Download The construction of an enhanced green fluorescence protein

The construction of an enhanced green fluorescence protein reporter system under control
of muscle specific promoters and their potential roles in studying ischemic disease.
Andrew Burch
Abstract:
Diseases attributed to ischemia are leading causes of mortality in developed
countries and using the bodies’ own revascularization mechanisms to treat ischemic
events is an active area of research. It has been observed that both ischemia and
arteriogenesis lead to a poor vasodilatory response in arteries, but the mechanism for
impairment remains unknown. The construction of an expression system to study
arteriogenic mechanisms independently will greatly aide in the elucidation of mechanism
causing impaired vasodilation caused by arteriogenesis. To this end, enhanced green
fluorescent protein reporter expression vectors under control of muscle specific
promoters were created that have the potential to drive expression of arteriogenic
mitogens upon further modification.
Introduction:
Ischemia is caused by an arterial occlusion and results in insufficient blood flow
to a given tissue or organ. The affected area becomes hypoxic and unable to maintain
normal metabolism, and ischemia has been implicated as the primary cause of coronary
artery disease (CAD), peripheral artery disease (PAD), and cerebrovascular disease.
These diseases are highly prevalent in our society and CAD is a leading cause of
mortality in industrialized nations (Zenovich and Taylor, 2009). Current treatments for
ischemic diseases are not successful in many patients and novel areas of research are
being pursued for their therapeutic potential. Drug regimens and lifestyle changes may
slow the progression of arthrosclerosis but are not effective in patents with advanced
ischemic disease symptoms (Ouriel, 2001). Surgical options are available to remove
atheroscopic legions, bypass arterial occlusions, or introduce artificial stents, but arterial
patency rates are variable and the symptoms often return (Bosiers et al 2006).
The body possesses innate revascularization mechanisms to aid in the healing
process from an ischemic event. Angiogenesis, the de novo production of vessels from
pre-existing capillaries, is driven by hypoxia and results in the formation of new capillary
beds. Arteriogenesis, the outward remodeling of pre-exisiting arteries from arterioles, is
induced by fluid sheer stress and produces “natural bypasses” that increase blood flow to
areas downstream of occluded vessels (Hiel and Schaper, 2006). Smooth muscle cell
(SMC) proliferation has been implicated as a stimulus mechanism partially responsible
for arteriogenesis. During SMC proliferation, a change from a contractile (non-dividing)
to synthethic (dividing) phenotype in smooth muscle is observed and is a key requirement
for the remodeling event (Cai and Schaper, 2008).
Gene therapy has been investigated as a potential therapy to treat and study
ischemic disease. (Staudacher et al, 2006) (Wright, 2001) (Opie and Dib, 2004). One
method of gene delivery, known as naked DNA transfection, is a safe and inexpensive
way to supply exogenous genes to target tissues. Skeletal muscle has been shown to
efficiently take up naked plasmid DNA, and the delivery of plasmid DNA encoding
VEGF has been shown to lead to partial restoration of blood flow in a chronic hindlimb
ischemia mouse model (Roguin et al 2003, Qian et al 2006).
Vasodilation, the widening of blood vessels due to relaxation of smooth muscle
cells, together with arteriogenesis are recognized as crucial for successful blood flow
recovery after an ischemic event (Mees et al 2007). Our laboratory has recently observed
that arteriogenesis and ischemia both cause an impairment of vasodilation in resistance
arteries (unpublished). Future research on this topic will focus on elucidating what
mechanisms of arteriogenesis produce impaired vasodilation in arteries. Here we
describe the construction of enhanced green fluorescent protein (eGFP) reporter
expression vectors under control of the consitiutively active CMV promoter and muscle
specific promoters myoglobin and desmin. These vectors will be used for the
visualization of arterial smooth muscle cells in our chronic hindlimb ischemia mouse
model. Further modification of these expression plasmids will allow for muscle specific
expression of smooth muscle cell mitogens and may reveal the mechanistic connection
between arteriogenesis and vasodilation impairment.
Materials and Methods:
Plasmid construction:
Transformation of plasmids into chemically competent E. coli:
pIRES-eGFP (Invitrogen, Carlsbad, Ca.) and pCDNA3 (Invitrogen, Carlsbad,
Ca.) were generously provided by the Sander’s Lab at the University of California, San
Diego. pDRIVE-mMb and pDRIVE-mDesmin (Invivogen, San Diego, Ca.) were
purchased commercially. In downstream applications, pIRES-eGFP was only used to
amplify eGFP, whereas pCDNA3, pDRIVE-mMb and pDRIVE-mDesmin were used as
expression vectors.
All plasmids were transformed into either MACH1 One Shot or BL21 (provided
by the Black laboratory, Cal Poly, San Luis Obispo) strains of E. coli using a standard
protocol. Briefly, plasmid DNA was added to thawed competent cells with subsequent
42°C heat shot to allow DNA to penetrate cells. Cells were then allowed to recover and
plated on selection agar plates overnight at 37°C. Resultant colonies were isolated and
propagated in LB media with selective antibiotic in order to increase cell number and
plasmid DNA was isolated using Qiagen’s miniprep kit (Qiagen, blah, state). pDNA
presence was confirmed by analytical digest (see below) and pDNA concentration was
determined by spectroscopy.
Generation of restriction site flanked eGFP from pIRES-eGFP:
PCR was used to produce two eGFP cDNA products for insertion into different
expression vectors. For the first eGFP product, primers were designed to amplify eGFP
from pIRES-eGFP with 5’ BamHI and 3’ EcoRI restircition sites (known as BamHIeGFP) for insertion into BamHI/EcoRI site in pCDNA3. For the second eGFP product,
primers were designed to amplify eGFP from pIRES-eGFP with 5’ NcoI and 3’ EcoRI
restriction sites (known as NcoI-eGFP) for insertion into NcoI/EcoRI site in pDRIVE
vectors after removal of the LacZ gene. See table 1 for primer sequences (IDT
Technologies San Diego, Ca). The PCR reaction was performed under standard
thermocycling conditions using PFU DNA polymerase (Stratagene, La Jolla, Ca) to
ensure high fidelity transcriptoipn. Generation of the PCR product was confirmed by gel
electrophoresis.
Table 1:
Primer
Sequence
F: BamHI-eGFP
5’ ATCGGGATCCATGGTGAGCAAGGGCGAGGAGCT 3’
F: NcoI-eGFP
5’ ATCGCCATGGTGAGCAAGGGCGAGGAGCT 3’
R: eGFP-EcoRI
5’ ATCGGAATTCTTACTTGTACAGCTCGTCCA 3’
F: T7 promoter
5’ TTAATACGACTCACTATAGG 3’
F: Sh bl3
5’ GGACTGAGGATAAGAATTGAG 3’
Ligation of eGFP into expression vectors:
Ligation experiments were designed to ligate BamHI-eGFP into pCDNA3 and
NcoI-eGFP into both pDRIVE expression vectors. To prepare for ligation, expression
vectors were linearized by cutting with restriction enzymes. pCDNA3 was linerized
using BamHI and EcoRI whereas pDRIVE-mMb and pDRIVE-mDesmin were linearized
using NcoI and EcoRI. Vector backbones were isolated by resolving on 1% agarose gels
followed by purifcation using so and so’s gel purifcation kit. BamHI and NcoI eGFP
PCR products were cut with BamHI/NcoI and EcoRI and purified using so and so’s PCR
purifcation kit. Prepared backbones and products were combined and T4 ligase was used
for the ligation procedure (so and so state, ca). Immediately after ligation, products were
transformed onto selective agar plates and incubated at 37°C overnight.
Analysis of constructed plasmids:
Confirmation of ligation products by analytical digest and colony PCR:
To confirm successful ligation of eGFP in expression vectors, analytical digests
and colony PCR techniques were performed. For analytical digests, post-transformation
ligation colonies were isolated, propagated in selection media and mini prepped to isolate
pDNA as previously described. pDNA was cut with either BamHI/NcoI and EcoRI, and
resolved by gel electrophoresis to detect presence of eGFP in the form of a 750bp band.
For colony PCR, post-transformation colonies were picked and mixed into a PCR
reaction using a Hot Start Taq Polymerase kit (so and so state). Combinations of NcoIeGFP, BamHI-eGFP, eGFP-EcoRI, T7 promoter, and sh ble primers were used to
determine eGFP presence and orientation in plasmids (see results and discussion for
further details).
Expression of eGFP from pCDNA3-eGFP using the inducible T7 promoter:
pCDNA3-eGFP plasmids confirmed by analytical digest and colony PCR were
transformed into BL21 strain E. coli as previously described. Individual transformed
colonies were isolated and grown to mid-log phase. Cultures were induced by addition of
1mM IPTG for to allow for gene products under control of the T7 promoter to be
expressed. After exposure to IPTG for three hours, cultures were pelleted and fluorescent
microscopy was used to detect presence of eGFP expression.
Transfection of 3T3 cell line with pCDNA-eGFP to measure CMV promoter driven eGFP
expression:
To confirm eGFP presence, pIRES-eGFP and analytical digest and colony PCR
confirmed pCDNA3-eGFP expression vectors were transfected into 3T3 cell lines using
Trans-IT-3T3 Transfection Kit (Mirus, Madison, Wi). Briefly, 1 ug of plasmid DNA
incubated with liposomal transfection reagents in serum free media and delivered to
~80% confluent 3T3 cells. Cells were then imaged using fluorescent microscopy after a
40 hour post transfection.
Results:
pIRES-eGFP, pCDNA3, pDRIVE-mMb, and pDRIVE-mDesmin identification.
Plasmids obtained from the Sander’s Lab or commercially were transformed into
competent E. coli and pDNA isolated for analysis. Specific restriction enzymes were
chosen (according to the sequence maps obtained for each plasmid) to determine the
integrity of the starting material (figure 1, A-C). pDRIVE-mDesmin (1,A) and pDRIVE-
mMb (1,B) plasmids were cut with both NcoI and EcoRI, and gel electrophoresis of
analytical digests produced expected band sizes bands sizes. Similarly, pCDNA and
pIRES-eGFP, when cut with BamHI, produced expected band sizes from gel
electrophoresis.
Figure 1: Analytical digest of plasmid starting material. pDRIVE-mDesmin (1A), when
cut with NcoI and EcoRI, produced band sizes of ~3.2kB and ~2.5kB, corresponding to
the LacZ gene and vector backbone, respectively. Similarly, NcoI and EcoRI digestion
of pDRIVE-mMb (1B) yielded bands of ~3.2kB (LacZ gene) and ~1.9kB (vector
backbone). pIRES-eGFP and pCDNA (1C), when cut with BamHI showed distinct
presence of linearized pDNA. Additionally, all undigested (UD) plasmids have a distinct
smearing appearance, typical of supercoiled plasmid.
Amplification of eGFP containing unique resitriction sites for subsequent ligation into
pDRIVE and pCDNA plasmids.
In order to produce the desired eGFP reporter plasmids, eGFP had to be cloned
from pIRES-eGFP with unique resitriction sites flanking both 5 prime and 3 prime ends.
Based on plasmid map sequences, primers were designed such that eGFP could be
amplified with flanking 5’ NcoI or BamHI sites and a 3’ EcoRI restriction site (NcoI for
pDRIVE and BamHI for pCDNA3). In combination with high fidelity PFU DNA
polymerase, the designed primers produced PCR products of expected nucleic size as
determined by gel electrophoresis (~750bp, each).
Figure 2: PCR amplification of eGFP with flanking restiction sites. eGFP was
amplified with a 5’ NcoI and 3’ EcoRI restriction sites (lane 2) for ligation into pDRIVEmMb and pDRIVE-mDesmin. eGFP was also amplified with a 5’ BamHI and 3’ EcoRI
restriction sites (lane 3) for ligation into pCDNA3. A ~750bp band corresponds to the
size of eGFP cDNA combined with the corresponding restriction sites.
eGFP successfully ligated into pCDNA, pDRIVE-mMb, and pDRIVE-mDesmin with the
correct orientation as confirmed by analytical digest and colony PCR.
In order to produce the eGFP reporter constructs, expression vectors were
subjected to ligation reactions. After plasmid linearization, restriction site flanked eGFP
PCR products were inserted into the plasmid backbones using T4 ligase with subsequent
transformation into competent E. coli. To confirm successful ligation, pDNA isolated
from transformed colonies were digested with restriction enzymes corresponding to the
restriction sites flanking eGFP (figure 3A, 4A). Five pCDNA3 clones showed positive
results as seen by bands appearing around ~5.4kB and ~750bp after gel electrophoresis
(figure 3A). Similarly, pDRIVE-mMb and pDRIVE-mDesmin clones showed band
corresponding to those expected of backbone and eGFP insert sizes when digested with
NcoI and EcoRI (figure 4A).
To further confirm presence of eGFP insert in expression vectors, colony PCR
was used to amplify eGFP from transformed colonies that produced positive results by
analytical digestion. Primers complementary to regions outside the insert (pCDNA: T7,
and pDRIVE: sh ble) were used to establish orientation of eGFP. Figures 3B, C and 4B
show band sizes corresponding to those expected of correctly inserted eGFP in all
expression vectors.
***Note: According to questions during presentation, it was determined
more analysis of pDRIVE-eGFP vectors was necessary. Tommy and I will complete
this early summer 2010. ***
Figure 3: Analytical digest and colony PCR of pCDNA3 suggest eGFP insertion into
pCDNA backbone in correct orientation. Analytical digest of pCDNA clones shows
bands of ~5.4kB and ~750bp, corresponding to the vector back bone and insert,
respectively (A). When colony PCR was performed with BamHI-eGFP and eGFP-EcoRI
primers, 750bp bands were observed and suggest presence of eGFP (B). When colony
PCR was performed with a T7 promoter primer and either BamHI-eGFP or eGFP-EcoRI,
~750bp bands were only observed, indicating the correct orientation of insert in pCDNA3
(C) (see discussion).
Figure 4: Analytical digest and colony PCR of pDRIVE-mMb and pDRIVE-mDesmin
suggest eGFP insertion into expression backbone vectors in the correct orientation.
When both pDRIVE vectors were digested with NcoI and EcoRI, band were observed
(mDesmin: ~2.5kb, ~750bp, mMb: ~1.9kB, ~750bp) that were expected sizes of vector
backbone and insert A). Colony PCR with a primer outside of the vector insert, namely
sh bl3, and eGFP-EcoRI, amplified a region of DNA approximately ~750bp, indicating
eGFP was correctly inserted into both pDRIVE backbones (B) (see discussion).
In vitro eGFP expression from pCDNA3-eGFP was observed in 3T3 transfection but not
via induction of transformed BL21 E.coli:
To confirm our data suggesting that eGFP was correctly ligated into expression
vectors, pCDNA3-eGFP was transfected into 3T3 cells or transformed into competent
BL21 E. coli to measure in vitro expression of eGFP. After pCDNA3-eGFP transfection
in 3T3 cells, highly visible eGFP expression was observed in the nucleus and cytoplasm,
and was comparable to eGFP expression observed in pIRES-eGFP positive control cells
(figure 5). Additionally eGFP transfected 3T3 cells had normal fibroblastic morphology
when compared to un-transfected control cells. Surprisingly, eGFP expression was not
observed in pCDNA3-eGFP transformed BL21 upon induction with IPTG (data not
shown). Troubleshooting of failed induction experiments revealed that sequence specific
elements required for prokaryotic expression of proteins were absent from pCDNA3eGFP and will be discussed below.
Figure 5: Expression of pCDNA3-eGFP and positive control pIRES-eGFP after
transient transfection into 3T3 cells. Fluorescent microscopy revealed green fluorescence
located in cells when bright field and GFP channels were merged.
Discussion:
Here we describe the construction of eGFP reporter plasmids under control of
consitutively active or muscle specific promoters (Figure 6). After eGFP and
pCDNA3/pDRIVE vector ligation, analytical digest of transformed colonies provided
evidence that eGFP was inserted into the plasmid. For all plasmids, restriction digest
with the appropriate restriction enzymes yielded DNA band sizes expected of plasmid
backbone and eGFP insert (pCDNA3, figure 3A, pDRIVE, figure 4A). This shows that
the ligation was successful in connecting backbone and insert, but does not prove insert
was ligated in the correct orientation.
Colony PCR of post-ligated E.coli colonies revealed that eGFP inserts were
ligated into pCDAN3/pDRIVE vectors in correct orientation. For each plasmid, a
forward primer was designed on the backbone of the vector (pCDNA3- T7, pDRIVE- sl
ble) and paired with the reverse primer eGFP-EcoRI used to produce the eGFP insert. In
all plasmids, colony PCR resulted in product amplification of correct band sizes (figure
3B, 4B). If the inserted had been inserted in a flipped orientation, the PCR primers
would have been in the same direction and no amplification would have occurred.
Indeed, when colony PCR was performed on pCDNA3 with forward BamHI-eGFP and
T7 primers no amplication was observed (figure 3B). In this case, if the insert had been
inserted in the incorrect orientation, the primers would have been in opposite directions
and amplification would occur.
Figure 6: Schematic diagrams of constructed expression vectors pCDNA-eGFP (A),
pDRIVE-mMb-eGFP (B), and pDRIVE-mDesmin-eGFP (C). Numbers correspond to
nucleotide location of plasmid features of interest. Directional arrows correspond to
designed primer locations (horizontal) or restriction sites (vertical). Multiple cloning
sites (not shown) are located between promoters and eGFP and can be manipulated to
insert genes of interest upstream of the eGFP reporter gene.
As a final confirmation of successful eGFP cloning into vectors, pCDNA3-eGFP
was transfected into the mammalian cell line 3T3 to measure expression in vitro. When
compared to untransduced controls, pCDNA-eGFP cells showed positive green
expression typical of eGFP presence. Additionally, fluorescence from pCDNA-eGFP
was similar to that of transfected pIRES2-eGFP 3T3 cells. This positive control is
important because pIRES-eGFP was the source of eGFP for PCR amplification. It is
interesting to note that in vitro expression from pCDAN3-eGFP was observed for
transfection experiments but not after induction in competent E. coli. This can be
attributed to pCDAN3-eGFP missing critical features necessary for prokaryotic
expression. Although pCDNA3-eGFP contains a T7 promoter, allowing transcription of
eGFP after IPTG induction, it lacks a ribosomal binding sequence such as a Shine
Dalgarno sequence, which is necessary for initial ribosomal binding onto bacterial
messenger RNA. Therefore, we propose that in failed induction experiments eGFP
transcripts were produced but lacked the ability to be translated.
Exogenous delivery of the constructs to skeletal muscle will provide our
laboratory with a novel way to observe muscle architecture in situ in a chronic hindlimb
ischemic mouse model. Moreover, it can potentially be used to target therapeutic genes to
smooth muscle cells upon subsequent modification of vectors. For instance, introducing
a smooth muscle cell mitogen such as platelet-derived growth factor (PDGF) into skeletal
muscle will reveal if vascular smooth muscle cell proliferation is responsible for impaired
vasodilation in arteries. Naked DNA transfection of arteriogenic stimuli makes it
possible to elucidate the mechanisms of arteriogenesis that cause impairment in arterial
vasodilation. The systematic introduction of isolated arteriogenic mechanisms will reduce
variability and lead to a better understanding into what aspect of arteriogenesis produces
the poor vasodilatory response.
Acknowledgements:
I would first like to thank Tommy Harper for working closely on this project with me. I
learned a number of molecular biology techniques from him and approximately half of
the work on this project was by him. I would especially like to thank Dr. Michael Black
for advising me on the project and allowing me to work in his laboratory. Thank you
Tim Tapscott for troubleshooting advice and reagents, and Ashley Russell for assistance
in fluorescence microscopy imaging. Finally, I am very grateful for Dr. Trevor
Cardinal’s mentorship during my time in Cal Poly’s MS Specialization in Stem Cell
Research program. This research was funded through grants provided by the CIRM
Bridges to Stem Cell Research program.
References:
Boisers M, Deloose K, Verbist J, Peeters P. Clinical application of the Xpert stent.
Endovascular Today 5: 24-26, 2006.
Cai W and Schaper W. Mechanisms of arteriogenesis. Acta Biochim Biophys Sin 40:681692, 2008.
Heil M, Eitenmuller I, Schmitz-Rixen T, Schaper W. Arteriogenesis versus
angiogenesis: similarities and differences. J. Cell. Mol. Med. 10(1):45-55, 2006.
Mees B, Wagner S, Ninci E, Tribulova S, Martin S, van Haperen R, Kostin S, Heil M, de
Crom R, Schaper W. Endothelial nitic oxide synthase activity is essential for
vasodilation during blood flow recovery but not for arteriogenesis. Arterioscler Thromb
Vasc Biol 27(9)(:1926-33, 2007.
Opie SR and Dib N. Local endovascular delivery, gene therapy, and cell transplantation
for peripheral arterial disease. J Endovasc Ther 11:151-162, 2004.
Ouriel K. Peripheral artery disease. The Lancet 358: 1257-1264, 2001.
Qian HS, Liu P, Huw L-Y, Halks-Miller M, Hill SM, Jin F, Kretschmer P, Blasko E,
Cashion L, Szymanski P, Vergona R, Harkins R, Yu J, Sessa WC, Dole WP, Rubanyi
GM. Effective treatment of vascular endothelial growth factor refractory hindlimb
ischemia by a mutant endothelial nitric oxide synthase gene. Gene Therapy 13:13421350, 2006.
Roguin A, Avivi A, Nitecki S, Rubinstein I, Levy NS, Abassi ZA, Resnick MB, Lache O,
Melamed-Frank M, Joel A, Hoffman A, Nevo E, Levy AP. Resoration of blood flow by
using continuous perimuscular infiltration of plasmid DNA encoding subterranean mole
rat Spalax ehrenbergi VEGF. PNAS 100(8):4644-4648, 2003.
Staudacher DL, Preis M, Lewis BS, Grossman PM, Flugelman MY. Cellular and
molecular therapeutic modalities for arterial obstructive syndromes. Pharmacology &
Therapeutics 109:263-273, 2006.
Wright CE. Effects of vascular endothelial growth factor (VEGF)A and VEGFB gene
transfer on vascular reserve in a conscious rabbit hindlimb ischaemia model. Clinical
and Experimental Pharmacology and Physiology 29:1035-1039, 2002.
Zenovich AG and Taylor DA. Atherosclerosis as a disease of failed endogenous repair.
Front Biosci 13: 3621-3636, 2009.