Download Interaction between tumour-infiltrating B cells and T cells controls

Downloaded from http://gut.bmj.com/ on August 3, 2017 - Published by group.bmj.com
Hepatology
ORIGINAL ARTICLE
Interaction between tumour-infiltrating B cells and
T cells controls the progression of hepatocellular
carcinoma
Marta Garnelo,1 Alex Tan,1 Zhisheng Her,2 Joe Yeong,1,3 Chun Jye Lim,4
Jinmiao Chen,1 Kiat Hon Lim,3 Achim Weber,5 Pierce Chow,6,7,13
Alexander Chung,6,7 London Lucien PJ Ooi,6,7,13 Han Chong Toh,6
Mathias Heikenwalder,8,9 Irene O L Ng,10,11 Alessandra Nardin,1 Qingfeng Chen,2,6
Jean-Pierre Abastado,1,12 Valerie Chew1,4,13
▸ Additional material is
published online only. To view
please visit the journal online
(http://dx.doi.org/10.1136/
gutjnl-2015-310814).
For numbered affiliations see
end of article.
Correspondence to
Dr Valerie Chew, SingHealth
Translational Immunology and
Inflammation Centre (STIIC),
Singapore Health Services Pte
Ltd, 20 College Road, the
Academia, Level 8 Discovery
Tower, Singapore 169856,
Singapore;
Valerie.chew.s.p@singhealth.
com.sg
MG and AT contributed
equally.
Received 28 September 2015
Revised 12 October 2015
Accepted 14 October 2015
ABSTRACT
Objective The nature of the tumour-infiltrating
leucocytes (TILs) is known to impact clinical outcome in
carcinomas, including hepatocellular carcinoma (HCC).
However, the role of tumour-infiltrating B cells (TIBs)
remains controversial. Here, we investigate the impact of
TIBs and their interaction with T cells on HCC patient
prognosis.
Design Tissue samples were obtained from 112
patients with HCC from Singapore, Hong Kong and
Zurich and analysed using immunohistochemistry and
immunofluorescence. RNA expression of CD19, CD8A,
IFNG was analysed using quantitative PCR. The
phenotype of freshly isolated TILs was analysed using
flow cytometry. A mouse model depleted of mature B
cells was used for functional study.
Results Tumour-infiltrating T cells and B cells were
observed in close contact with each other and their
densities are correlated with superior survival in patients
with HCC. Furthermore, the density of TIBs was correlated
with an enhanced expression of granzyme B and IFN-γ,
as well as with reduced tumour viability defined by low
expression of Ki-67, and an enhanced expression of
activated caspase-3 on tumour cells. CD27 and CD40
costimulatory molecules and TILs expressing activation
marker CD38 in the tumour were also correlated with
patient survival. Mice depleted of mature B cells and
transplanted with murine hepatoma cells showed reduced
tumour control and decreased local T cell activation,
further indicating the important role of B cells.
Conclusions The close proximity of tumour-infiltrating
T cells and B cells indicates a functional interaction
between them that is linked to an enhanced local
immune activation and contributes to better prognosis
for patients with HCC.
Significance of this study
What is already known on this subject?
▸ We have previously shown that the nature of
tumour-infiltrating leucocytes has an impact
on hepatocellular carcinoma (HCC) patient
survival.
▸ Multiple costimulatory molecules involved in T
cell–B cell interaction have been implicated in
cancer prognosis.
▸ The role of tumour-infiltrating B cells (TIBs),
however, remains controversial with several
studies reporting contradictory findings.
What are the new findings?
▸ We show that the density of TIBs correlates
with an enhanced expression of granzyme B
and IFN-γ as well as with reduced viability of
tumour cells.
▸ We demonstrate the densities of T cells and B
cells that are in close proximity to each other,
costimulatory molecules CD27 and CD40 and
activation marker CD38, all indicative of local
immune activation were associated with better
survival in a total of 112 patients from
Singapore, Hong Kong and Zurich, that is,
irrespective of patient ethnicity and disease
aetiology.
▸ We use a murine model depleted of mature B
cells and transplanted with murine hepatoma
cell lines to demonstrate the critical role of B
cell in tumour control and local T cell
activation.
How might it impact on clinical practice in
the foreseeable future?
INTRODUCTION
To cite: Garnelo M, Tan A,
Her Z, et al. Gut Published
Online First: [ please include
Day Month Year]
doi:10.1136/gutjnl-2015310814
Hepatocellular carcinoma (HCC) is the sixth most
common cancer, but the second leading cause of
death by cancer worldwide.1 The link between
inflammation due to hepatitis virus infection or
alcoholism and HCC tumorigenesis is well known,2
but the role of the immune response in cancer progression or prognosis requires further elucidation.
▸ Improved understanding of the importance of
T cell–B cell interaction, the costimulatory
molecules involved and the resulting activation
of local immune response in HCC progression.
▸ Providing evidence supporting clinical
development of agonists targeting
costimulatory molecules for cancer
immunotherapy.
Garnelo M, et al. Gut 2015;0:1–10. doi:10.1136/gutjnl-2015-310814
1
Downloaded from http://gut.bmj.com/ on August 3, 2017 - Published by group.bmj.com
Hepatology
Tumour-infiltrating T cells, especially CD8+ T cells, have been
shown to play a critical role in controlling tumour progression.3
Studies in many human cancers, including HCC, demonstrated
a positive correlation between the density of T cells and better
patient prognosis.4 On the other hand, the involvement of B
cells in cancer development and progression is rather controversial. Previous findings from a diethylnitrosamine-induced liver
cancer mouse model showed that T cells and B cells are important in suppressing tumour development and progression.5
Several B cell activation genes were reported to be downregulated in patients with HCC with poor prognosis suggesting their
protective roles in tumour progression.5 Others, however, found
that a special subset of B cells defined as regulatory B cells
(Bregs) with CD19+CD24hiCD38hi phenotype was enriched in
the tumour microenvironment and was associated with progression of various cancers, including HCC.6 7
The interaction between T cells and B cells is known to be
critical in the activation of local immune response in several
inflammatory conditions, including cancer.8 Multiple costimulatory and coinhibitory molecules that are expressed on T cells
have been the recent targets of a new generation of immunotherapies, such as anti-CTLA-4, anti-PD-1/PD-L1 or anti-OX40
antibodies, which aim to enhance the local antitumour immune
response either through blocking coinhibitory checkpoint receptors or activating costimulatory receptors expressed on tumourinfiltrating T cells.9 The balance of these molecules/receptors
has been shown to be paramount in eliciting efficient antitumour immune response, supporting the basis of combinatorial
strategy in immunotherapy.10
We here present an extensive retrospective study on the role
of T cells and B cells from a total of 112 patients with HCC
from Singapore, Hong Kong and Zurich, that is, with different
ethnicities as well as disease aetiologies. By investigating the
archived tissues from patients with HCC, we found that the
densities of both T cells and B cells are associated with better
patient survival and decreased tumour aggressiveness. The
phenotype of both tumour-infiltrating T and B cells suggests that
they acquire an activated phenotype as a result of their close
proximity and interaction. A mouse model depleted of mature B
cells further demonstrated the key role of B cells in controlling
tumour progression and local T cell activation.
MATERIALS AND METHODS
Patients
One hundred and twelve formalin-fixed paraffin-embedded
(FFPE) patient tissue samples from resected HCC were obtained
from the National Cancer Centre (NCC), Singapore (n=40); the
Queen Mary Hospital, Hong Kong (n=45) and the University
Hospital Zurich, Switzerland (n=27). The tissues were used for
immunohistochemistry (IHC) or immunofluorescence (IF) labelling. Among these, 81 RNA samples were also obtained for gene
expression analysis. All samples were obtained with ethics committee approval from patients who underwent curative resection
from 1991 to 2009. A table comparing patient characteristics
from different cohorts is listed in online supplementary table S1.
Immune cells were freshly isolated from HCC tumour, adjacent
non-tumour tissues as well as peripheral blood mononuclear
cells (PBMCs) from seven patients with HCC and were analysed
using flow cytometry. Patient consent was obtained from each
case with institutional review board (IRB) approval.
Immunohistochemistry and immunofluorescence
IHC and IF staining were performed on FFPE tissue samples as
described previously.11 The antibodies used are listed in online
2
supplementary table S2. IF images were captured using
Olympus FluoView FV1000 confocal microscope with 40 ,6-diamidino-2-phenylindole (DAPI) as the nuclear marker. IHC
images were obtained with an Olympus DP20 camera attached
to a CX31 microscope. Multiplex tissue fluorescence staining
was performed with Opal staining system and images were
acquired using Mantra platform (Perkin Elmer).12–14
Quantification of positively stained cells was performed using
ImagePro Software and verified with manual counting from 5 to
10 random fields at 100×magnification. The mean number
from all fields from each patient sample was taken and the
density of cell of interest (number/mm2) was calculated based
on the area of each tumour field at 100×magnification measured as 1.27 mm2. The definitions of peritumour, intratumoral
and non-tumour at the tumour margin are illustrated in online
supplementary figure S1.
Gene expression analysis
Quantitative PCR (qPCR) assay was performed on a total of 81
mRNA samples as described previously.11 Briefly, primers were
designed using Primer3 and qPCR assay was performed using
iTaq SYBR Green Supermix with ROX (Bio-Rad Laboratories).
Relative RNA expression of CD19, CD8A and IFNG was calculated by normalisation to the housekeeping gene beta-actin
(ACTB) using MxPro Software (Stratagene). The primers used
were as follows: CD19 primers: FW0 TCCTTCT
CCAACGCTGAGTC, RV0 GCTCAGGAAGTCCATTGTCC;
CD8A primers: FW0 CCCTTTACTGCAACCACAGG, RV0
GTCTCCCGATTTGACCACAG;
IFNG
primers:
FW0
0
ATGCAGGTCATTCAGATGTAGC, RV TGTCACTCTCCTCT
TTCCAATTC and ACTB primers: FW0 CCAACCGCGA
GAAGATGA, RV0 TAGCACAGCCTGGATAGCAA.
Flow cytometry
PBMCs were isolated using standard ficoll procedure and
tumour dissociation was performed as previously described.15
The immune cells were stained with antibodies as listed in
online supplementary table S2.
Mice
Male wild-type (WT) C57BL/6 mice at 6–7 weeks of age were
used. To induce in vivo B cell depletion, one single dose of
mouse anti-mouse CD20 (clone 5D2, isotype IgG2a, Genentech)
or isotype-matched control mAb (100 μg) was injected in 200 μL
phosphate buffered saline (PBS) through lateral tail veins.16 A
single dose of this depleting antibody ensures the B cell depletion
from Day 7 to as long as 57 days post-injection.16 Sixteen days
after, 3×106 Hepa1–6 hepatoma cell lines were transplanted into
both flanks of the mice. Tumour growth was monitored using calliper on Days 17, 19, 23, 26 and 30 before the mice were sacrificed on Day 31. Tumours and spleens were harvested for
analysis of tumour-infiltrating leucocytes (TILs) using flow cytometry. Antibodies used include CD45, CD3 CD8, CD19, granzyme B (GZB), PD-1 (eBiosciences), CD4, NK1.1, CD69 and
IFN-γ (BioLegend). Animal care and all experimental procedures
were approved by the Institutional Animal Care and Use
Committee from Biological Resource Centre, A*STAR,
Singapore.
Statistical analysis
Kaplan–Meier univariate survival analysis was performed using
classification as ‘low’ or ‘high’ according to the median densities
of cells of interest and p values are reported using log-rank
(Mantel–Cox) test with HR and 95%CI. For correlation
Garnelo M, et al. Gut 2015;0:1–10. doi:10.1136/gutjnl-2015-310814
Downloaded from http://gut.bmj.com/ on August 3, 2017 - Published by group.bmj.com
Hepatology
analyses, p values and correlation coefficients (r) were calculated
using the Pearson’s correlation test. Both tests were performed
using GraphPad Prism V.6.03 (GraphPad Software).
Multivariate analysis by Cox proportional hazards model was
used to examine the predictive value of densities of tumourinfiltrating CD3+ T cells and CD20+ B cells in the context of
other clinical variables. The variables were chosen with a stepwise approach to calculate Akaike’s information criteria (AIC),
starting from a full model comprising CD3, CD20, grade, stage,
age and pairwise interactions. At each iteration step, variables
were removed or added to the current model and AIC were
calculated for the new models until the model being tested
showed a lower AIC. The final model we reached is as follows:
coxph (formula=Surv(survival, death)∼CD3+CD20+grade+as.
factor(stage)+age+CD3:CD20+CD3:grade+CD20:age+grade:
age+as.factor(stage):age). Stage is considered as a factor where
stage I is used as the baseline.
RESULTS
The density of tumour-infiltrating B cells correlates with
that of the tumour-infiltrating T cells
Given the controversial role of B cells in tumour progression,
especially in HCC, we investigated whether tumour-infiltrating
B cells (TIBs) could play a role in HCC progression. First, we
performed IF staining for CD20+ B cells together with CD3+ T
cells in tumour tissue samples from patients with HCC. We
observed that CD20+ B cells are in close proximity to CD3+ T
cells forming either a small cluster (figure 1A) or, less frequently
(one-third of the cases), a tertiary lymphoid-like structure with
T cells and B cells organised in a feature resembling a germinal
Figure 1 Tumour-infiltrating T and B cells are in close contact and their densities are correlated with each other within the hepatocellular
carcinoma (HCC) microenvironment. Representative immunofluorescence images on CD20 (red), CD3 (green) and nuclear staining with DAPI (blue)
showing (A) a small aggregate and (B) a tertiary lymphoid structure formed with T and B cells in HCC. 400× magnification. Bar=30 μm. (C)
Representative images from multiplex tissue fluorescence staining using Opal (Perkin Elmer) showing DAPI (blue), CD20 (magenta), CD8 (green) and
CD68 (yellow). 200× magnification. Bar=50 μm. (D) The density of tumour-infiltrating B cells (number of cells/mm2) is correlated with
tumour-infiltrating CD3+ (n=103) and CD8+ (n=70) T cells. (E) Relative RNA expression of CD19 (B cell marker) and CD8A (CD8+ T cell marker)
normalised to the housekeeping gene ACTB is correlated with each other (n=81). Graphs show p value against Pearson correlation coefficients r.
****p<0.0001.
Garnelo M, et al. Gut 2015;0:1–10. doi:10.1136/gutjnl-2015-310814
3
Downloaded from http://gut.bmj.com/ on August 3, 2017 - Published by group.bmj.com
Hepatology
centre (figure 1B). In almost all cases, T cells and B cells are in
close proximity or even in contact with one another. Notably,
such structures appear within the tumour bed, as well as at the
infiltrating margin of tumours. About 70% of the bigger clusters
resembling tertiary lymphoid structures appear at the infiltrating
margin of tumours, which are also considered as the intratumoral regions. A typical example showing strong B cell infiltration at the invasive margin and in the tumour bed is given in
online supplementary figure S1. Importantly, such interaction is
specific to T cells where multiplex tissue staining with Opal
(Perkin Elmer) showed that CD20+ B cells form a cluster with
CD8+ T cells while not with the CD68+ macrophages which
are abundant in HCC tissues (figure 1C). Further IHC staining
and quantification for CD20 and CD3 on tumour tissues from a
total of 112 patients with HCC from Singapore, Hong Kong
and Zurich demonstrated that, indeed, the density of CD20+ B
cells closely correlates with the densities of both CD3+ and
CD8+ T cells (see figure 1D and online supplementary
figure S2A). A weak correlation was also observed between the
densities of CD20+ B cells and CD56+ NK cells, but not with
CD68+ macrophages (see online supplementary figure S2B). To
further confirm these IHC data, we performed qPCR on RNA
samples from a total of 81 patients with HCC and observed a
striking correlation between CD19 (another marker for B cells)
and CD8A gene expression in these tumour samples (figure 1E).
Taken together, IHC and transcriptome analysis confirm that
the density of TIBs correlates with T cell infiltration to HCC.
The density of TIBs correlates with T cell and NK cell
activation and decreased tumour cell viability
We further investigated whether the intratumoral density of TIBs
is associated with any particular phenotypes of TILs or tumour
cells in microenvironment of HCC. First, we found that the
density of TIBs correlates with the intratumoral density of GZB,
an activation marker for both T cells and NK cells by IHC staining (figure 2A). Additionally, qPCR was performed on RNA
samples from 75 patients with HCC and the correlation between
CD19 and IFNG (another activation marker for T and NK cells)
expression was also observed (figure 2B). Further double IHC
staining on tissues and flow cytometry analysis on freshly isolated
TILs demonstrated that T and NK cells are the major sources of
GZB and IFN-γ (see online supplementary figure S3A, B).
Figure 2 The density of
tumour-infiltrating B cells (TIBs) is
correlated with an enhanced T and NK
cell activation and reduced tumour cell
viability. (A) The density of CD20+ TIBs
is correlated with the density of total
granzyme B (GZB)+ tumour-infiltrating
leucocytes (n=50). (B) RNA expression
of CD19 correlates with IFNG,
activation marker for T and NK cells
(n=75). (C) Graphs showing correlation
of densities of CD20+ TIBs with
CD56+GZB+ cells (left) and CD8+GZB+
cells (right). (D) The density of CD20+
TIBs negatively correlated with
Caspase-3+ tumour cells (n=54) and
positively with Ki-67+ tumour cells
(n=40). Graphs show p value against
Pearson correlation coefficients r.
*p<0.05; **p<0.01; ****p<0.0001.
4
Garnelo M, et al. Gut 2015;0:1–10. doi:10.1136/gutjnl-2015-310814
Downloaded from http://gut.bmj.com/ on August 3, 2017 - Published by group.bmj.com
Hepatology
Table 2
Multivariate survival analysis by Cox regression model
Variables
HR (95% CI)
p Value
CD3+ T cell density
CD20+ B cell density
Grade
as.factor (stage) II
as.factor (stage) III
as.factor (stage) IV
Age
CD3:CD20
CD3:grade
CD20:age
Grade:age
as.factor (stage) II:age
as.factor (stage) III:age
as.factor (stage) IV:age
1.0086
1.0799
924
25.3168
0.1002
1411
1.2322
0.9999
0.9946
0.9987
0.9238
0.9810
1.0790
0.9498
0.0213*
0.0424*
2.30e−06***
0.2511ns
0.3611ns
0.0198*
6.80e−04***
0.1795ns
0.0022**
0.0256*
0.0005***
0.6643ns
0.0571ns
0.2892ns
(1.0010 to 1.0160)
(1.0030 to 1.1630)
(54.42 to 15 700)
(0.1016 to 6308)
(7.192e−04 to 13.97)
(3.160 to 6.302e+05)
(1.092 to 1.390)
(0.9999 to 1.000)
(0.9912 to 0.9981)
(0.9975 to 0.9998)
(0.8837 to 0.9658)
(0.8997 to 1.0700)
(0.9977 to 1.1670)
(0.8636 to 1.0450)
*p<0.05 **p<0.01 ***p<0.001 ****p<0.0001.
Figure 3 Densities of tumour-infiltrating T and B cells are associated
with superior hepatocellular carcinoma (HCC) patient survival. (A)
Representative immunohistochemistry images showing higher densities
of CD20+ B and CD3+ T cells (in blue) from long versus short survival
patient. Survival profile is based on either ≥(long) or <(short) median
survival of 4.5 years. Bar=50 μm. (B) Kaplan–Meier (KM) analysis graph
showing densities of CD20+ B (n=112) and CD3+ T (n=103) cells are
associated with favourable HCC patient survival. (C) KM analysis graph
showing the patient survival profile by combining the densities of both
CD20+ B and CD3+ T cells. CD3hiCD20hi (n=39), CD3hiCD20lo (n=12),
CD3loCD20hi (n=13) and CD3loCD20lo (n=38). (D) KM analysis showing
survival profiles of patients with CD3hiCD20hi (n=39) versus
CD3loCD20lo (n=38). lo and hi indicate ≥(low) or <(high) median
densities of CD20+ B cells (16 cells/ mm2 of tumour area) and CD3+
T cells (95/mm2 of tumour area). Graphs show p=log-rank test p value.
***p<0.001; ****p<0.0001.
Table 1
survival
Indeed, the density of TIBs correlated with the densities of
CD8+ T cells and CD56+ NK cells that express GZB (figure 2C).
Meanwhile, we also detected GZB expression by CD68+ macrophages in multiplex tissue fluorescence staining by Opal system
(see online supplementary figure 3C). As both GZB and IFN-γ
represent activation markers for cytotoxic T and NK cells, the
density of TIBs is correlated with the activation of both CD8+ T
and CD56+ NK cells intratumorally and hence possibly leads to
an enhanced local antitumour immune response. To demonstrate
that TIBs are indeed correlated with an enhanced antitumour
immune response, we analysed the density of TIBs in the context
of the tumour viability markers. We observed that the density of
TIBs correlates with the density of apoptotic tumour cells measured as activated caspase-3-positive tumour cells (see figure 2D
and online supplementary figure S4). Conversely, the density of
TIBs negatively correlates with the density of proliferating
tumour cells as identified by their expression of Ki-67 (figure 2D
and online supplementary figure S4).
The densities of tumour-infiltrating T cells and B cells are
associated with superior HCC patient survival
We previously demonstrated that the densities of tumourinfiltrating CD8+ T cells and CD56+ NK cells are associated with
Univariate analysis of various clinical parameters and densities of intratumoral CD20+ B cells and CD3+ T cells as predictors of patient
Variables
Number (%)
Median (range)
HR (95% CI)
p Value
Grade (1+2/3+4)
TNM stage (I+II/III+IV)
Tumour size, cm (<median/≥median)
AFP (ng/mL) (<median/≥median)
Age (<median/≥median)
Viral status (non-infected/HepB+C)
Race (others/Chinese)
Gender (female/male)
CD20+ B cell density (<median/≥median)
CD3+ T cell density (<median/≥median)
82/21 (80/20)
64/45 (59/41)
NA
NA
NA
37/72 (34/66)
26/83 (24/76)
21/89 (19/81)
NA
NA
NA
NA
5 (0.7–27)
52 (1–>70 700)
58 (20–84)
NA
NA
NA
16 (0.3–199)
95 (5–840)
0.4 (0.1 to 0.7)
0.4 (0.2 to 0.7)
0.6 (0.3 to 1.0)
0.8 (0.5 to 1.4)
0.5 (0.3 to 0.8)
1.1 (0.6 to 2.0)
1.3 (0.6 to 2.6)
0.7 (0.3 to 1.4)
3.1 (1.9 to 6.0)
2.9 (1.7 to 5.5)
0.0055**
0.0020**
0.0702ns
0.4092ns
0.0106*
0.8163ns
0.4985ns
0.2903ns
<0.0001****
<0.0001****
*p<0.05 **p<0.01 ***p<0.001 ****p<0.0001.
AFP, alpha-fetoprotein; TNM, tumour, node, metastases.
Garnelo M, et al. Gut 2015;0:1–10. doi:10.1136/gutjnl-2015-310814
5
Downloaded from http://gut.bmj.com/ on August 3, 2017 - Published by group.bmj.com
Hepatology
longer HCC patient survival.11 Given the above observation, we
investigated the association between the densities of intratumoral
CD20+ B cells and CD3+ T cells and HCC patient survival. IHC
staining and quantification for CD20 and CD3 were performed
as described above. The densities of both intratumoral CD20+ B
cells and CD3+ T cells were associated with superior HCC
patient survival (figure 3A, B and table 1). Since CD20+ B cells
are located in close proximity to T cells, we then investigated
their influence on patient survival when their densities are taken
into consideration together (figure 3C). We observed that
patients with high intratumoral densities of both CD20+ B cells
and CD3+ T cells had longer survival compared with those with
low densities of both subsets (figure 3D vs figure 3B; HR=4.8 vs
3.1 and 2.9 for either CD20+ B cells or CD3+ T cells, respectively). The densities of intratumoral CD3+ T cells and CD20+ B
cells (TIBs) were both independent predictors of HCC patient
survival as shown in the multivariate Cox regression analysis
together with grade, stage and age (table 2). The interaction
between CD3 and grade was significantly associated with survival, suggesting that the relationship between CD3 and survival
varied between different grades. The interaction between CD20
and age is also significant, which suggests the relationship
between CD20 and survival varied at different age (table 2). For
instance, the effect of CD3 on survival is more profound in the
group of patients with advanced grades (3 or 4 vs 1 or 2), while
the effect of CD20 on survival is more profound in the group of
patients with advanced age of more than 58 years old.
Costimulatory molecules CD27 and CD40 expressed on both
T cells and B cells correlate with patient survival
Based on the above observations, T and B cell proximity potentially reflects functional interaction. The interaction between
Figure 4 CD27 and CD40 costimulatory molecules are associated with superior hepatocellular carcinoma (HCC) patient survival. (A) Kaplan–Meier
(KM) analysis graph showing the density of CD27+ tumour-infiltrating leucocytes (TILs) is associated with superior HCC patient survival. n=80.
(B) Representative immunohistochemistry images showing CD27 (red) with CD3 (blue) and CD20 (blue) at 200× magnification. Bar=30 μm.
(C) Representative immunofluorescence (IF) images at 800× magnification showing DAPI (blue), CD20 (red), CD3 (green), CD27 (white) and merged
image on the far right. Bar=20 μm. (D) KM analysis graphs showing that densities of CD27+CD3+ (left, n=28) and CD27+CD20+ (right, n=39) are
associated with superior patient survival. (E) KM analysis graph showing that the density of CD40+ TILs is associated with superior HCC patient
survival (n=54). (F) Representative IF images at 800× magnification showing DAPI (blue), S100 (red), CD20 (green), CD40 (white) and merged
image on the far right. Bar=20 μm. Graphs show p=log-rank test p value. *p<0.05; **p<0.01.
6
Garnelo M, et al. Gut 2015;0:1–10. doi:10.1136/gutjnl-2015-310814
Downloaded from http://gut.bmj.com/ on August 3, 2017 - Published by group.bmj.com
Hepatology
T cells and B cells could result in bidirectional T cell and B cell
activation. Costimulatory molecules indicative of B cell activation such as CD27 could be an important indicator for such
interaction/activation state.17 Indeed, the expression of CD27
on TILs within HCC determined by IHC analysis is positively
associated with overall patient survival (figure 4A). Closer examination of CD27+ cells showed that both T cells and B cells can
express CD27 in HCC (figure 4B, C). On average, 48% of total
CD20+ B cells (range, 1–90%) and 64% of total CD3+ T cells
(range, 4–98%) express CD27. It was previously shown that
CD27 is expressed on most T cells, including naive T cells, but it
is only upregulated on activated B cells.18 This indicates that
close to half of the TIBs are activated (CD27+). The majority of
CD27+ population consists of CD3+ T cells (average of 59%;
range, 13–88%), while CD20+ B cells make up 12% (range,
2–42%) of the total CD27+ population. Importantly, the frequency of either CD3+ T cells or CD20+ B cells that express
CD27 is positively associated with superior patient survival
(figure 4D).
The above results suggest that the interaction between B
and T cells is an important event leading to their activation
and hence tumour control. To test this, we probed for
another important costimulatory molecule, CD40, which is
necessary for productive interactions between T and B cells.8
The ligation between CD40 on antigen-presenting cells such
as B cells and dendritic cells and CD40 ligand expressed on T
cells is known to trigger T cell activation.19 The density of
CD40+ TILs was indeed associated with better HCC patient
survival (figure 4E). We observed that CD40 is expressed on
average in 54% (range, 11–99%) of the total CD20+ B cells
within the HCC microenvironment. On the other hand, 54%
(range, 22–81%) of CD40+ cells are CD20− B cells, with
other CD40-expressing cells including S100+ dendritic cells
(figure 4F).
Expression of CD38 on TILs correlates with longer patient
survival
Next, we probed for the expression of CD38 on TILs in HCC.
CD38 is expressed on activated B cells such as germinal centre
B cells, memory B cells, plasmablasts or plasma cells.20 It is
also expressed on other immune cells such as T and NK cells
22
upon
activation21
or
monocytes.23
Interestingly,
CD27+CD38+CD138+ plasma cells were observed within
HCC tumours and in most cases near the margin of the
tumours (figure 5A). The CD38+CD138+ plasma cells are a
rare population within the tumour with only about 9 cells/mm2
compared with 40 cells/mm2 of CD20+ B cells. Most of the
CD38+ cells are, however, CD20− (on average, only 0.8%
(range, 0–5%) of the entire CD38+ population is
CD38+CD20+) and CD27+ (on average, 58% (range, 30–99%)
of total CD38+ cells coexpress CD27). This indicates that half
of the CD38+ TILs could potentially be activated T cells, NK
cells, monocytes or plasma cells which lack CD20 expression.
Indeed, flow cytometry analysis on freshly isolated TILs from
tumour samples taken from patients with HCC showed that
majority of the CD38+ TILs are either CD3+ T cells (average
37%) or CD14+ monocytes (average 29%) (figure 5B). Plasma
cells detectable as CD38+CD138+CD27+CD19− (average 5%
Figure 5 CD38+ tumour-infiltrating leucocytes (TILs) are associated with superior hepatocellular carcinoma (HCC) patient survival.
(A) Representative immunofluorescence images at 800× magnification showing DAPI (blue), CD138 (red), CD27 (green), CD38 (white) and merged
image on the far right. Bar=20 μm. (B) Population of CD38+ TILs isolated from freshly resected HCC specimens (n=7), each dot represents one
tumour. Definitions: T cells (CD3+), B cells (CD19+CD24−), regulatory B cells (Bregs) (CD24+CD19+), plasma cells (CD138+), NK (CD56+), NKT
(CD3+CD56+) and monocytes (CD14+). Graph shows mean and SD. Right, pie chart showing representative distribution of CD38+ TILs based on the
average percentage from seven HCC tumours. (C) Kaplan–Meier analysis graph showing that CD38+ TILs are associated with superior HCC patient
survival (n=59). Graphs show p=log-rank test p value. ***p<0.001. NKT, natural killer T cells.
Garnelo M, et al. Gut 2015;0:1–10. doi:10.1136/gutjnl-2015-310814
7
Downloaded from http://gut.bmj.com/ on August 3, 2017 - Published by group.bmj.com
Hepatology
of total CD38+ TILs) and Bregs as defined by
CD38+CD24+CD19+ (average 4% of total CD38+ TILs) are
both rare events in TILs (figure 5B). As plasma cells produce
large quantities of antibodies, we also probed for human IgG
expression in HCC tissues. Indeed, antibodies were shown to be
bound to HCC tumour cells and costained with plasma cell
marker CD138 (see online supplementary figure S5A, B).
Importantly, the density of CD38+ TILs is associated with
better HCC patient survival (figure 5C). Again, this indicates
the activated immune microenvironment of HCC plays a critical
role in superior HCC patient survival.
Depletion of CD20+ mature B cells resulted in reduced
tumour control and decreased local T cell activation
Next, to further strengthen our claim on the important role of
TIBs in HCC, we depleted the mature B cells from WT C57BL/
6 mice using anti-mouse CD20 mAb or with isotype-matched
mAb (Genentech) as control according to previous report.16
These mice were then transplanted with murine hepatoma cell
lines Hepa1–6 on Day 16 after B cell depletion and tumour
growth was monitored for another 15 days until Day 31. First of
all, we established that B cells were successfully depleted from
these mice even on Day 31 (figure 6A). Tumour growth was
Figure 6 CD20+ B cell depletion
reduced tumour control and decreased
T cell activation. Wild-type (WT)
C57BL/6 mice were transplanted with
Hepa1–6 cells and tumour growth was
monitored. (A) Successful B cell
depletion showing less than 0.3% of B
cells present in the spleens of the mice
at Day 31 after injection with
anti-mouse CD20 mAb compared with
more than 30% of B cells in those
injected with isotype control mouse
IgG2a antibody. (B) Tumour growth
was enhanced in B cell-depleted mice
compared with control mice. n=4–8
tumours in each group. (C) Left,
representative images showing larger
tumours harvested from B cell-depleted
mice versus control mice on Day 31.
Right, graph showing bigger tumours
by weight (g) harvested from B
cell-depleted mice versus control mice.
Percentage (%) of (D) IFN-γ and
granzyme B (GZB). (E) CD69 and (F)
PD-1 on CD4+ T, CD8+ T and NK1.1+
NK cells isolated from tumours harvest
from B cell-depleted mice versus
control mice. All graphs show *p<0.05
from unpaired Student’s t test except
(B) p<0.0001 from one-way ANOVA
test.
8
Garnelo M, et al. Gut 2015;0:1–10. doi:10.1136/gutjnl-2015-310814
Downloaded from http://gut.bmj.com/ on August 3, 2017 - Published by group.bmj.com
Hepatology
significantly enhanced in mice depleted of B cells (figure 6B)
resulting in larger tumour size at harvest on Day 31 (figure 6C).
We observed no significant difference in tumour-infiltrating
CD3+ T cells, but a corresponding reduction of CD20+ B cells
in tumours from control undepleted mice versus CD20-depleted
mice (data not shown). To support our above hypothesis that
TIBs play an important role in local T cell activation, we then
examined the T cell activation status from TILs. Indeed, CD4+
T cell activation was reduced with B cell depletion shown by the
reduced expression of IFN-γ, GZB (figure 6D) and CD69, an
early activation marker (figure 6E). Notably, we do not observe
a significant difference in CD8+ T cell activation in this current
model. However, the expression of PD-1, an inhibitory receptor
marker, was enhanced on CD8+ TILs upon B cell depletion
(figure 6F). This indicates that the activation of CD8+ T cells
was also influenced by CD20+ B cells. In conclusion, we demonstrated TIBs play an important role in tumour control via T cell
activation.
DISCUSSION
We demonstrated that densities of both T and B cells are associated with HCC patient survival, and that they are in close
proximity and seemingly at cell-to-cell contact with one
another, most likely an indication of a functional interaction
between them. To support this hypothesis, we found that the
density of TIBs correlates with the number and activation status
of both T and NK cells and coincides with reduced tumour cell
viability. Using a mouse model transplanted with murine hepatoma cells, we demonstrated that the depletion of B cells
resulted in an enhanced tumour growth and reduced local T cell
activation. We conclude that the interaction between B and T
cells is an important event leading to their activation and hence
contributing to better tumour control in HCC.
Our current study partially contradicts an earlier report
showing that circulating Bregs defined as CD19+CD24hiCD38hi
population promoted HCC progression via the CD40/CD40L
signalling pathway.6 Instead, we found that Breg cells represent
a minor population in TILs counting for less than 5% of the
CD38+ TILs in fresh tumour samples. It may also be difficult to
directly compare our study, based on TIBs, with Shao’s report
on circulating Bregs. Rather, our findings support and extend
several other studies consistent with antitumour activity of intratumoral B cells.5 24 25 For instance, Schneider et al5 reported
that adaptive immunity, in particular T and B cells, is critical for
the suppression of HCC progression. On the other hand,
Nielson et al described CD20+ TIBs with an atypical CD27−
memory phenotype to be correlated with better prognosis in
ovarian cancer.25 Both studies highlighted the importance of T
and B cell interaction in triggering functional adaptive immune
response.
The role of costimulatory molecules CD27/CD70 in tumour
control has been widely reported.26–28 Previous studies showed
that CD27 is expressed on most T cells, including naive T cells,
and its expression is increased upon T cell activation, but downregulated as T cells differentiate towards effector phenotypes.29
However, it has also been shown that in secondary lymphoid
organs, CD27 expression is retained on central memory T cells.30
Its expression on B cells, on the other hand, is usually detected
on activated18 and memory B cells.31 32 CD27 was reported to
play an important role in T cell expansion and survival as well as
in B cell activation and antibodies production.26 The expression
of CD27 on intratumoral B cells could therefore be indicative of
their activation and active local immune response within the
tumour microenvironment. It was previously shown that the
Garnelo M, et al. Gut 2015;0:1–10. doi:10.1136/gutjnl-2015-310814
population of CD19+CD27+ B cells was decreased in HCC.33
This could indicate a negative feedback mechanism during
tumour progression. In the current study, we demonstrated that
both CD27+ T cells and CD27+ B cells are present in the tumour
of patients with HCC and that their densities are associated with
longer patient survival. Furthermore, we demonstrated the presence of CD27+CD38+CD138+ plasma cells in the tumour
microenvironment. CD38+ TILs, which could be activated T and
NK cells,21 22 germinal centre B cells, memory B cells, plasmablasts, plasma cells34 or monocytes,23 were also shown to be associated with better patient survival.
This study also showed a correlation of CD40+ cells with
better HCC patient survival. CD40 is an important costimulatory molecule expressed on B cells that upon ligation with
CD40 ligand leads to activation of both T and B cells.35 CD40
agonists have been tested as cancer immunotherapies in recent
years.36 It was previously reported that CD40 ligand-activated B
cells transfected with tumour total RNA isolated from HCC
cells were able to induce cytotoxic T cell response ex vivo.26
The current study is the most comprehensive study of costimulatory molecules in HCC, since it involves analysis of the largest
number of HCC cases and largest number of costimulatory
molecules indicative of T and B cell interaction thus far.
In the mouse model transplanted with Hepa1–6 cells, we
clearly demonstrated the role of TIBs in tumour control
whereby their depletion leads to an enhanced tumour growth
and reduced local T cell activation. The effect on T cell activation was mainly observed on CD4+ T cells where the expression
of IFN-γ, GZB and CD69 was significantly decreased. On
CD8+ T cells, however, PD-1 was significantly increased when B
cells were depleted in these mice. In this particular case, we
refer to PD-1 marker as inhibitory receptor rather than an
exhaustion marker since the expression of IFN-γ and GZB from
CD8+ T cells was not significantly reduced in B cell-depleted
animals.37 This is somehow in contrast to our observation in
human HCCs showing that B and T cell interaction leads to
CD8+ T cell activation marked by the expression of IFN-γ and
GZB. We believe that this difference is due to the chronic effect
of B cells, which interact first with CD4+ T cells leading to the
enhanced local immune response and eventually to the activation of CD8+ T cells.38–40 This explanation is consistent with
the fact that animal studies were performed within 15 days after
tumour transplantation, while the human HCC samples were
examined years after the tumours were established.
In conclusion, this study provides comprehensive data from
patients with HCC, indicating a critical role of T and B cell
interaction in cancer progression. Our findings warrant further
investigations for the design of future immunotherapies leading
to local immune response and improved patient survival.
Author affiliations
1
Singapore Immunology Network (SIgN), Agency for Science, Technology and
Research (A*STAR), Biopolis, Singapore
2
Institute of Molecular and Cell Biology (IMCB), A*STAR, Biopolis, Singapore
3
Department of Pathology, Singapore General Hospital, Singapore, Singapore
4
SingHealth Translational Immunology and Inflammation Centre (STIIC), Singapore
Health Services Pte Ltd, Singapore, Singapore
5
Institute of Surgical Pathology, University Hospital of Zurich, Zurich, Switzerland
6
National Cancer Centre, Singapore, Singapore
7
Singapore General Hospital, Singapore, Singapore
8
Division of Chronic Inflammation and Cancer, German Cancer Research Center
(DKFZ), Heidelberg, Germany
9
Institute of Virology, Technical University München/Helmholtz Zentrum München,
Germany
10
Department of Pathology, The University of Hong Kong, Queen Mary Hospital,
Hong Kong, Hong Kong
9
Downloaded from http://gut.bmj.com/ on August 3, 2017 - Published by group.bmj.com
Hepatology
11
State Key Laboratory for Liver Research, The University of Hong Kong, Hong Kong,
Hong Kong
12
Institut de Recherches Internationales Servier, Suresnes, France
13
Duke-NUS Graduate Medical School, Singapore, Singapore
Acknowledgements We wish to thank Dr Chai Ling Pang for her help in IHC
staining. We thank Sarah Novack from Servier, France, for manuscript editing. We
also thank Genentech for their kind gift of the anti-mouse CD20 mAb (clone 5D2)
and the isotype-matched control IgG2a mAb as well as Dr Lakshmi Ramakrishna
and Professor Salvatore Albani for preparing the Material Transfer Agreement. This
work was mainly supported by the Biomedical Research Council of A*STAR (Agency
for Science, Technology and Research), Singapore, and Ministry of Health Industrial
Alignment Fund (MOH IAF) Category 2 grant. Dr Mathias Heikenwalder’s
contribution was supported by an European Research Council (ERC) starting grant
(Liver Cancer Mechanisms), the Stiftung für Experimentelle Biomedizin (Hans-Peter
Hofschenider Stiftung), the Helmholtz Alliance Pre-clinical Cancer Center (PCCC), the
SFB TR 36 and the Helmoltz-Zentrum.
Contributors MG, AT: performed most of the IHC stainings and quantifications.
ZH: performed the animal work for figure 6. JY: performed the Opal staining. CJL:
assisted in animal work and Opal staining. JC: biostatistician, performed univariate
and multivariate analyses. KHL: pathologist, Singapore. AW: pathologist, Zurich. PC,
AC, LLPJO: surgeons providing fresh HCC samples. HCT, MH, IOLN: oncologists from
Singapore, Zurich and Hong Kong, respectively, involved in patient recruitment and
sample collections. AN, J-PA: supervising the project. QC: supervisor for animal
work. VC: main supervisor for the entire project.
Funding National Medical Research Council (NMRC), Singapore, Ministry of Health
(MOH), Industry Alignment Fund, Biomedical Research Council (BMRC), Singapore.
12
13
14
15
16
17
18
19
20
21
22
23
Competing interests None declared.
Patient consent Obtained.
24
Ethics approval Centralised Institutional Review Board (CIRB), SingHealth.
25
Provenance and peer review Not commissioned; externally peer reviewed.
Open Access This is an Open Access article distributed in accordance with the
Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which
permits others to distribute, remix, adapt, build upon this work non-commercially,
and license their derivative works on different terms, provided the original work is
properly cited and the use is non-commercial. See: http://creativecommons.org/
licenses/by-nc/4.0/
28
REFERENCES
29
1
2
3
4
5
6
7
8
9
10
11
10
Ferlay J, Soerjomataram I, Dikshit R, et al. Cancer incidence and mortality
worldwide: sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer
2015;136:E359–86.
Nikolaou K, Sarris M, Talianidis I. Molecular pathways: the complex roles of
inflammation pathways in the development and treatment of liver cancer. Clin
Cancer Res 2013;19:2810–16.
Pagès F, Galon J, Dieu-Nosjean MC, et al. Immune infiltration in human tumors:
a prognostic factor that should not be ignored. Oncogene 2010;29:1093–102.
Jochems C, Schlom J. Tumor-infiltrating immune cells and prognosis: the potential
link between conventional cancer therapy and immunity. Exp Biol Med (Maywood)
2011;236:567–79.
Schneider C, Teufel A, Yevsa T, et al. Adaptive immunity suppresses formation and
progression of diethylnitrosamine-induced liver cancer. Gut 2012;61:1733–43.
Balkwill F, Montfort A, Capasso M. B regulatory cells in cancer. Trends Immunol
2013;34:169–73.
Shao Y, Lo CM, Ling CC, et al. Regulatory B cells accelerate hepatocellular carcinoma
progression via CD40/CD154 signaling pathway. Cancer Lett 2014;355:264–72.
Driessens G, Kline J, Gajewski TF. Costimulatory and coinhibitory receptors in
anti-tumor immunity. Immunol Rev 2009;229:126–44.
Peggs KS, Quezada SA, Allison JP. Cancer immunotherapy: co-stimulatory agonists
and co-inhibitory antagonists. Clin Exp Immunol 2009;157:9–19.
Pauken KE, Wherry EJ. TIGIT and CD226: tipping the balance between
costimulatory and coinhibitory molecules to augment the cancer immunotherapy
toolkit. Cancer Cell 2014;26:785–7.
Chew V, Chen J, Lee D, et al. Chemokine-driven lymphocyte infiltration: an early
intratumoural event determining long-term survival in resectable hepatocellular
carcinoma. Gut 2012;61:427–38.
26
27
30
31
32
33
34
35
36
37
38
39
40
Abel EJ, Bauman TM, Weiker M, et al. Analysis and validation of tissue biomarkers
for renal cell carcinoma using automated high-throughput evaluation of protein
expression. Hum Pathol 2014;45:1092–9.
Stack EC, Wang C, Roman KA, et al. Multiplexed immunohistochemistry, imaging,
and quantitation: a review, with an assessment of Tyramide signal amplification,
multispectral imaging and multiplex analysis. Methods 2014;70:46–58.
Lovisa S, LeBleu VS, Tampe B, et al. Epithelial-to-mesenchymal transition induces cell
cycle arrest and parenchymal damage in renal fibrosis. Nat Med 2015;21:998–1009.
Chew V, Tow C, Teo M, et al. Inflammatory tumour microenvironment is associated
with superior survival in hepatocellular carcinoma patients. J Hepatol
2010;52:370–9.
Montalvao F, Garcia Z, Celli S, et al. The mechanism of anti-CD20-mediated B cell
depletion revealed by intravital imaging. J Clin Invest 2013;123:5098–103.
Kobata T, Jacquot S, Kozlowski S, et al. CD27-CD70 interactions regulate B-cell
activation by T cells. Proc Natl Acad Sci USA 1995;92:11249–53.
Borst J, Hendriks J, Xiao Y. CD27 and CD70 in T cell and B cell activation. Curr
Opin Immunol 2005;17:275–81.
Hernandez MG, Shen L, Rock KL. CD40-CD40 ligand interaction between dendritic
cells and CD8+ T cells is needed to stimulate maximal T cell responses in the
absence of CD4+ T cell help. J Immunol 2007;178:2844–52.
Kaminski DA, Wei C, Qian Y, et al. Advances in human B cell phenotypic profiling.
Front Immunol 2012;3:302.
Mallone R, Funaro A, Zubiaur M, et al. Signaling through CD38 induces NK cell
activation. Int Immunol 2001;13:397–409.
Sandoval-Montes C, Santos-Argumedo L. CD38 is expressed selectively during the
activation of a subset of mature T cells with reduced proliferation but improved
potential to produce cytokines. J Leukoc Biol 2005;77:513–21.
Musso T, Deaglio S, Franco L, et al. CD38 expression and functional activities are
up-regulated by IFN-gamma on human monocytes and monocytic cell lines.
J Leukoc Biol 2001;69:605–12.
Nelson BH. CD20+ B cells: the other tumor-infiltrating lymphocytes. J Immunol
2010;185:4977–82.
Nielsen JS, Sahota RA, Milne K, et al. CD20+ tumor-infiltrating lymphocytes have
an atypical CD27- memory phenotype and together with CD8+ T cells promote
favorable prognosis in ovarian cancer. Clin Cancer Res 2012;18:3281–92.
Denoeud J, Moser M. Role of CD27/CD70 pathway of activation in immunity and
tolerance. J Leukoc Biol 2011;89:195–203.
He L-Z, Prostak N, Thomas LJ, et al. Agonist anti-human CD27 monoclonal
antibody induces T cell activation and tumor immunity in human CD27-transgenic
mice. J Immunol 2013;191:4174–83.
Roberts DJ, Franklin NA, Kingeter LM, et al. Control of established melanoma by
CD27 stimulation is associated with enhanced effector function and persistence,
and reduced PD-1 expression of tumor infiltrating CD8(+) T cells. J Immunother
2010;33:769–79.
Nolte MA, van Olffen RW, van Gisbergen KP, et al. Timing and tuning of
CD27-CD70 interactions: the impact of signal strength in setting the balance
between adaptive responses and immunopathology. Immunol Rev
2009;229:216–31.
Wherry EJ, Teichgräber V, Becker TC, et al. Lineage relationship and protective
immunity of memory CD8T cell subsets. Nat Immunol 2003;4:225–34.
Wei C, Jung J, Sanz I. OMIP-003: phenotypic analysis of human memory B cells.
Cytometry A 2011;79:894–6.
Kurosaki T, Kometani K, Ise W. Memory B cells. Nat Rev Immunol
2015;15:149–59.
Wang XD, Wang L, Ji FJ, et al. Decreased CD27 on B lymphocytes in patients with
primary hepatocellular carcinoma. J Int Med Res 2012;40:307–16.
Pittner BT, Shanafelt TD, Kay NE, et al. CD38 expression levels in chronic
lymphocytic leukemia B cells are associated with activation marker expression and
differential responses to interferon stimulation. Leukemia 2005;19:2264–72.
Grewal IS, Flavell RA. The role of CD40 ligand in costimulation and T-cell activation.
Immunological reviews 1996;153:85–106.
Khong A, Nelson DJ, Nowak AK, et al. The use of agonistic anti-CD40 therapy in
treatments for cancer. Int Rev Immunol 2012;31:246–66.
Fuertes Marraco SA, Neubert NJ, Verdeil G, et al. Inhibitory receptors beyond T cell
exhaustion. Front Immunol 2015;6:310.
Zhang S, Zhang H, Zhao J. The role of CD4T cell help for CD8 CTL activation.
Biochem Biophys Res Commun 2009;384:405–8.
Phares TW, Stohlman SA, Hwang M, et al. CD4T cells promote CD8T cell
immunity at the priming and effector site during viral encephalitis. J Virol 2012;86:
2416–27.
Castiglioni P, Gerloni M, Cortez-Gonzalez X, et al. CD8T cell priming by B
lymphocytes is CD4 help dependent. Eur J Immunol 2005;35:1360–70.
Garnelo M, et al. Gut 2015;0:1–10. doi:10.1136/gutjnl-2015-310814
Downloaded from http://gut.bmj.com/ on August 3, 2017 - Published by group.bmj.com
Interaction between tumour-infiltrating B
cells and T cells controls the progression of
hepatocellular carcinoma
Marta Garnelo, Alex Tan, Zhisheng Her, Joe Yeong, Chun Jye Lim,
Jinmiao Chen, Kiat Hon Lim, Achim Weber, Pierce Chow, Alexander
Chung, London Lucien PJ Ooi, Han Chong Toh, Mathias Heikenwalder,
Irene O L Ng, Alessandra Nardin, Qingfeng Chen, Jean-Pierre Abastado
and Valerie Chew
Gut published online December 15, 2015
Updated information and services can be found at:
http://gut.bmj.com/content/early/2015/12/15/gutjnl-2015-310814
These include:
Supplementary Supplementary material can be found at:
Material http://gut.bmj.com/content/suppl/2015/12/15/gutjnl-2015-310814.DC1
References
This article cites 40 articles, 12 of which you can access for free at:
http://gut.bmj.com/content/early/2015/12/15/gutjnl-2015-310814#BIBL
Open Access
This is an Open Access article distributed in accordance with the Creative
Commons Attribution Non Commercial (CC BY-NC 4.0) license, which
permits others to distribute, remix, adapt, build upon this work
non-commercially, and license their derivative works on different terms,
provided the original work is properly cited and the use is
non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/
Email alerting
service
Receive free email alerts when new articles cite this article. Sign up in the
box at the top right corner of the online article.
Topic
Collections
Articles on similar topics can be found in the following collections
Open access (362)
Hepatic cancer (474)
Notes
To request permissions go to:
http://group.bmj.com/group/rights-licensing/permissions
To order reprints go to:
http://journals.bmj.com/cgi/reprintform
To subscribe to BMJ go to:
http://group.bmj.com/subscribe/