* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Ch 16 homework
Survey
Document related concepts
Zinc finger nuclease wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
DNA sequencing wikipedia , lookup
Eukaryotic DNA replication wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA profiling wikipedia , lookup
DNA nanotechnology wikipedia , lookup
Microsatellite wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA replication wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Transcript
BIO101 Homework DNA replication 1. 2. 3. 4. 5. 6. name ________________ Below is a diagram of DNA replication in E. coli. Which end (5’ or 3’) of the DNA molecule is here? Which enzyme functions here to deal with supercoils in DNA? What enzyme functions here to unwind the DNA? Which enzyme functions to synthesize these small RNA sequences? What are these ~1000 nucleotide long DNA fragments called? Is this strand the leading or lagging strand 2 3 4 5 6 1 7. Refer to the figure above. Explain how this figure represents semiconservative replication. 8. In analyzing the number of different bases in a DNA sample, which 2 results are consistent with basepairing rules? (circle 2) A. A = G C. A=C E. A +T = G + T B. A+G = C + T D. G=T F. A/T = 1 9. What do the letters DNA stand for? _________________________________________ 10. The nucleotide bases are paired by ____ bonds along the axis of the DNA molecule. 11. The DNA “backbone” is composed of _________ and __________ molecules 12. A cell has an adenine content of 17%. What is the % of the nucleotide, cytosine? __________ 13. Write the complementary sequence to following DNA strand: AATTCGCCGGTATTAGACGTT