Download Thioaptamer decoy targeting of AP-1 proteins influences cytokine

Journal of General Virology (2007), 88, 981–990
DOI 10.1099/vir.0.82499-0
Thioaptamer decoy targeting of AP-1 proteins
influences cytokine expression and the outcome of
arenavirus infections
Susan M. Fennewald,1,2 Erin P. Scott,1,24 Lihong Zhang,1,2 Xianbin Yang,3
Judith F. Aronson,1,2 David G. Gorenstein,3 Bruce A. Luxon,3
Robert E. Shope,1,23 David W. C. Beasley,1,2 Alan D. T. Barrett1,2
and Norbert K. Herzog1,2
1
Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0609,
USA
Correspondence
Norbert K. Herzog
2
[email protected]
Center for Biodefense and Emerging Infectious Diseases, Sealy Center for Structural Biology,
University of Texas Medical Branch, Galveston, TX 77555-0609, USA
3
Department of Biochemistry and Molecular Biology, University of Texas Medical Branch,
Galveston, TX 77555-0609, USA
Received 25 August 2006
Accepted 10 November 2006
Viral haemorrhagic fever (VHF) is caused by a number of viruses, including arenaviruses. The
pathogenesis is believed to involve dysregulation of cytokine production. The arenaviruses
Lassa virus and Pichinde virus have a tropism for macrophages and other reticuloendothelial cells
and both appear to suppress the normal macrophage response to virus infection. A decoy
thioaptamer, XBY-S2, was developed and was found to bind to AP-1 transcription factor proteins.
The P388D1 macrophage-like cell line contains members of the AP-1 family which may act as
negative regulators of AP-1-controlled transcription. XBY-S2 was found to bind to Fra-2 and JunB,
and enhance the induction of cytokines IL-6, IL-8 and TNF-a, while reducing the binding to AP-1
promoter elements. Administration of XBY-S2 to Pichinde virus-infected guinea pigs resulted in
a significant reduction in Pichinde virus-induced mortality and enhanced the expression of cytokines
from primary guinea pig macrophages, which may contribute to its ability to increase survival of
Pichinde virus-infected guinea pigs. These data demonstrate a proof of concept that thioaptamers
can be used to modulate the outcome of in vivo viral infections by arenaviruses by the manipulation
of transcription factors involved in the regulation of the immune response.
INTRODUCTION
Members of the family Arenaviridae (genus Arenavirus) are
small RNA viruses that include the prototype Lymphocytic
choriomeningitis virus (LCMV), Pichinde virus (PICV) that is
non-pathogenic for humans, and highly pathogenic viruses
that cause viral haemorrhagic fevers (VHF), including Lassa
fever and Argentine, Venezuelan and Bolivian haemorrhagic
fevers. Although arenaviruses infect macrophages and
dendritic cells, the immune response to arenavirus infections is poorly understood and, as with many of the viruses
causing VHF, it is unclear how these viruses evade the
immune system or cause death with only limited cellular
damage. Our laboratory has been using PICV to study the
effects on the immune response of both lethal and nonlethal arenavirus infection of guinea pigs. Increases in TNF-a
3Dr Robert E. Shope died 19 January 2004 in Galveston.
4Present address: Department of Microbiology, University of Pennsylvania, Philadelphia, PA 19104, USA.
0008-2499 G 2007 SGM
have been associated with fatal PICV infection of guinea pigs
(Aronson et al., 1995), but only in the late stages of infection.
Alternatively, there is evidence that swift elaboration of proinflammatory cytokines and early engagement of the innate
immune response may help protect an infected host from
lethal haemorrhagic fever (Baize et al., 1999; Peters et al.,
1987; Leroy et al., 2000; Fisher-Hoch et al., 1988). We have
been interested in developing strategies to interfere with the
pathogenic sequence, or even boost early protective innate
immune responses.
Members of the AP-1 family of transcription factors are key
regulators of a wide range of cellular processes including cell
proliferation, cell death, cell differentiation, oncogenesis,
inflammation and innate immune responses (Adcock,
1997). While not as strongly associated with the immune
response as the NF-kB family of transcription factors, it is
still involved in the transcriptional regulation of T-cell
receptor alpha (Giese et al., 1995), beta-interferon (IFN-b)
(Du et al., 1993; Merika et al., 1998; Thanos & Maniatis,
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 03 Aug 2017 10:24:16
Printed in Great Britain
981
S. M. Fennewald and others
1995), TNF-a (Falvo et al., 2000; Tsai et al., 2000) and
other genes important to an antiviral immune response
(Chinenov & Kerppola, 2001).
Similar to the NF-kB family, the AP-1 transcription factors
are composed of various dimers which can act as positive or
negative regulators of transcription. The subunits are basic
region–leucine zipper proteins of the Jun, Fos, Maf, ATF and
cAMP response element-binding (CREB) protein subfamilies. The best-studied activator dimers are the Fos/Jun
dimers, which bind to the canonical AP-1 site, and the CREB
dimers, which bind to the similar CRE sites with some level
of cross-binding. The significance of the various dimer
combinations and binding sites are not fully understood at
this time (Shaulian & Karin, 2001, 2002; Karin & Shaulian,
2001; De Cesare et al., 1999). The c-Jun, c-Fos and FosB
proteins contain transactivation domains, while Fra-1, Fra-2
and some splice variants of FosB do not (Chinenov &
Kerppola, 2001) and can act as negative regulators at AP-1binding sites (Suzuki et al., 1991; Sonobe et al., 1995). The
regulation of AP-1 activity is complex and occurs through:
(i) changes in jun and fos transcription and mRNA turnover,
(ii) Fos and Jun protein turnover, (iii) post-translational
modifications of both Fos and Jun proteins that modulate
their activities and (iv) interactions with other transcription
factors.
Transcription factors such as AP-1 and NF-kB can be
targeted for inhibition using RNA and DNA oligonucleotides acting as decoy ‘aptamers’, which bind and act as direct
in vivo inhibitors. Various studies have demonstrated the
potential of using specific decoy oligodeoxynucleotides
(ODNs) as therapeutic or diagnostic reagents, and to dissect
the specific roles of particular transcription factors in
regulating the expression of various genes (Bielinska et al.,
1990; Cho-Chung et al., 1999; Eleouet et al., 1998; Jin &
Howe, 1997; Mann, 1998; Morishita et al., 1995, 1998;
Osborne et al., 1997; Tomita et al., 1999; Park et al., 1999).
Dithiophosphate oligonucleotides (S2-ODNs) and monothiophosphate oligonucleotides (S-ODNs), are taken up
efficiently by cells and have enhanced binding to proteins
(Marshall & Caruthers, 1993; Yang et al., 2002a; King et al.,
2002). We previously developed thiophosphate-backbone
modified aptamers (‘thioaptamers’) targeting NF-kB p50
and RelA p65 (Yang et al., 1999).
Inc. Duplex oligonucleotides were annealed at 1.75 mM in 10 mM
Tris/HCl (pH 7.6), 2 mM MgCl2, 50 mM NaCl, 1 mM EDTA by
heating briefly at 95 uC and allowing them to cool slowly. Oligonucleotides were radiolabelled with T4 polynucleotide kinase
(Promega) and [c-32P]ATP (DuPont NEN) under standard reaction
conditions. Oligonucleotides containing phosphorodithioates (XBYS2, XBY-S1 and XBY-6) were synthesized using phosphorothioamidite
chemistry as previously described (Yang et al., 1999). The thiophosphite triesters were oxidized with the sulfurization reagent
3-ethoxy-1,2,4-dithiazoline-5-one (Xu et al., 1996). After removal of
the dimethoxytrityl group, the crude oligonucleotides were purified
on a Mono Q HR 10/10 FPLC column (Pharmacia) (Yang et al.,
2002b). The purified oligonucleotides were desalted and concentrated by ultrafiltration using Centricon-3 (Amicon) centrifugal concentrators. Equal molar quantities of complementary strands were
mixed, annealed at 90 uC and slowly cooled to form the duplexes.
Antibodies and recombinant proteins. Antibodies specific for
ATF-2 (#9222), phosphorylated ATF-2 (#9221), c-Jun (c-JunB;
#9162), phosphorylated c-Jun (#9261S), CREB (#9192) and phosphorylated CREB (#9191) were purchased from Cell Signaling
Technology. Antibodies specific for c-Fos (210-128), FosB (210114), JunD (210-111) and JunB (210-112) were purchased from
Alexis Biochemicals. Antibodies directed against Fra-1 (SC183X),
Fra-2A (SC171X), Fra-2B (SC13017X), cAMP-responsive element
modulator (CREM), JunB (SC73X), JunD (SC74X) and FosB
(SC703X) were purchased from Santa Cruz Biotechnology. Antibody
against c-Fos (c-FosA) was purchased from BD Biosciences and antibody to c-Jun (c-JunA) was purchased from Delta Biolabs. Human
recombinant c-Jun was purchased from Promega.
Cell lines and culture conditions. 70Z/3 (murine pre-B lymphocyte) cells were maintained in RPMI medium supplemented with
5 % fetal bovine serum (FBS), 1 % b-mercaptoethanol and 2 mM
glutamine. They were treated with 10 mg Salmonella enterica serovar
Typhosa LPS (W0901; Difco) ml21 for 6 h prior to extraction.
P388D1 (murine monocyte-like) cells were maintained in RPMI
medium supplemented with 5 % FBS and 2 mM glutamine. When
indicated, they were treated with 0.1 mg LPS ml21 prior to processing for extracts. Alternatively, P388D1 cells were stimulated
with poly(I : C) (25 mg ml21; Sigma-Aldrich) in Aim V medium
(Invitrogen).
Thioaptamer treatment of P388D1 cells. P388D1 cells were
plated in T25 flasks in Aim V medium (Invitrogen). Oligonucleotide
(25 mg) was mixed with 50 ml liposomes (Tfx-50, Promega) in
500 ml Aim V medium and added to the cells. Following a 2 h incubation, poly(I : C) (Sigma-Aldrich) was added to a final concentration of 25 mg ml21 and the cells were incubated for an additional
18 h before harvesting for nuclear extract preparation. Culture
supernatants were used for cytokine measurements.
Electrophoretic mobility shift assay (EMSA). Nuclear extracts
In this study, we identify the binding specificity of a thioaptamer oligonucleotide, XBY-S2, that recognizes AP-1 and
can be used to modulate the basal levels of macrophage
cytokine expression as well as the expression of cytokines in
response to stimulation with LPS. This thioaptamer alters
cytokine gene expression in macrophage cell lines as well as
primary macrophages and we show that it protects animals
from a potentially lethal PICV infection.
METHODS
Preparation and purification of oligonucleotides. Single-
stranded oligonucleotides were synthesized to order by Bio-Synthesis
982
were prepared following standard procedures as described previously
(Dyer et al., 1993). For EMSA reactions, 1–5 mg nuclear extract was
incubated with 0.1 pmol radiolabelled oligonucleotide in a 15 ml
volume under standard reaction conditions [20 mM HEPES (pH 7.5),
50 mM KCl, 2.5 mM MgCl2, 20 mM dithiothreitol (DTT), 10 % glycerol, plus 50 mg poly(dI : C) and 0.1 mg BSA ml21] (Dyer & Herzog,
1995). For competition experiments, a 35-fold excess of unlabelled
oligonucleotide was also added. For supershift experiments, nuclear
extracts were incubated with antibody overnight at 4 uC in a 15 ml
volume under standard reaction conditions in buffer lacking
poly(dI : C) prior to the addition of the radiolabelled oligonucleotide
and 50 mg poly(dI : C).
Microaffinity isolation assay. Microaffinity purification (MAP)
of proteins binding to the AP-1 and XBY-S2 oligonucleotides was
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 03 Aug 2017 10:24:16
Journal of General Virology 88
AP-1 inhibition and arenavirus infection
performed by a two-step biotinylated DNA–streptavidin capture
assay (Casola et al., 2000). In this assay, duplex oligonucleotides
were chemically synthesized containing 59 biotin on a flexible linker
(Bio-Synthesis). Dithioated aptamers with the biotin linker were
synthesized in house. One milligram of P388D1 cell nuclear extract
was incubated at 4 uC for 30 min with 50 pmol biotinylated AP-1 or
XBY-S2, in the absence or presence of a 10-fold molar excess of
non-biotinylated wild-type or mutated AP-1 sites. The binding
buffer contained 8 mg poly(dI : C) (as non-specific competitor) and
5 % (v/v) glycerol, 12 mM HEPES, 80 mM NaCl, 5 mM DTT,
5 mM MgCl2 and 0.5 mM EDTA. One hundred microlitres of a
50 % slurry of prewashed streptavidin–agarose beads was then added
to the sample, which was incubated at 4 uC for an additional 20 min
with gentle rocking. Pellets were washed twice with 500 ml binding
buffer and the washed pellets were resuspended in 100 ml 16 SDSPAGE sample buffer. After SDS-PAGE separation, proteins were
transferred to Immobilon P (Millipore) membranes for immunoblot
analysis.
Immunoblots. Samples (10–20 mg) were electrophoresed by standard SDS-PAGE (8 % gels) and transferred to Immobilon-P. Filters
were blocked in 5 % non-fat dry milk–Tris-buffered saline (TBS)
overnight and then incubated with a primary antibody diluted in
milk–TBS plus 100 mg BSA ml21 for 1 h. Following a series of TBS–
Tween (0.5 %) washes, the filters were incubated with horseradish
peroxidase-conjugated secondary antibody in milk–TBS–BSA for
1 h. Following another series of washes, the filters were soaked in
the Pierce SuperSignal chemiluminescent substrate (Pierce Biotechnology) and exposed to film.
Cytokine assays. IL-12p40, IL-12p40/p70, IL-6 and TNF-a from
mouse cells were measured using ELISA kits (Biosource International) following the instructions of the manufacturer. Guinea pig
TNF-a was measured by bioassay (Flick & Gifford, 1984) and guinea
pig IL-8 was measured using an ELISA kit for human IL-8 (R&D
Systems).
Stably transfected reporter P388D1 assays of thioaptamer
action. A reporter vector containing the firefly luciferase gene with
AP-1 cis-enhancer elements (pHTS-AP1) was obtained from Biomyx
Technology. Control vectors had a multiple cloning site in lieu
of enhancer sequences upstream of the reporter gene (designated
pHTS-MCS). P388D1 cells were maintained prior to transfection in
Dulbecco’s modified Eagle’s medium (DMEM) supplemented with
10 % FBS, 100 U penicillin ml21 and 100 mg streptomycin ml21.
Cells were transfected using the calcium phosphate precipitation
method and were subsequently placed in medium containing 300 mg
hygromycin ml21. After 3–4 weeks, colonies were screened for the
presence of the reporter gene by stimulating monolayers with 20 ng
recombinant human TNF-a ml21 (R&D Systems), and assaying for
luciferase activity 6–24 h later using the luciferase assay system
(Promega). The P388D1 cells stably transfected with the pHTS-AP1
luciferase reporter plasmid were maintained with high-glucose
DMEM containing 300 mg hygromycin ml21 and 10 % FBS. For the
testing of thioaptamer influence on the expression of the AP-1
driven luciferase reporter gene, 56105 P388AP1 cells were seeded
into the wells of a six-well plate and grown at 37 uC overnight.
XBY-S2 (10 mg per well) was added to the appropriate wells and
the cultures were grown for an additional 18 h. LPS (100 ng ml21)
was then added to the appropriate wells. Each control and treatment
group consisted of three wells. After 6 h, the cells were rinsed twice
with PBS and then lysed by the addition of 400 ml 16 lysis buffer
per well (40 mM Tricine pH 7.8, 50 mM NaCl, 2 mM EDTA,
1 mM MgSO4, 5 mM DTT and 1 % Triton X-100) and incubated
for 15 min at room temperature with gentle rocking. Samples were
either used immediately to assay the luciferase activity or stored at
280 uC.
http://vir.sgmjournals.org
Virus and aptamer/liposome preparation. Pooled guinea pig
spleen stock of PICV P18 virus derived from Pichinde Munchique
strain (CoAn 4763) was diluted to 1000 p.f.u. ml21 in endotoxinfree PBS containing Ca2+ and Mg2+. For XBY-S2 and XBY-S1
treatment, Tfx-50 liposomes (Promega) were used as a delivery
vehicle, with a constant lipid : DNA charge ratio of 1.3 : 1 (Ono et al.,
1998) and prepared according to the manufacturer’s instructions.
Aptamer/liposome was then diluted in endotoxin-free PBS containing Ca2+ and Mg2+ to a final concentration of 50 mg aptamer
ml21.
Animal XBY-S2 treatment/virus inoculation. Male Hartley
outbred guinea pigs, approximately 6 weeks old, were obtained from
Charles River Laboratories (colony K81). Guinea pigs were treated
2 h prior to virus infection with a 1 ml intraperitoneal (ip) injection
of XBY-S2 in liposomes (50 mg thioaptamer ml21). A control group
received an ip injection of endotoxin-free PBS only. Two hours after
the first XBY-S2/liposome injection, 1000 p.f.u. PICV P18 was
inoculated ip into guinea pigs. Two days post-virus infection, guinea
pigs received a second injection of thioaptamer/liposomes or PBS at
the same dose as day 0. Compiled data from two separate experiments are shown, representing a total of 18 guinea pigs per group.
For XBY-S1 treatment, the injections were given 1 day before infection and on days 1 and 3 post-infection, with six animals per group.
Thioaptamer treatment of primary guinea pig macrophages.
Peritoneal macrophages from three male outbred Charles River
guinea pigs (350 g each) were harvested by aseptic peritoneal lavage
with 100 ml sterile PBS (Ca- and Mg-free). The cells were collected
by centrifugation, resuspended in 2.5 ml red cell lysis buffer (0.15 M
NH4Cl, 0.1 mM Na2–EDTA, 1.0 mM KHCO3, pH 7.3) and placed
in a 37 uC incubator for 5 min with occasional mixing. We then
added 2.5 ml 16 RPMI 1640 medium supplemented with 10 %
(v/v) FBS, 100 U penicillin ml21, 100 mg streptomycin ml21 and
2 mM L-glutamine and plated cells into 96-well plates at a concentration of 16105 cells per well. Cells were then treated with XBY-S2
for 24 h. The supernatants were collected and analysed for TNF-a by
bioassay (Aronson et al., 1995; Flick & Gifford, 1984) and IL-8 using
a human IL-8 ELISA (R&D Systems) previously shown to be applicable for measuring guinea pig IL-8 (Kuo et al., 1997).
Statistics. Where indicated, statistical significance of differences
between groups was determined using Student’s t-test. LogRank
analysis was performed to compare survival curves for treated and
untreated animals (Sigmastat 3.0; Systat Software).
RESULTS
XBY-S2 influences the outcome of lethal PICV
infection
We have previously shown that increases in TNF-a have
been associated with fatal PICV infection of guinea pigs
(Aronson et al., 1995). Therefore, we hypothesized that
inhibition of transcriptional factors would modulate the
host immune response and reduce PICV-induced mortality
in our guinea pig model. We have previously described
utilization of systematic evolution of ligands by exponential
enrichment (SELEX) technology to develop thioaptamers
against several target proteins, including transcription
factors (Yang et al., 2002a). Briefly, several double-stranded
oligomers targeting transcription factors were tested for
their ability to modulate an in vivo PICV infection. In this
study we synthesized XBY-S2, a 14 bp DNA duplex that
contains six dithioate residues (Table 1) (three on each
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 03 Aug 2017 10:24:16
983
S. M. Fennewald and others
Table 1. Oligonucleotides used in this study
‘s’ denotes a dithioated linkage. Binding sites are in bold.
ODN name
XBY-S0
XBY-S1
XBY-S2
XBY-6
AP-1
CREB
NF-kB
ISRE
ODN sequence
CCAGGTCAGATCTG
GGTCCAGTCTAGTG
TsTsGCGCGC-A-AC-ATsG
A-A-CGCGCGsTsTGsTA-C
CC-AGTsG-ACTsC-AGTsG
GGsTCA-CsTGA-GsTCA-C
CC-AGG-AG-ATsTsCC-AC
GGsTCCsTCsTA-A-GGsTG
CGCTTGATGACTCACCGGAA
GCGAACTACTGAGTGGCCTT
AGAGATTGCCTGACGTCAGAGAGCTAG
TCTCTAACGGACTGCAGTCTCTCGATC
AGTTGAGGGGACTTTCCCAGGC
TCAACTCCCCTGAAAGGGTCCG
GATCGGGAAACCGAAACTGAAGCC
CTAGCCCTTTGGCTTTGACTTCGG
strand) that includes a consensus AP-1-binding site.
Dithioate linkages contain sulfur replacements for the two
non-bridging oxygens in the DNA phosphate linkage. XBYS0 and XBY-S1 are oligonucleotides containing the same
base composition in each strand. XBY-S0 lacks dithioate
substitutions; XBY-S1 contains the same number of
dithioate linkages as XBY-S2. The other oligonucleotides
used in this study are also shown in Table 1. The effectiveness of the oligonucleotides was determined in PICVinfected guinea pigs. Guinea pigs were treated with
thioaptamer on days 0 and 2 relative to time of infection
with a lethal dose of PICV (P18). The most effective
oligonucleotide at modulating PICV infection in guinea pigs
was XBY-S2. Treatment with XBY-S2 increased and
prolonged the survival of PICV-infected animals (Fig. 1a).
The majority (61 %) of the animals treated survived virus
infection, which was a significant improvement over the
22 % survival rate for the untreated animals (P=0.013,
LogRank survival analysis). In contrast, thioaptamer XBYS1 was tested with doses administered at 1 day before
infection, and 1 and 3 days post-infection. It not only failed
to modulate the virus infection but also decreased survival,
though it was not statistically significant (Fig. 1b).
Additional experimentation is under way to determine the
optimal dosage and time of administration to protect
animals from virulent arenavirus infection.
EMSA analysis of P388D1 and 70Z/3 cells
Since XBY-S2 proved to be effective against PICV infection
in guinea pigs, we sought to investigate the mechanism of
action and binding specificity of XBY-S2. An examination of
the XBY-S2 sequence revealed an AP-1 consensus binding
site TGA(C/G)TCA that resembled the related CRE-binding
984
Fig. 1. XBY-S2 prolongs and increases survival of PICVinfected guinea pigs. (a) Guinea pigs were treated with XBYS2 (solid line) at 2 h prior to infection with a lethal dose of
PICV variant P18. A control group received an injection of
endotoxin-free PBS only (dashed line). Mortality was monitored
for 40 days post-infection. (b) XBY-S1 (solid line) decreases
survival; treatment was at ”1, 1 and 3 days post-infection.
site, TGACgTCAG. The binding specificity of the XBY-S2
oligonucleotide was determined using lysates from mouse
P388D1 macrophages and 70Z/3 mouse pre-B cells. 32Plabelled XBY-S2 was found to bind specifically with proteins
in the extracts, forming one discrete band (Fig. 2a). Fully
phosphorothioate-substituted oligonucleotides are unable
to show binding specificity in this assay due to very high
levels of non-specific binding. Only a subset of the partially
dithioate-substituted oligonucleotides show binding,
depending on the sequence specificity of their binding
sites. The XBY-S2 binding was successfully competed by
unlabelled XBY-S2, indicating specific binding, and by AP-1
and CREB oligonucleotides, indicating that the binding was
to proteins in the AP-1 family. Neither an oligonucleotide
with an NF-kB nor an interferon-stimulated response
element (ISRE)-binding site was capable of competing for
binding, indicating that these immune-associated transcription factors are not bound by XBY-S2 (Fig. 2a). In the
reciprocal binding assays, binding of AP-1 proteins by their
consensus oligonucleotide was successfully competed by
XBY-S2, confirming that XBY-S2 was binding to the same
proteins as the AP-1 consensus oligonucleotide (Fig. 2b).
XBY-S2 was also specifically bound by human recombinant
AP-1 and c-Jun protein dimers (data not shown).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 03 Aug 2017 10:24:16
Journal of General Virology 88
AP-1 inhibition and arenavirus infection
Identification of the AP-1 complexes binding to
the AP-1 and XBY-S2 oligonucleotides
Fig. 2. XBY-S2 binds to AP-1 proteins in both macrophage and
B cell lines. EMSA analysis to determine the complexes present in
mouse 70Z/3 pre-B cells (activated with LPS) and P388D1
mouse macrophage-like cells [activated with poly(I : C)] using
either a consensus AP-1 binding site (a) or XBY-S2 thioaptamer
(b). Competition with 50-fold molar excess unlabelled transcription
factor-binding site oligonucleotides (AP-1, CREB, XBY-S2, NFkB and ISRE) in the EMSA reaction was performed as indicated.
There are more than 10 different members of the AP-1
family of proteins, which dimerize in various combinations.
To determine which of the AP-1 proteins were binding to
the XBY-S2 oligonucleotide, we used a combination of
immunoblots, supershift EMSAs and MAP. Immunoblots
revealed that P388D1 cells contain JunB, c-Jun, Fra-2,
CREB, CREM and possibly JunD proteins (Fig. 3a). High
background in immunoblots using anti-Fra-2(A) and antic-Fos(A) precluded their use and inclusion in the selection
shown in Fig. 3(a). Subsequently, supershift EMSA reactions were used to determine which of the AP-1 proteins
were binding to XBY-S2 on the EMSA gels (Fig. 3b). Where
possible, we used more than one antibody from different
sources, or specific to different portions of an AP-1 protein,
to confirm these results. Supershift analysis revealed that
AP-1 complexes in stimulated P388D1 cells contained
detectable levels of Fra-2, c-Fos, JunB and JunD, as well as
c-Jun and phosphorylated c-Jun (Fig. 3b). We were unable
to detect the presence of active Fra-1, FosB, ATF2, CREM
and CREB using supershift assays. Most of the AP-1
complexes contain Fra-2 and/or JunB since the combination
of antibodies can supershift the majority of the complexes
(data not shown). The same experiment was performed to
identify the AP-1 proteins that bind to XBY-S2 (Fig. 3b).
Fra-2, c-Fos, JunB and possibly c-Jun were found in
complexes that bound XBY-S2.
Fig. 3. Determination of AP-1 proteins capable of binding to the XBY-S2 thioaptamer
decoy. Abbreviations: pc-Jun, phosphorylated
c-Jun; pATF-2, phosphorylated ATF-2;
pCREB, phosphorylated CREB. (a) Immunoblot analysis of P388D1 nuclear extracts
with the indicated antibodies for AP-1/
CREB family members. Two separate antibodies for Fra-2, c-Jun and c-Fos were used
and are distinguished by the A and B designation. (b) Supershift analysis of P388D1
nuclear protein complexes binding to either
the AP-1 consensus oligonucleotide or the
XBY-S2 thioaptamer. Antibodies are the
same as those used for immunoblots and
were added to each of the EMSA reactions
to achieve a supershift as indicated. Supershifted bands are indicated by a dot. (c)
MAP of proteins in P388D1 nuclei which
bind to the XBY-S2 aptamer was followed
by immunoblot analysis of the proteins that
were bound.
http://vir.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 03 Aug 2017 10:24:16
985
S. M. Fennewald and others
Due to the limited availability of antibodies that are effective
in supershift analysis, we also used MAP in conjunction
with immunoblotting to confirm the results of negative
supershift data. MAP is a more sensitive assay than either
immunoblotting or EMSA. XBY-S2 was end-labelled with
biotin and streptavidin beads were used to purify any
proteins that were bound to it. MAP results established that
XBY-S2 was recognized by AP-1 dimers that also included
CREM, but there was still no detectable ATF-2 or FosB
(Fig. 3c). Either the complexes containing CREM are not
detectable by EMSA, or the CREM antibody is not effective
when used in the EMSA supershift protocol, but is effective
in immunoblot analysis.
Treatment of P388D1 cells with XBY-S2
eliminates AP-1 DNA-binding activity
XBY-S2 includes a consensus AP-1-binding site [59-TGA(G/
C)TCA-39] and, when used as a decoy aptamer, it would be
expected to influence the expression of cytokines from
macrophages by acting to sequester the AP-1 proteins in
cells. In order to demonstrate that XBY-S2 functions as a
decoy, P388D1 macrophage cultures were treated in triplicate with liposomes, either with or without XBY-S2, for 2 h
prior to stimulation with LPS; liposomes were used to
deliver the thioaptamer into cells more efficiently. XBY-S0
was used as a control oligonucleotide since it contains the
same base composition as the XBY-S2 oligonucleotide,
though it does not contain any dithioate modifications.
Nuclear extracts were harvested at 16 h post-stimulation
with LPS and analysed by EMSA. The EMSA gels were
quantified, to allow statistical analysis, and the results are
depicted graphically in Fig. 4(a). Treatment of cells with
XBY-S2 significantly reduced the AP-1-binding activity.
Treatment with the control oligonucleotide XBY-S0 led to a
non-significant reduction of AP-1-binding activity and was
significantly higher than the levels of AP-1 in the XBY-S2treated cells. Therefore, the XBY-S2 thioaptamer appears to
be an efficient and specific inhibitor of AP-1 transcription
factor DNA-binding activity.
Reporter assays confirm that XBY-S2 treatment
of P388 cells inhibits AP-1 transcription factors
activity
In order to confirm that the XBY-S2 thioaptamer altered
AP-1 regulated transcription, we established a P388D1derived cell line (P388AP1) stably transformed with an AP-1
driven luciferase reporter plasmid, pHTS-AP1 (Biomyx
Technology). This plasmid contains a tandem repeat of six
copies of an AP-1 site (TGACTAA) linked to the luciferase
gene. Fig. 4(b) illustrates that the P388AP1 reporter cell line
responds to LPS stimulation with a twofold increase in the
expression of luciferase. Treatment with XBY-S2 alone
stimulated nearly the same increase in luciferase expression
as LPS stimulation. LPS in addition to XBY-S2 resulted in an
additive increase of luciferase expression. Treatment with a
thioaptamer without an AP-1 site had no effect on AP-1driven expression of luciferase (data not shown). Thus,
986
Fig. 4. XBY-S2 eliminates AP-1 DNA-binding activities in
macrophages and alters AP-1 reporter gene expression in
P388D1 cells. (a) P388D1 cells were incubated with liposomes
with or without the indicated thioaptamers for 24 h prior to stimulation with LPS. Binding to an AP-1 consensus binding site
in nuclear extracts was analysed by EMSA. InstantImager quantification of the gel is depicted in (a). Statistical analysis used
Student’s t-test. (b) P388D1 cells stably transfected (P388AP1)
with an AP-1-driven luciferase reporter plasmid, pHTS-AP1,
were stimulated with 100 ng LPS ml”1 for 6 h with and without
pretreatment overnight with 10 mg XBY-S2 per well and then
assayed for luciferase activity.
XBY-S2 appears to function by increasing AP-1-driven
transcription, possibly by blocking Fra-2, the repressive
AP-1 subunit that is present in large amounts in these cells.
XBY-S2 perturbation of cytokine expression in
P388D1 cells in response to poly(I : C)
Poly(I : C) is a potent inducer of cytokine expression
through Toll-like receptors (Alexopoulou et al., 2001). To
determine whether XBY-S2 can influence cytokine gene
expression, cytokines elaborated from macrophages following poly(I : C) stimulation were measured in combination
with prior treatment with the XBY-S2 thioaptamer. As
above, liposomes were used to deliver the aptamer more
efficiently. A 2 h pre-treatment with XBY-S2 increased the
expression of IL-12p40+p70 (sixfold), IL-6 (3.5-fold), and
TNF-a (1.7-fold) over the levels expressed in cells stimulated
with poly(I : C) alone (Fig. 5). IL12p70 was only detectable
in those cells treated with XBY-S2 and poly(I : C). Interestingly, liposome treatment without thioaptamer appeared to
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 03 Aug 2017 10:24:16
Journal of General Virology 88
AP-1 inhibition and arenavirus infection
cytokine production from primary peritoneal macrophages
was examined following treatment with the XBY-S2
thioaptamer. Due to the limited availability of anti-guinea
pig-based reagents, we are limited as to the cytokines that
can be measured in the guinea pig. The supernatants of
cultured primary guinea pig peritoneal macrophages were
assayed for TNF-a by standard bioassay and IL-8 was
measured by ELISA based on human IL-8. These two
cytokines were chosen because they are among the few
guinea pig macrophage-derived cytokines for which available standardized assays exist, and because AP-1 is known to
be important in regulation of their transcription (Hoffmann
et al., 2002). XBY-S2 increased the expression of IL-8 in a
dose-dependent fashion over the levels expressed in
untreated macrophages (Fig. 6). At doses below 20 mg per
105 cells, XBY-S2 appeared to increase basal level of TNF-a
expression, but there was no clear dose dependence at higher
doses. Therefore, these data, in part, confirm the results seen
in the P388D1 cell line, which indicate that XBY-S2 either
directly targets AP-1 proteins that repress the transcription
of these cytokines, or AP-1 regulates the expression of
another protein that serves as a repressor. XBY-S2 does not
block the activities of transcription factors that activate the
expression of these cytokines. However, XBY-S2 increases
the basal level of expression of pro-inflammatory cytokines
that could influence innate immunity induced in response
to viral challenge.
DISCUSSION
PICV infection of guinea pigs causes a syndrome that is
indicative of immune system malfunction (Aronson et al.,
1995; Peters et al., 1989). Infection of guinea pigs with
the virulent P18 variant is characterized by dysregulated
Fig. 5. Pretreatment of P388D1 cells with XBY-S2 increases the
levels of cytokine expression in response to poly(I : C) stimulation.
P388D1 cells were treated with XBY-S2 liposome preparations
or liposomes alone 1 h prior to stimulation with poly(I : C)
(25 mg ml”1). Cell culture supernatants were collected 24 h after
stimulation and the levels of the cytokines measured by ELISA.
suppress cytokine gene expression under these conditions.
These data suggest that either binding of AP-1 proteins to
the XBY-S2 decoy aptamer eliminates transcriptional
repressors of these cytokines, or a specific set of AP-1
proteins regulates the expression of another protein that
serves as a repressor. These data also suggest that XBY-S2
modulation of AP-1 proteins alters the expression of proinflammatory cytokines that could influence innate immunity induced in response to viral challenge.
XBY-S2 perturbation of cytokine expression in
primary guinea pig macrophages
To determine whether XBY-S2 can also influence cytokine
gene expression in primary cells from guinea pigs, the
http://vir.sgmjournals.org
Fig. 6. XBY-S2 increases cytokine expression in primary
guinea pig macrophages. Primary peritoneal macrophages were
harvested by lavage from guinea pigs and treated with varying
amounts of XBY-S2 for 48 h. TNF-a and IL-8 were measured
in culture supernatants.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 03 Aug 2017 10:24:16
987
S. M. Fennewald and others
pro-inflammatory cytokine production (Aronson et al.,
1995) with profound terminal shock. The macrophage
tropism of PICV is a characteristic of many haemorrhagic
fever viruses (reviewed by Peters et al., 1989) and may be an
important contributor to either the ability of the virus to
evade the immune system and/or the eventual fatal shock
syndrome. Virus infection of macrophages presents an
opportunity for a virus to evade the immune system by
modulating the immune response of the infected cell.
Inhibition of macrophage activation would favour viral
spread, as activation of macrophages is known to increase
the microbicidal action of these phagocytes (Oswald et al.,
1992). Therefore, treatment with an immunomodulating
agent such as the thioaptamer XBY-S2 may alter the expression of a number of cytokines that are important in generating an effective early innate response, in the development
of the protective Th-1 type antiviral response critical in
determining the outcome of infection, and ultimately the
development of the adaptive immune response. In previous
studies, macrophages explanted from PICV-infected guinea
pigs and stimulated ex vivo with LPS showed some suppression of TNF-a induction (Aronson et al., 1994; Fennewald
et al., 2002). We previously described that the attenuated
PICV P2 variant is associated with the appearance of
activated forms of transcription factors NF-kB in macrophages, while the lethal PICV P18 variant is associated with
the ‘non-activated’ state of these transcription factors that
appears to correlate with a failure to mount an effective
immune response (Fennewald et al., 2002). Here we
demonstrate that modulation of the DNA-binding activity
of another transcription factor, AP-1, appears to eliminate
the repression of cytokine gene expression, elevating the
basal and, in some circumstances, the induced cytokines.
Modulation of AP-1 is capable of protecting guinea pigs
from lethal PICV infection and we hypothesize that this is
the result of changes in host cell gene expression that
counteract inhibitions by pathogenic PICV.
Though we were somewhat surprised to find that our most
active aptamer was binding to AP-1, it is known that AP-1
is important in the immune response (Adcock, 1997).
Although there are over 50 members of the AP-1 family of
proteins and potentially over 1000 different homo- and
heterodimeric forms (Newman & Keating, 2003), the
majority of the detectable AP-1 DNA-binding activity in
mouse macrophages consists of dimers that include Fra-2
and JunB. As Fra-2 can also negatively regulate c-Jun activity
(Suzuki et al., 1991; Sonobe et al., 1995) and can form
heterodimers with JunB that act as transcriptional repressors in keratinocytes (Rutberg et al., 1997), it is conceivable
that the negative influence of c-Jun and JunB on basal
cytokine expression in macrophages may arise from formation of repressive Jun/Fra-2 heterodimers. The treatment
of macrophages with the thioaptamer XBY-S2 can completely abrogate AP-1 DNA binding activity and hence could
be acting as a decoy to effectively outcompete the repressive
Jun/Fra-2 dimers. By modulating the activity of AP-1 we
988
have shown that we can increase the expression of several
key cytokines including TNF-a, IL-8, IL-6 and IL-12 and
increase the survival of guinea pigs to lethal PICV infection.
The increased expression of IL-12 may be particularly
important. It is consistent with the inhibitory action of some
AP-1 dimers and the work of Roy et al. (1999), who
demonstrated that a deficiency in c-Fos increased macrophage IL-12 production. Previous research has demonstrated that IL-12 administration at low doses can be
efficacious in mice infected with LCMV, resulting in
inhibition of virus replication and enhanced CD-8 responses
(Orange et al., 1995). Similarly, low doses of IL-12 are also
effective in protecting mice against Encephalomyelocarditis
virus, Murine hepatitis virus and herpes simplex virus, and
promotes clearance of vesicular stomatitis virus while
having other positive effects on the outcome of a number
of other virus infections (Komastu et al., 1998). Though we
are unable to confirm the observations in vivo in PICVinfected guinea pigs due to the lack of antibody reagents or a
bioassay, the increase in IL-12 production following XBY-S2
treatment could contribute to the efficacy in the animal.
As with all treatments, it is not entirely proven that the in
vivo efficacy is due to the measured in vitro activity – that the
ability of XBY-S2 to prolong survival is due to its in vitro
ability to inhibit AP-1 proteins. While phosphorothioate
oligonucleotides are known to give strong non-specific
effects, our modestly modified aptamers continue to show
specific binding in assays and only the XBY-S2 aptamer
showed significant protection in the animal model. Still, we
cannot rule out the possibility that additional activities,
including Toll-like receptor responses, are important in the
in vivo efficacy. The XBY-S2 activity increases the interest in
the AP-1 proteins and their significance in both positive and
negative regulation of the immune response.
Inhibition of AP-1 with XBY-S2 treatment increases cytokine gene expression and protects against virus infection. It
is of interest to note that Lassa virus infection of macrophages leads to the release of virus particles, but not to an
increase in TNF-a, IL-1b, IL-12p35 and p40, IL-10, IL-6,
TGF-b, IFN-c or CD25 synthesis (Baize et al., 2004).
Interestingly, these authors also demonstrated that Lassa
virus infection of dendritic cells led to the expression of
elevated levels of IL-8 but no other chemokines. Therefore,
our data using virulent PICV correlate with results from
studies with Lassa virus that indicate that there is viral
suppression of the normal response of macrophages and
dendritic cells to dsRNA or viral infection.
ACKNOWLEDGEMENTS
We wish to express our deep regrets at the death of Dr Robert E. Shope
on 19 January 2004 in Galveston and to acknowledge his leadership and
participation in this research. Dr Shope had a world-class career of
more than 40 years of identifying and isolating infectious diseases
worldwide. His contributions to the scientific arena are extensive, but
more importantly, he consistently exemplified and fostered an attitude
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 03 Aug 2017 10:24:16
Journal of General Virology 88
AP-1 inhibition and arenavirus infection
of service and collegiality. Dr Shope was admired and beloved by
students and scientific colleagues alike, and his contributions to science
and society will long be remembered. We wish to thank Barry Elsom
for his excellent technical assistance and Dr Debra Kallick for her
helpful discussions. This work was supported by grants from DARPA
(DAAD19011037), DTRA (DAAD17-01-D0001), NIH (N01-HV28184, U01 AI054827, R01 A127744) and by a grant from NIAID to
Dr Herzog through the Western Regional Center of Excellence for
Biodefence and Emerging Infectious Disease Research, NIH grant
number U54 AI057156.
Falvo, J. V., Uglialoro, A. M., Brinkman, B. M., Merika, M., Parekh,
B. S., Tsai, E. Y., King, H. C., Morielli, A. D., Peralta, E. G. & other
authors (2000). Stimulus-specific assembly of enhancer complexes
on the tumor necrosis factor alpha gene promoter. Mol Cell Biol 20,
2239–2247.
Fennewald, S. M., Aronson, J. F., Zhang, L. & Herzog, N. K. (2002).
Alterations in NF-kappaB and RBP-Jkappa by arenavirus infection of
macrophages in vitro and in vivo. J Virol 76, 1154–1162.
Fisher-Hoch, S., McCormick, J. B., Sasso, D. & Craven, R. B. (1988).
Hematologic dysfunction in Lassa fever. J Med Virol 26, 127–135.
Flick, D. A. & Gifford, G. E. (1984). Comparison of in vitro cell
REFERENCES
cytotoxic assays for tumor necrosis factor. J Immunol Methods 68,
167–175.
Adcock, I. M. (1997). Transcription factors as activators of gene
Giese, K., Kingsley, C., Kirshner, J. R. & Grosschedl, R. (1995).
transcription: AP-1 and NF-kappa B. Monaldi Arch Chest Dis 52,
178–186.
Alexopoulou, L., Holt, A. C., Medzhitov, R. & Flavell, R. A. (2001).
Assembly and function of a TCR alpha enhancer complex is
dependent on LEF-1-induced DNA bending and multiple proteinprotein interactions. Genes Dev 9, 995–1008.
Recognition of double-stranded RNA and activation of NF-kappaB
by Toll-like receptor 3. Nature 413, 732–738.
Hoffmann, E., Dittrich-Breiholz, O., Holtmann, H. & Kracht, M.
(2002). Multiple control of interleukin-8 gene expression. J Leukoc
Aronson, J. F., Herzog, N. K. & Jerrells, T. R. (1994). Pathological
Biol 72, 847–855.
and virological features of arenavirus disease in guinea pigs.
Comparison of two Pichinde virus strains. Am J Pathol 145, 228–235.
Jin, G. & Howe, P. H. (1997). Regulation of clusterin gene expression
by transforming growth factor beta. J Biol Chem 272, 26620–26626.
Aronson, J. F., Herzog, N. K. & Jerrells, T. R. (1995). Tumor necrosis
factor and the pathogenesis of Pichinde virus infection in guinea
pigs. Am J Trop Med Hyg 52, 262–269.
Baize, S., Leroy, E. M., Georges-Courbot, M. C., Capron, M.,
Lansoud-Soukate, J., Debre, P., Fisher-Hoch, S. P., McCormick, J. B.
& Georges, A. J. (1999). Defective humoral responses and extensive
intravascular apoptosis are associated with fatal outcome in Ebola
virus-infected patients. Nat Med 5, 423–426.
Baize, S., Kaplon, J., Faure, C., Pannetier, D., Georges-Courbot,
M. C. & Deubel, V. (2004). Lassa virus infection of human dendritic
cells and macrophages is productive but fails to activate cells.
J Immunol 172, 2861–2869.
Bielinska, A., Shivdasani, R. A., Zhang, L. Q. & Nabel, G. J. (1990).
Regulation of gene expression with double-stranded phosphorothioate oligonucleotides. Science 250, 997–1000.
Casola, A., Garofalo, R. P., Jamaluddin, M., Vlahopoulos, S. &
Brasier, A. R. (2000). Requirement of a novel upstream response
Karin, M. & Shaulian, E. (2001). AP-1: linking hydrogen peroxide
and oxidative stress to the control of cell proliferation and death.
IUBMB Life 52, 17–24.
King, D. J., Bassett, S. E., Li, X., Fennewald, S. M., Herzog, N. K.,
Luxon, B. A., Shope, R. & Gorenstein, D. G. (2002). Combinatorial
selection and binding of phosphorothioate aptamers targeting human
NF-kappa B RelA(p65) and p50. Biochemistry 41, 9696–9706.
Komastu, T., Ireland, D. D. & Reiss, C. S. (1998). IL-12 and viral
infections. Cytokine Growth Factor Rev 9, 277–285.
Kuo, H. P., Hwang, K. H., Lin, H. C. & Lu, L. C. (1997). Effect of
endogenous nitric oxide on tumour necrosis factor-alpha-induced
leukosequestration and IL-8 release in guinea-pigs airways in vivo. Br
J Pharmacol 122, 103–111.
Leroy, E. M., Baize, S., Volchkov, V. E., Fisher-Hoch, S. P., GeorgesCourbot, M. C., Lansoud-Soukate, J., Capron, M., Debre, P.,
McCormick, J. B. & Georges, A. J. (2000). Human asymptomatic
element in respiratory syncytial virus-induced IL-8 gene expression.
J Immunol 164, 5944–5951.
Ebola infection and strong inflammatory response. Lancet 355,
2210–2215.
Chinenov, Y. & Kerppola, T. K. (2001). Close encounters of many
Mann, M. J. (1998). E2F decoy oligonucleotide for genetic engineering
kinds: Fos-Jun interactions that mediate transcription regulatory
specificity. Oncogene 20, 2438–2452.
Marshall, W. S. & Caruthers, M. H. (1993). Phosphorodithioate DNA
of vascular bypass grafts. Antisense Nucleic Acid Drug Dev 8, 171–176.
Cho-Chung, Y. S., Park, Y. G. & Lee, Y. N. (1999). Oligonucleotides
as a potential therapeutic drug. Science 259, 1564–1570.
as transcription factor decoys. Curr Opin Mol Ther 1, 386–392.
Merika, M., Williams, A. J., Chen, G., Collins, T. & Thanos, D. (1998).
De Cesare, D., Fimia, G. M. & Sassone-Corsi, P. (1999). Signaling
Recruitment of CBP/p300 by the IFN beta enhanceosome is required
for synergistic activation of transcription. Mol Cell 1, 277–287.
routes to CREM and CREB: plasticity in transcriptional activation.
Trends Biochem Sci 24, 281–285.
Du, W., Thanos, D. & Maniatis, T. (1993). Mechanisms of transcrip-
tional synergism between distinct virus-inducible enhancer elements.
Cell 74, 887–898.
Dyer, R. B. & Herzog, N. K. (1995). Isolation of intact nuclei for
nuclear extract preparation from fragile B-lymphocyte cell lines.
Biotechniques 19, 192–195.
Morishita, R., Gibbons, G. H., Horiuchi, M., Ellison, K. E., Nakama,
M., Zhang, L., Kaneda, Y., Ogihara, T. & Dzau, V. J. (1995). A gene
therapy strategy using a transcription factor decoy of the E2F
binding site inhibits smooth muscle proliferation in vivo. Proc Natl
Acad Sci U S A 92, 5855–5859.
Morishita, R., Higaki, J., Tomita, N. & Ogihara, T. (1998). Application
Dyer, R. B., Collaco, C., Niesel, D. W. & Herzog, N. K. (1993). Shigella
flexneri invasion of HeLa cells induces kB DNA-binding activity.
of transcription factor ‘decoy’ strategy as means of gene therapy
and study of gene expression in cardiovascular disease. Circ Res 82,
1023–1028.
Infect Immun 61, 4427–4433.
Newman, J. R. S. & Keating, A. E. (2003). Comprehensive identifica-
Eleouet, J. F., Chilmonczyk, S., Besnardeau, L. & Laude, H. (1998).
tion of human bZIP interactions with coiled-coil arrays. Science
300, 2097.
Transmissible gastroenteritis coronavirus induces programmed cell
death in infected cells through a caspase-dependent pathway. J Virol
72, 4918–4924.
http://vir.sgmjournals.org
Ono, S., Date, I., Onoda, K., Shiota, T., Ohmoto, T., Ninomiya, Y.,
Asari, S. & Morishita, R. (1998). Decoy administration of NF-kB into
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 03 Aug 2017 10:24:16
989
S. M. Fennewald and others
the subarachnoid space for cerebral angiopathy. Hum Gene Ther 9,
1003–1011.
Shaulian, E. & Karin, M. (2002). AP-1 as a regulator of cell life and
Orange, J. S., Salazar-Mather, T. P., Opal, S. M., Spencer, R. L.,
Miller, A. H., McEwen, B. S. & Biron, C. A. (1995). Mechanism of
Sonobe, M. H., Yoshida, T., Murakami, M., Kameda, T. & Iba, H.
(1995). fra-2 promoter can respond to serum-stimulation through
interleukin-12-mediated toxicities during experimental viral infections: role of tumor necrosis factor and glucocorticoids. J Exp Med
181, 901–914.
AP-1 complexes. Oncogene 10, 689–696.
death. Nat Cell Biol 4, E131–E136.
Suzuki, T., Okuno, H., Yoshida, T., Endo, T., Nishina, H. & Iba, H.
(1991). Difference in transcriptional regulatory function between c-
Osborne, S. E., Matsumura, I. & Ellington, A. D. (1997). Aptamers as
Fos and Fra-2. Nucleic Acids Res 19, 5537–5542.
therapeutic and diagnostic reagents: problems and prospects. Curr
Opin Chem Biol 1, 5–9 (Review) (34 refs).
Thanos, D. & Maniatis, T. (1995). Virus induction of human IFN
Oswald, I. P., Wynn, T. A., Sher, A. & James, S. L. (1992). Interleukin
beta gene expression requires the assembly of an enhanceosome. Cell
83, 1091–1100.
10 inhibits macrophage microbicidal activity by blocking the
endogenous production of tumor necrosis factor a required as a
costimulatory factor for interferon c-induced activation. Proc Natl
Acad Sci U S A 89, 8676–8681.
Tomita, S., Tomita, N., Yamada, T., Zhang, L., Kaneda, Y., Morishita, R.,
Ogihara, T., Dzau, V. J. & Horiuchi, M. (1999). Transcription factor decoy
Park, Y. G., Nesterova, M., Agrawal, S. & Cho-Chung, Y. S. (1999).
Tsai, E. Y., Falvo, J. V., Tsytsykova, A. V., Barczak, A. K., Reimold,
A. M., Glimcher, L. H., Fenton, M. J., Gordon, D. C., Dunn, I. F. &
Goldfeld, A. E. (2000). A lipopolysaccharide-specific enhancer
Dual blockade of cyclic AMP response element- (CRE) and
AP-1-directed transcription by CRE-transcription factor decoy
oligonucleotide. Gene-specific inhibition of tumor growth. J Biol
Chem 274, 1573–1580.
Peters, C. J., Jahrling, P. B., Liu, C. T., Kenyon, R. H., McKee, K. T., Jr
& Barrera-Oro, J. G. (1987). Experimental studies of arenavirus
hemorrhagic fevers. Curr Top Microbiol Immunol 134, 5–68.
to study the molecular mechanism of negative regulation of renin gene
expression in the liver in vivo. Circ Res 84, 1059–1066.
complex involving Ets, Elk-1, Sp1, and CREB binding protein and
p300 is recruited to the tumor necrosis factor alpha promoter in
vivo. Mol Cell Biol 20, 6084–6094.
Xu, Q., Musier-Forsyth, K., Hammer, R. P. & Barany, G. (1996).
Peters, C. J., Liu, C. T., Anderson, G. W., Jr, Morrill, J. C. & Jahrling,
P. B. (1989). Pathogenesis of viral hemorrhagic fevers: Rift Valley
Use of 1,2,4-dithiazolidine-3,5-dione (DtsNH) and 3-ethoxy-1,2,4dithiazoline-5-one (EDITH) for synthesis of phosphorothioatecontaining oligodeoxyribonucleotides. Nucleic Acids Res 24, 1602–1607.
fever and Lassa fever contrasted. Rev Infect Dis 11 (Suppl. 4),
S743–S749.
Yang, X., Fennewald, S., Luxon, B. A., Aronson, J., Herzog, N. K. &
Gorenstein, D. G. (1999). Aptamers containing thymidine 39-O-
Roy, S., Charboneau, R., Cain, K., DeTurris, S., Melnyk, D. & Barke,
R. A. (1999). Deficiency of the transcription factor c-Fos increases
phosphorothioates: synthesis and binding to nuclear factor-B. Bioorg
Med Chem Lett 9, 3357–3362.
lipopolysaccharide-induced macrophage interleukin 12 production.
Surgery 126, 239–247.
Yang, X., Bassett, S. E., Li, X., Luxon, B. A., Herzog, N. K., Shope,
R. E., Aronson, J., Prow, T. W., Leary, J. F. & other authors (2002a).
Rutberg, S. E., Saez, E., Lo, S., Jang, S. I., Markova, N., Spiegelman,
B. M. & Yuspa, S. H. (1997). Opposing activities of c-Fos and Fra-2
Construction and selection of bead-bound combinatorial oligonucleoside phosphorothioate and phosphorodithioate aptamer libraries
designed for rapid PCR-based sequencing. Nucleic Acids Res 30, e132.
on AP-1 regulated transcriptional activity in mouse keratinocytes
induced to differentiate by calcium and phorbol esters. Oncogene 15,
1337–1346.
Shaulian, E. & Karin, M. (2001). AP-1 in cell proliferation and
survival. Oncogene 20, 2390–2400.
990
Yang, X., Hodge, R. P., Luxon, B. A., Shope, R. & Gorenstein, D. G.
(2002b). Separation of synthetic oligonucleotide dithioates from
monothiophosphate impurities by anion-exchange chromatography
on a mono-q column. Anal Biochem 306, 92–99.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 03 Aug 2017 10:24:16
Journal of General Virology 88