left) and stimulated with PMA and ionomycin (right). Data are represented as mean 6 SEM. Data are pooled from two independent cohorts of 12-wk-old mice; control n = 15 and CD19-Cre n = 10. Statistics were calculated by two-tailed Mann–Whitney U test. *p , 0.05. The Journal of Immunology 2577 of Ag-specific B cell–T cell interactions even in a TLR-driven response that can occur outside of GCs. The incomplete deletion of MHCII on B cells in the CD19-Cre MHCIIfl/fl mice, although not ideal, did enable us to compare the fate of MHCII+ and MHCII2 B cells within the same animal. MHCII+ B cells had a substantial advantage in almost every parameter we examined: proliferation, differentiation into plasmablasts or GC B cells, and isotype switching. The dramatic expansion of B cells that retained a MHCII allele during progression through expansion and differentiation underscores the importance of B–T cognate interactions in all of these processes. A similar escape phenomenon was observed in a study using the same Cre-LoxP system and a traditional T-dependent model Ag. When CD19-Cre MHCIIfl/fl C57BL/6 mice were immunized with nitrophenyl– chicken gamma globulin, as few as 2% of residual MHCII+ B cells were able to expand, with the response eventually reaching similar numbers of GC B cells to the MHCII-intact animals (40). Despite the importance of T–B cognate interactions, our experiments do show that expression of MHCII is not strictly required for any aspect of the B cell response. Indeed, the majority of acti- vated B cells still had fully deleted MHCII. This indicates that initial activation is mostly T independent, as we have previously found for the TLR-dependent RF B cell response in the AM14 model system (6, 7). However, further differentiation into plasmablasts or GC B cells is substantially affected by the loss of cognate T cell help. Although the differentiation into plasmablasts was significantly decreased in the CD19-Cre MHCIIfl/fl mice, only isotypeswitched AFC and resulting serum IgG were affected. This greater dependence on T cell help for isotype-switched AFCs is also consistent with our previous studies with the AM14 B cells and also studies of T cell–deficient MRL.Faslpr mice (6, 7, 41, 42). It is interesting that the large number of activated and cytokineproducing CD4 T cells that were present in CD19-Cre mice could not compensate for the lack of Ag-specific interactions. The necessity for cognate interactions to promote full-blown B cell–mediated autoimmunity was also suggested by a previous study showing reduced disease in TCR transgenic MRL.Faslpr mice with a restricted repertoire (43). The partial T cell–independence of B cell activation, as shown in this work and also as demonstrated for in vivo activation of RF Downloaded from http://www.jimmunol.org/ by guest on August 9, 2017 FIGURE 10. Activation and pathogenesis in systemic autoimmunity (1). Autoreactive B cells, such as those specific for DNA, become activated through engagement of their BCR and TLRs in a MyD88-dependent manner (2). Activated autoreactive B cells present Ag on MHCII and upregulate costimulatory molecules, resulting in the activation of cognate autoreactive CD4 T cells (3). B cells and DCs promote subsequent differentiation into Th1 and TEFH cells (4). Cognate-activated T cells provide help such as CD40 ligation and cytokines, resulting in significant expansion and isotype switch of the plasmablasts (5). Activated autoreactive B cells promote epitope spreading and expansion of the anti-self response. B cells have the potential to present anything that is endocytosed through their BCR, not only the protein sequences recognized by the CDR3 region (6). Activated T cells migrate and infiltrate target tissues, such as the kidneys, in a DC-dependent manner. These T cells may activate resident or migratory DCs through CD40-CD40L ligation that induces ICOSL expression on the DCs. DC-expressed ICOSL promotes kidney damage. 2578 Acknowledgments We thank Jaime Cullen for excellent technical assistance. We thank the technicians of the Yale Animal Resources Center and Division of Laboratory Animal Resources at the University of Pittsburgh for excellent work in animal husbandry. Disclosures The authors have no financial conflicts of interest. References 1. Chan, O., and M. J. Shlomchik. 1998. A new role for B cells in systemic autoimmunity: B cells promote spontaneous T cell activation in MRL-lpr/lpr mice. J. Immunol. 160: 51–59. 2. Chan, O. T. M., L. G. Hannum, A. M. Haberman, M. P. Madaio, and M. J. Shlomchik. 1999. A novel mouse with B cells but lacking serum antibody reveals an antibody-independent role for B cells in murine lupus. J. Exp. Med. 189: 1639–1648. 3. Teichmann, L. L., M. L. Ols, M. Kashgarian, B. Reizis, D. H. Kaplan, and M. J. Shlomchik. 2010. Dendritic cells in lupus are not required for activation of T and B cells but promote their expansion, resulting in tissue damage. Immunity 33: 967–978. 4. Leadbetter, E. A., I. R. Rifkin, A. M. Hohlbaum, B. C. Beaudette, M. J. Shlomchik, and A. Marshak-Rothstein. 2002. Chromatin-IgG complexes activate B cells by dual engagement of IgM and Toll-like receptors. Nature 416: 603–607. 5. Lau, C. M., C. Broughton, A. S. Tabor, S. Akira, R. A. Flavell, M. J. Mamula, S. R. Christensen, M. J. Shlomchik, G. A. Viglianti, I. R. Rifkin, and A. Marshak-Rothstein. 2005. RNA-associated autoantigens activate B cells by combined B cell antigen receptor/Toll-like receptor 7 engagement. J. Exp. Med. 202: 1171–1177. 6. Herlands, R. A., S. R. Christensen, R. A. Sweet, U. Hershberg, and M. J. Shlomchik. 2008. T cell-independent and Toll-like receptor-dependent antigen-driven activation of autoreactive B cells. Immunity 29: 249–260. 7. Sweet, R. A., M. L. Ols, J. L. Cullen, A. V. Milam, H. Yagita, and M. J. Shlomchik. 2011. Facultative role for T cells in extrafollicular Toll-like receptor-dependent autoreactive B-cell responses in vivo. Proc. Natl. Acad. Sci. USA 108: 7932–7937. 8. Rodrı́guez-Pinto, D. 2005. B cells as antigen presenting cells. Cell. Immunol. 238: 67–75. 9. Rodrı́guez-Pinto, D., and J. Moreno. 2005. B cells can prime naive CD4+ T cells in vivo in the absence of other professional antigen-presenting cells in a CD154CD40-dependent manner. Eur. J. Immunol. 35: 1097–1105. 10. Yan, J., B. P. Harvey, R. J. Gee, M. J. Shlomchik, and M. J. Mamula. 2006. B cells drive early T cell autoimmunity in vivo prior to dendritic cell-mediated autoantigen presentation. J. Immunol. 177: 4481–4487. 11. Kurt-Jones, E. A., D. Liano, K. A. HayGlass, B. Benacerraf, M. S. Sy, and A. K. Abbas. 1988. The role of antigen-presenting B cells in T cell priming in vivo: studies of B cell-deficient mice. J. Immunol. 140: 3773–3778. 12. Lanzavecchia, A. 1985. Antigen-specific interaction between T and B cells. Nature 314: 537–539. 13. Lanzavecchia, A. 1990. Receptor-mediated antigen uptake and its effect on antigen presentation to class II-restricted T lymphocytes. Annu. Rev. Immunol. 8: 773–793. 14. Tony, H. P., N. E. Phillips, and D. C. Parker. 1985. Role of membrane immunoglobulin (Ig) crosslinking in membrane Ig-mediated, major histocompatibilityrestricted T cell-B cell cooperation. J. Exp. Med. 162: 1695–1708. 15. Mamula, M. J., S. Fatenejad, and J. Craft. 1994. B cells process and present lupus autoantigens that initiate autoimmune T cell responses. J. Immunol. 152: 1453–1461. 16. Hashimoto, K., S. K. Joshi, and P. A. Koni. 2002. A conditional null allele of the major histocompatibility IA-beta chain gene. Genesis 32: 152–153. 17. Campbell, A. M., M. Kashgarian, and M. J. Shlomchik. 2012. NADPH oxidase inhibits the pathogenesis of systemic lupus erythematosus. Sci. Transl. Med. 4: 157ra141. 18. Nickerson, K. M., J. L. Cullen, M. Kashgarian, and M. J. Shlomchik. 2013. Exacerbated autoimmunity in the absence of TLR9 in MRL.Fas(lpr) mice depends on Ifnar1. J. Immunol. 190: 3889–3894. 19. Teichmann, L. L., D. Schenten, R. Medzhitov, M. Kashgarian, and M. J. Shlomchik. 2013. Signals via the adaptor MyD88 in B cells and DCs make distinct and synergistic contributions to immune activation and tissue damage in lupus. Immunity 38: 528–540. 20. Nickerson, K. M., S. R. Christensen, J. Shupe, M. Kashgarian, D. Kim, K. Elkon, and M. J. Shlomchik. 2010. TLR9 regulates TLR7- and MyD88-dependent autoantibody production and disease in a murine model of lupus. J. Immunol. 184: 1840–1848. 21. Christensen, S. R., M. Kashgarian, L. Alexopoulou, R. A. Flavell, S. Akira, and M. J. Shlomchik. 2005. Toll-like receptor 9 controls anti-DNA autoantibody production in murine lupus. J. Exp. Med. 202: 321–331. 22. William, J., C. Euler, and M. J. Shlomchik. 2005. Short-lived plasmablasts dominate the early spontaneous rheumatoid factor response: differentiation pathways, hypermutating cell types, and affinity maturation outside the germinal center. J. Immunol. 174: 6879–6887. 23. Hoyer, B. F., K. Moser, A. E. Hauser, A. Peddinghaus, C. Voigt, D. Eilat, A. Radbruch, F. Hiepe, and R. A. Manz. 2004. Short-lived plasmablasts and long-lived plasma cells contribute to chronic humoral autoimmunity in NZB/W mice. J. Exp. Med. 199: 1577–1584. 24. Chan, O. T. M., M. P. Madaio, and M. J. Shlomchik. 1999. B cells are required for lupus nephritis in the polygenic, Fas-intact MRL model of systemic autoimmunity. J. Immunol. 163: 3592–3596. 25. Odegard, J. M., B. R. Marks, L. D. DiPlacido, A. C. Poholek, D. H. Kono, C. Dong, R. A. Flavell, and J. Craft. 2008. ICOS-dependent extrafollicular helper T cells elicit IgG production via IL-21 in systemic autoimmunity. J. Exp. Med. 205: 2873–2886. 26. Weinstein, J. S., S. G. Hernandez, and J. Craft. 2012. T cells that promote B-cell maturation in systemic autoimmunity. Immunol. Rev. 247: 160–171. 27. Yu, D., A. H. Tan, X. Hu, V. Athanasopoulos, N. Simpson, D. G. Silva, A. Hutloff, K. M. Giles, P. J. Leedman, K. P. Lam, et al. 2007. Roquin represses autoimmunity by limiting inducible T-cell co-stimulator messenger RNA. Nature 450: 299–303. 28. Linterman, M. A., R. J. Rigby, R. K. Wong, D. Yu, R. Brink, J. L. Cannons, P. L. Schwartzberg, M. C. Cook, G. D. Walters, and C. G. Vinuesa. 2009. Follicular helper T cells are required for systemic autoimmunity. J. Exp. Med. 206: 561–576. 29. Lee, S. K., R. J. Rigby, D. Zotos, L. M. Tsai, S. Kawamoto, J. L. Marshall, R. R. Ramiscal, T. D. Chan, D. Gatto, R. Brink, et al. 2011. B cell priming for extrafollicular antibody responses requires Bcl-6 expression by T cells. J. Exp. Med. 208: 1377–1388. 30. Teichmann, L. L., J. L. Cullen, M. Kashgarian, C. Dong, J. Craft, and M. J. Shlomchik. 2015. Local triggering of the ICOS coreceptor by CD11c(+) myeloid cells drives organ inflammation in lupus. Immunity 42: 552–565. 31. Chan, O. T., M. P. Madaio, and M. J. Schlomchik. 1999. The central and multiple roles of B cells in lupus pathogenesis. Immunol. Rev. 169: 107–121. 32. Noorchashm, H., N. Noorchashm, J. Kern, S. Y. Rostami, C. F. Barker, and A. Naji. 1997. B-cells are required for the initiation of insulitis and sialitis in nonobese diabetic mice. Diabetes 46: 941–946. 33. Akashi, T., S. Nagafuchi, K. Anzai, S. Kondo, D. Kitamura, S. Wakana, J. Ono, M. Kikuchi, Y. Niho, and T. Watanabe. 1997. Direct evidence for the contribution of B cells to the progression of insulitis and the development of diabetes in non-obese diabetic mice. Int. Immunol. 9: 1159–1164. Downloaded from http://www.jimmunol.org/ by guest on August 9, 2017 B cells, raises the question of how important T–B interactions are in an immune response that is driven by B cell–intrinsic TLR signaling (6). B cell–specific deletion of MyD88 in otherwise intact MRL.Faslpr mice demonstrated that this molecule is not only critical for intrinsic activation, but also promotes disease, including kidney infiltration by T cells (19). This in turn indicates that certain types of autoreactive B cells that can initially be activated via BCR and TLR dual signals are subsequently important for broader T cell activation and disease pathology. Autoreactive T cells are believed to escape central deletion because they have very low affinity for self Ags. Cognate autoreactive B cells could concentrate and present self Ag at levels high enough to induce activation even in very low-affinity T cells. Conversely, DCs are not needed for the vast majority of peripheral T cell activation in this lupus model, suggesting that at best they play a redundant role in this process (3). Although these findings are consistent with the notion that B cells have nonredundant roles in Ag presentation, the lack of requirement for DCs in peripheral T cell activation by no means proved that B cells are required. This key fact is something that only B cell–intrinsic deletion of MHCII could demonstrate. By incorporating present and prior studies, we present a model (Fig. 10) in which B cells are the initial APCs for the activation of autoreactive T cells, something that occurs after T cell–independent/ TLR-dependent activation of the B cell. Subsequent B cell and T cell expansion and differentiation—both of which result in target organ damage—depend on B cell–expressed MHCII. Once there has been substantial T cell activation and epitope spreading, T cells that infiltrate organs will be sustained by CD11c+ cells in an ICOSL-dependent, MyD88-independent fashion (19, 30). In target organs, we propose that previously activated infiltrating T cells can provide CD40L signals to DCs to induce optimal costimulatory signals from DCs. This is consistent with the fact that MyD88-dependent signals are dispensable in DCs with respect to kidney disease. The next step in defining this schema is to better understand the nature and regulation of the autoreactive T cells that help B cells and promote tissue damage. B CELL–SPECIFIC MHCII DELETION IN LUPUS The Journal of Immunology 34. Serreze, D. V., H. D. Chapman, D. S. Varnum, M. S. Hanson, P. C. Reifsnyder, S. D. Richard, S. A. Fleming, E. H. Leiter, and L. D. Shultz. 1996. B lymphocytes are essential for the initiation of T cell-mediated autoimmune diabetes: analysis of a new “speed congenic” stock of NOD.Ig m null mice. J. Exp. Med. 184: 2049–2053. 35. Serreze, D. V., S. A. Fleming, H. D. Chapman, S. D. Richard, E. H. Leiter, and R. M. Tisch. 1998. B lymphocytes are critical antigen-presenting cells for the initiation of T cell-mediated autoimmune diabetes in nonobese diabetic mice. J. Immunol. 161: 3912–3918. 36. Ahuja, A., J. Shupe, R. Dunn, M. Kashgarian, M. R. Kehry, and M. J. Shlomchik. 2007. Depletion of B cells in murine lupus: efficacy and resistance. J. Immunol. 179: 3351–3361. 37. Bekar, K. W., T. Owen, R. Dunn, T. Ichikawa, W. Wang, R. Wang, J. Barnard, S. Brady, S. Nevarez, B. I. Goldman, et al. 2010. Prolonged effects of short-term anti-CD20 B cell depletion therapy in murine systemic lupus erythematosus. Arthritis Rheum. 62: 2443–2457. 38. Molnarfi, N., U. Schulze-Topphoff, M. S. Weber, J. C. Patarroyo, T. Prod’homme, M. Varrin-Doyer, A. Shetty, C. Linington, A. J. Slavin, J. Hidalgo, et al. 2013. MHC class II-dependent B cell APC function is required 2579 39. 40. 41. 42. 43. for induction of CNS autoimmunity independent of myelin-specific antibodies. J. Exp. Med. 210: 2921–2937. Noorchashm, H., Y. K. Lieu, N. Noorchashm, S. Y. Rostami, S. A. S. Greeley, A. Schlachterman, H. K. Song, L. E. Noto, A. M. Jevnikar, C. F. Barker, and A. Naji. 1999. I-Ag7-mediated antigen presentation by B lymphocytes is critical in overcoming a checkpoint in T cell tolerance to islet b cells of nonobese diabetic mice. J. Immunol. 163: 743–750. Shimoda, M., T. Li, J. P. S. Pihkala, and P. A. Koni. 2006. Role of MHC class II on memory B cells in post-germinal center B cell homeostasis and memory response. J. Immunol. 176: 2122–2133. Jevnikar, A. M., M. J. Grusby, and L. H. Glimcher. 1994. Prevention of nephritis in major histocompatibility complex class II-deficient MRL-lpr mice. J. Exp. Med. 179: 1137–1143. Wofsy, D., J. A. Ledbetter, P. L. Hendler, and W. E. Seaman. 1985. Treatment of murine lupus with monoclonal anti-T cell antibody. J. Immunol. 134: 852–857. Peng, S. L., S. Fatenejad, and J. Craft. 1996. Induction of nonpathologic, humoral autoimmunity in lupus-prone mice by a class II-restricted, transgenic a b T cell: separation of autoantigen-specific and -nonspecific help. J. Immunol. 157: 5225–5230. Downloaded from http://www.jimmunol.org/ by guest on August 9, 2017