Download Transgenic Tobacco Plants with Bacillus thuringiensis 8

Mol. Cells, Vol. 4, pp. 211-219
Transgenic Tobacco Plants with Bacillus thuringiensis 8-endotoxin
Gene Re~istant to Korean-born Tobacco Budworms
Mi Chung Suh, Choo Bong Hong*, Sang Seock Kim I and W oong Seop Sim2
Institute for Molecular Biology and Genetics, Seoul National University, Seoul 151-742, Korea;
'Special Research Division, Korea Ginseng and Tobacco Research Institute, Taejon 305-606, Korea;
2Department of Biology, Korea University, Seoul 136-701, Korea
(Received on April 21 , 1994)
Insecticidal protein genes, crylA(b) and crylA(c), of Bacillus thuringiensis subsp. leurstaki HD1 and HD-73 were expressed in tobacco plants. Two fuD-lengths and four 3' -portion truncated
toxin genes were respectively inserted into a binary vector, pBKSl-l. These six recombinant
plasmids amplified in Escherichia coli were introduced into Agrobacterium tumefaciens by direct
gene transfer method. After tobacco leaf disks were cocultivated with Agrobacterium carrying
these toxin genes, whole plants were regenerated from the transfonned leaf disks, and the
regenerated transgenic plants (1'.) were either self-pollinated or backcrossed. The seeds obtained
were genninated on MS media containing kanamycin (300 mg/I) and the inheritance of kanamycin- resistant gene introduced to progenies (1'2) was confinned and foDowed Mendelian fashion.
peR and Southern blot analyses showed that crylA(b) and crylA(c) toxin genes were stably
integrated in the nuclear genomes of the transgenic tobacco plants and inherited to the next
generation. Northern blot analysis for the transcripts of neomycin phosphotransferase IT gene
confinned that the introduced foreign gene was expressed in the transgenic tobacco plants.
Most of the T. and T2 transgenic tobacco plants showed resistance to lepidopteran insects,
tobacco budworms (Heliothis assulta) isolated and maintained in Korea, and the weight increase
of larvae feeding on them was inhibited.
In order to control insect damage to crops many
kinds of insecticides have been extensively used in
modern agriculture. Most of them were chemically synthesized and then have resulted in serious environmental and health problems. Notable exceptions were
the insecticidal proteins produced by Bacillus thuringiensis, which have been shown to be harmless against
humans, other vertebrates and beneficial insects. In
addition, degradability of the toxin proteins is thought
to be desirable to minimize pollution. Their commercial use, however, is limited due to high production
costs and instability of crystal proteins when exposed
in the field (Dulmage, 1981).
The Gram-positive bacterium B. thuringiensis produces crystalline insecticidal proteins called 8-endotoxins
during sporulation (Aronson et ai., 1986; Whiteley and
Schnepf, 1986). Delta-endotoxins produced by different
B. thuringiensis strains may exhibit highly specific insecticidal activities. Most of them are active against lepidopteran larvae but some show toxicity against dipteran or coleopteran larvae (Goldberg and Margalit,
1977; Krieg et al., 1983; Hofte and Whiteley, 1989).
Most 8-endotoxins are protoxins, which are proteolytically activated in the insect midgut to smaller toxins
(Lilley et al., 1980; Schnepf and Whiteley, 1985). The
smaller toxins bind to the insect midgut epithelial cell
membranes and open the cation selective channels
which leads to osmotic imbalance and cell lysis (Hofmann et ai., 1988; Slatin et ai., 1990; English et al.,
1991; English and Slatin, 1992).
Among insecticidal protein genes, lepidopteran specific genes, cryJA class, are mostly well characterized
(Adang et al., 1985; Thorne et al., 1986; Schnepf et
ai., 1985; Geiser et al., 1986; Oeda et al., 1987; Shibano
et al., 1985; Kronstad and Whiteley, 1986; Schnepf et
ai., 1990; Suh et al., 1992). Genes of these insecticidal
proteins are attractive candidates for the genetic modification of. crops to be protected from insect attack
B. thuringiensis 8-endotoxins were expressed in tobacco,
tomato and cotton, and the transgenic plants showed
resistance to lepidopteran or coleopteran insects (Fischhoff et ai., 1987; Barton et ai., 1987; Vaeck et al.,
1987; Perlak et al., 1990; Cho et ai., 1992).
We introduced B. thuringiensis subsp. kurstaki toxin
genes, cryJA(b) and crylA(c), into tobacco plants using
an Agrobactenum mediated T-DNA transfer system to
engineer tobacco plants resistant to Korean-born tobacco budworms (H assulta).
* To whom correspondence should be addressed.
Plant and bacteria
Materials and Methods
©
1994 The Korean Society for Molecular Biology
Mol. Cells
Insect Resistant Transgenic Tobacco Plants
212
Nicotiana tabacum L. cv. Wisconsin 38 was used as
a plant material for transformation. E. coli strain HB
10 I and A. tumefaciens strain LBA4404 were used for
gene manipulation and to transform tobacco, respectively.
Insects
Heliothis assulta (tobacco budworm) was obtained
from the Special Research Division, Korea Ginseng
and Tobacco Research Institute.
Preparation of plasmid DNA and traniformation
Plasmid DNA was isolated from E. coli and A. tume/aciens by an alkaline lysis method as described
by Sambrook et al. (1989). Restriction enzyme digestions, dephosphorylation of the linearized vectors and
ligation were carried out according to the method of
Sambrook et al. (1989) and manufacturers' instructions
(KOSCO, Korea; Promega, U.SA). DNA was run on
an agarose gel with ethidium bromide (0.1 llg/mJ), and
elution of particular DNA fragments from the gel was
performed with a gel eluter (Hoefer Scientific InstruB. thuringiensis subsp.
kurstaki HD-l and HD-73
insecticidal toxin gene
clones; pBTbI', pBTb2',
pBTb3', pBTc1', pBTc2', and
pBTc3' (Suh et al., 1992)
ments, U.SA). Transformation of recombinant plasmid DNAs into E. coli was done by a CaCh treatment
method (Sambrook et aI., 1989). The recombinant plasmid DNAs amplified in E. coli were transferred into
A. tumefaciens by a direct DNA uptake method (An,
1987).
Plant traniformation
Transformation of tobacco plants was carried out
as described by Horsch et al. (1985). Surface sterilized
young leaves were cut to 0.5 cm2 and cocultivated with
A. tumefaciens carrying the recombinant DNA in the
liquid MS medium (Murashige and Skoog, 1962). After cocultivation for 2 days, leaf disks were washed
for several times with MS medium and placed on
a selectable MS medium supplemented with 2 mgll
of a-naphtalene acetic acid, 0.5 mg/1 6-benzyJ aminopurine, 250 mg/1 kanamycin, and 250 mg/1 carbenicillin (Fig. 1).
Plant regeneration and seed germination
Kanamycin resistant calli were induced from the
Oligonucleotide contammg
repeated translational termination
codons and BamHI and BglII
restriction enzyme sites
at both ends
A binary vector, pBKS-I
used for Agrobactenum
mediated plant transfomation system (Song and
Hong, 1991)
1
1
Bam HI digestion
t
Kinasing
Dephosphorylation
I
BamHI digestion
I
Ligation
,!.
Construction of a binary vector, pBKSI-I
,!.
Bam HI digestion
~
Elution of va rious toxin
gene fragments
Dephosphorylation
I
L I_ _ _ _ _ _ _ _ _ __ _ _ __ _ _ _ _ _, -_ __ _ _ _ _ _ _ _ _ _ _ _~.
~
Ligation
,!.
Transformation into E. coli strain HBIOI
~
Transformation into A. tumifaciens strain LBA4404
,!.
Cocultivation with tobacco leaf disks for 2-3 days at 25 °C
~
Washing the tobacco leaf disks with MS medium
,!.
Incubation of the tobacco leaf disks on callus
and shoot induction media with kanamycin (250 mg/!)
and carbenicillin (250 mgll)
Figure 1. Scheme for the engineering of insect-resistant tobacco plants by using B. thurigiensis subsp. kurstaki HD-l and HD-73
insecticidal toxin genes.
Vol. 4 (1994)
Mi Chung Suh et at.
cutting edges of the transformed leaf disks and induction of shoot was done on the selectable MS medium
without NAA. Rooting was carried out in the selectable MS medium without any additional hormones,
and the plantlets were moved to soil in a green house.
The fully grown transgenic plants were either self-pollinated or backcrossed. The seeds were aseptically germinated on MS medium containing 300 mgll of kanamycin, and then kanamycin resistant and sensitive
seedlings were counted. Kanamycin resistant seedlings
were moved to soil and maintained in a green house.
Polymerase chain reaction
Chromosomal DNA was isolated from the leaves
of T J and T2 generation transgenic plants as described
by Dellaporta et af. (1984). PCR was performed with
1 f.1g total leaf DNA, 100 ng of each primer (5'TTCAAAGCAAGTGGATTGAT3' and 5'ATCTGTATAGTTGCCAATAA3'), 200 f.1M of each deoxynucleoside
triphosphate (dATP, dCTP, dGTP and dTTP), 50 mM
KCI, 10 mM Tris, pH 8.3, l.5 mM MgCb, 0.001 % gelatin and 4 units of Taq DNA polymerase (AmpliTag™
DNA polymerase, Perkin Elmer Cetus, USA) in a
total volume of 100 fll. The reaction mixtures were
covered with mineral oil and placed in a thermal cycler (Perkin Elmer Cetus). Temperature was cycled at
95°C for 1 min (denaturation), then at 48°e for I min
e for 1 min (extension)
(annealing), and then at n O
for a total of 40 cycles. PCR products were run on
an 1% agarose gel.
Southern hybridization
Extracted genomic DNA was digested with BamHI
or EcoRI, electrophoresed on a 0.6% agarose gel in
the presence of ethidium bromide (0.1 f.1g1ml) and blotted onto Nytran membrane (Schleicher & Schuell,
U.SA). The toxin gene probe was labeled with 32p_
dATP using Prime-a-Gene system (promega, USA).
The ftlter was prehybridized and hybridized in the
condition of a 50% of formamide and 5 X SSPE at
37°e and washed in 0.1 X SSPE and 0.1 X SDS at
the same temperature. The membrane was exposed
to X-ray ftlm (Kodak, USA) with two intensifying
o
screens (Dupont, USA) at - 70 e.
Northern hybridization
Total RNA was prepared as described by Hong and
Jeon (1987). Isolation of poly(A +) RNA and northern
hybridization were carried out as described by Sambrook et af. (1989). After isolation of poly(A +) RNA
using oligo(dT)-cellulose resin (Pharmacia, USA), approximately 20 f.1g of poly(A +) RNA was electrophoresed on an agarose gel containing 17.5% formaldehyde
and blotted on to Nytran membrane. The rbcS, nptII
and toxin genes were labeled with 32p_UTP using Riboprobe Gemini II Core system (Promega). Prehybridization, hybridization and washing conditions were
identical to those of Southern hybridization.
213
Western blot analysis
Total protein was extracted from the transgenic tobacco leaves in 50 roM Tris · HCI, pH 7.5, I mM
EDTA, 8 roM MgCb and 1% ~-mercaptoethanol and
run on an 8% SDS-polyacrylamide gel according to
Laemmli (1970). For immunological analysis, the electrophoresed proteins were blotted onto nitrocellulose
membrane as described by Towbin et af. (1979). The
membrane was hybridized with a polyclonal antibody
for the toxin protein of B. thuringiensis subsp. kurstaki
HD-73 in sporulation, a generous gift from the Biocontrol Lab., Genetic Engineering Research Institute,
and the goat anti-rabbit IgG antibody conjugated with
alkaline phosphatase (Sigma Chemical Co., USA) as
a secondary antibody. Bands were visualized in 0.1
M Tris· HCl, pH 9.5, 0.1 M NaCl, 50 mM MgCb containing 5-bromo-4-chloro-3-indolyl phosphate (0.15
mglml) and nitro blue tetrazolium (OJ mglml) for 15
min. Enzyme reaction was stopped by adding 20 mM
Tris· HCI, pH 8.0, and 5 mM EDTA.
Insect bioassay
Ten neonate tobacco budworm (H assulta) larvae
were placed in a Petri-dish containing the leaves of
T J transgenic or non transgenic tobacco plants. After
feeding on the leaves at 28 °e for 7 days, average
weights of tobacco budworm larvae and protection levels of transgenic plants from insect attack were measured. Protection levels were decided by comparing
leaf areas consumed by larvae. In T2 transgenic plants,
two leaves from each plant were individually wrapped
with two layers of gauze and ten third-instar larvae
per leaf were placed. The results were measured after
3 days for the average weights of larvae and protection
levels of transgenic plants. The experiments were repeated three times.
Results
Full-length and 3'-portion truncated B. thuringiensis
toxin genes, cryJA(b) ,and cryJA(c), were previously cloned and expressed in E. coli (Suh et af., 1992). Also,
a binary vector, pBKS1-1, was constructed by addition
of the repeated translation termination codons, TAG,
to a binary vector, pBKSl (Song and Hong, 1991).
Toxin gene fragments were isolated from the six recombinant clones (Suh et al., 1992) using the flanking
BamHI sites. Each fragment was inserted into a
Bam HI site between the CaMV 35S promoter and the
terminator of a nopaline synthase gene in ·pBKSI -l.
The six recombinant plasmids with each of the toxin
gene fragments were named pBKS1-1/BTb1', pBKSllIBTb2', pBKSl-l/BTb3', pBKSl -lIBTcl', pBKSl -l/
BTc2' and pBKSI -lIBTc3' (Fig. 2).
The recombinant plasmids were moved to A. tumejaciens and tobacco leaf disks were cocultivated with
Agrobacterium carrying the toxin genes in pBKSI-l.
Transformed calli were induced from the cutting edges
Insect Resistant Transgenic Tobacco Plants
214
N
I
~~
I
p BKSI -I /BTbl'
700bp
I
I
B HiP"
HIS K
II
I
B HiP"
K
I
"
X
HO
II
I
I
X7'tC
r
II'
B
! I
i
I
I
I
I
Tox i n
,Me
~=MCTTACTTAro
ia.JlI ___ _ _
---
p BKSl-l/BTb2'
"
-8H~P
'-
:
"
I I
pBKSl-l/BTb3'
I
I
I
HO
I
" HlP'
I! ,E
B HiP'
I
! I
I
I
Ip
Mol. Cells
i
-"
II
pBKSI-I /BTCl'
I
I
I
I
i
p BKSI-I/BTc2 '
I
I
I
i
pBKSi-l/BTc3 '
I
I
I
I
I
I
I
I
--------s.""r
_"" agffl "/B..RI "
Figure 2. Restriction enzyme maps of a binary vector, pBKS
1-1, containing the toxin genes, eryJA(b) and eryJA(e). Thick
lines are for the toxin coding sequences. B, Bam HI; 0 , Ndel;
E, EeoRI; H, Hincll; HD, Hindill; K, Kpnl; N, Nrul; P,
PvuII; Pt, PstI; S, Seal; X, Xhol; LB, T-DNA left border;
RB, T-DNA right border; NPTII, neomycin phosphotransferase gene II; Pnos, nopaline synthase promoter; Tnos, nopaline synthase terminator; P35S, cauliflower mosaic virus 35S
promoter. ' . ' indicates the restriction enzyme sites removed,
'-' indicates 0.7 kb DNA fragment for Southern probes
and '---' indicates 1.7 kb DNA fragment for NPTII probes.
ATG is the translation initiation codon of the toxin genes
and TAG is the translation termination codon.
of tobacco leaf disks and regenerated in vitro. More
than 90% of the transgenic tobacco plants with the
six different toxin genes were normal in morphology
and growth rate. Each type of the transgenic plants
was either self-pollinated or backcrosseci, and the
seeds were germinated on the medium containing kanamycin, 300 mglrnl (Fig. 3).
Genomic DNA was isolated from young leaves of
the morphologically normal, putative transgenic plants. From peR analyses of genomic DNA, amplified
0.7 kb DNA bands were observed (Fig. 4), which indicate stable integrations of cryJA(b) and cryJA(c) genes
in the nuclear genomes of the transformed tobacco
Figure 3. Regeneration of tobacco plants after transformation. (A) Agrobacterium cocultivated leaf explants; (B) calli
forming from the cutting edge of leaf disk; (C) shoot formation from callus; (D) regenerated transgenic tobacco plants;
(E) flowering of a transgenic plant; (F) the seedlings showing
either the kanamycin sensitivity or resistance.
plants. T, transgenic tobacco plants with positive pe R
signals were used in the bioassay afterwards. Genomic
DNAs from T, transgenic tobacco plants were further
checked with the 32P-labeled 0.7 kb EcoRl fragment
of each toxin gene. The Southern bands shown at
0.7 kb from the EcoRl digested genomic DNA again
confirmed that toxin gene segments were integrated
in the nuclear genomes of transgenic tobacco plants
(Fig. 5).
Northern hybridizations for the poly(A +) RNA from
the transgenic tobacco plants with the 32P-labeled NPTn (neomycin phosphotransferase IT) gene showed
specific northern bands for the NPTII gene transcript
at 1.3 kb, which indicate active transcription of the
introduced gene in transgenic tobacco plants (Fig. 6).
Bioassay of the T, transgenic tobacco plants against
tobacco budworms showed that most transgenic plants
reduced larval feeding levels and growth rates compared to nontransgenic plants. Among the 30 transgenic
plants with cryJA(b) gene tested, ten plants resulted
in average weight loss of larvae to more than 40%.
In six plants, the average weights of larvae were reduced to 10-40%, and in fourteen plants, larval growth
Mi Chung Suh et al.
Vol. 4 (1994)
215
(A)
(A)
5' rrCAAAGCAAGI'GGAITG~T3'
-;3~- I---~;;N ~
5
6
7
TNOO
(B)
1 2 3 4 5 6 7 8 9 10111213
<:=>1.2 kb
(8)
<?700bp
2
Figure 4. PCR analysis for the cryJA(b) and cryJA(c) toxin
genes from the transgenic tobacco plants. (A) primers used
in PCR; (B) 1, BRL's 1 kb DNA ladder; 2 and 8, nontransgenic plants; 3-7, transgenic plants with the cryJA(b) toxin
genes; 9-13, transgenic plants with the cryJA(c) toxin genes.
(A)
3
4
5
6
7
¢::> 1.3kb
(8)
Figure 5. Genomic Southern blot analyses for the cryJA(b)
and cryJA(c) toxin genes from TI transgenic tobacco plants.
Chromosomal DNA was EcoRI restriction digested, run on
a 0.7% agarose gel, blotted onto Nytran membrane and hybridized with 32P-Iabelled 0.7 kb EcoRI DNA fragment of the
toxin gene. 1, BRL's 1 kb ladder; 2, EcoRI digestion of pBKS
1-1 carrying the toxin gene; 3, EcoRI digestion of genomic
DNA from tobacco plants transformed with bacterial ~-glu ­
curonidase gene; (A) 4-10, EcoRI digestions of genomic
DNAs from the tobacco plants transformed with the cryJA(b)
genes; (B) 4-10, EcoRI digestions of genomic DNAs from
the tobacco plants transformed with the cryJA(c) genes; Southern bands at 0.7 kb were from the introduced toxin genes.
Figure 6. Northern blot analyses for the RNA isolated from
TI transgenic tobacco plants. (A) Northern bands indicate
the position for the ribulose-I, 5-biphosphate carboxylase
and oxygenase gene transcripts as a positive control. (B) Northern bands indicate the position for the neomycin phosphotransferase II gene transcripts at 1.3 kb. The RNAs in
pannel(A) were loaded with the same amount as in (B).
1, nontransgenic plant; 2, pBKSl-i/BThI' transformed plant;
3, pBKSI-l/ BTb2' transformed plant; 4, pBKSI-IIBTb3'
transformed plant; 5, pBKSI-i/ BTcl' transformed plant; 6,
pBKSI-IIBTc2' transformed plant; 7, pBKSI-IIBTc3' transformed plant
inhibitions were less than lO%. Among the 28 transformed tobacco plants with cry/A(c) tested, seven plants
resulted in average weight loss of larvae to more than
40%. In eight plants, the average weights of larvae
were reduced to 10-40%, and in thirteen plants, larval
growth inhibition was less than 10% (Fig. 7A, Table
1). When the resistances of transgenic tobacco plants
with the full-length or truncated toxin genes against
tobacco budworms were compared, no significant difference was observed (fable 1).
To investigate whether cry/A(b) and cry/A(c) toxin
Mol. Cells
Insect Resistant Transgenic Tobacco Plants
216
(6)
(A)
Figure 7. Protection of the TI and T2 transgenic tobacco plants from the H assulta (tobacco budworm). Ten neonate laIVae
fed on the leaves from the TI transgenic and nontransgenic plants for 7 days (A), and ten third instar laIVae fed on
the leaves from the T2 transgenic and non transgenic plants for 3 days (B). N, leaves from nontransformed tobacco plants;
T-bI7, a leaf from the tobacco plant transformed with cryJA(b) gene; T-c18, a leaf from the tobacco plant transformed
with cryJA(c) gene; T-b013, the T2 transgenic tobacco plant transformed with cryJA(b) gene; T -cOli , the T2 transgenic tobacco
plant transformed with cryJA(c) gene. T-b013 is the T2 generation of T-b17, and T -cOli is the T2 generation of T -c18.
genes were stably inherIted to the next generation or
not, T2 generation transgenic plants also analyzed.
Transgenic plants were either self-pollinated or backcfOssed, and the seeds obtained were germinated on
the MS medum containing kanamycin (300 mg/l).
Mendelian pattern of segregation for the kanamycin
resistance, 3: 1 or 15: 1 (data not shown), indicated
that NPTII gene was stably inherited by the progenies.
Among the Tl generation trasgenic plants, ones showing the highest insect resistance in each group were
selected for further analyses in T2 generation. Southern
analyses of T2 generation plants after BamHI digestion
of the genomic DNAs and hybridization with the toxin gene probes showed specific bands at about 4.0
kb for BTbl', 3.3 kb for BTb2', 2.4 kb DNA for BTb3',
3.6 kb for BTc1', 3.3 kb for BTc2' and 2.4 kb for
BTc3' (Fig. 8). The results confirmed that the full length or truncated cryJA(b) and cryJA(c) toxin genes in
the nuclear genome of the transgenic plants were stably inherited by the next generation. In insect bioassay
of T2 plants, average weights of larvae fed on the T2
transgenic plants were reduced to about 51% for BTbI
" 30% for BTb2', 4()01o for BTb3', 45% for BTc1', 34%
for BTc2', and 45% for BTc3' (Fig. 7B, Table 2). Again,
the differences observed from each toxin gene were
not found to be statistically significant.
Discussion
About one hundred twenty transgenic tobacco pla-
Mi Chung Suh et al.
Vol. 4 (1994)
217
(A)
123456789
(8)
1234567
8
'¢:J 3.6 kbp
¢:o 3 .3 kbp
¢:J 2.4 kbp
Figure 8. Southern blot analyses for the cry/A(b) and cry/A(c) toxin genes from the transgenic tobacco plants in T2·generation.
DNAs were BarnHI restiction digested, run on a 0.6% agarose gel, blotted onto Nytran membranes and hybridized with
32P-Iabeled RNA probes of the toxin genes. I, BRL's I kb DNA ladder; (A) 2, Pvull digestion of pGEM-I carrying the
BTb2' toxin gene; 3, Barn HI digestion of genomic DNA from nontrltllsgenic tobacco plants; 4 and 5, BarnHI digestions
of genomic DNAs from the tobacco plants transformed with the pBKSt-I/BTbl'; 6 and 7, BarnHI digestions of genomic
DNAs from the tobacco plants transformed with the pBKSI-I/BTb2'; 8 and 9, Barn HI digestions of genomic DNAs from
the tobacco plants transformed with the pBKSI-I/BTb3'; (B) 2, Pvull digestion of pGEM-I carrying the BTc2' toxin gene;
3, BarnHI digestion of genomic DNA from nontransgenic tobacco plants; 4 and 5, BarnHI digestions of genomic DNAs
from the tobacco plants transformed with the pBKSI-I/BTcl'; 6 and 7, BarnHI digestions of genomic DNAs from the
tobacco plants transformed with the pBKSI-I/BTc2'; 8, BarnHI digestion of genomic DNA from the tobacco plants transformed with the pBKSI-I/BTc3'.
nts transformed with the six types of B. thuringiensis
subsp. kurstaki cryJA(b) and cryJA(c) genes were grown
in a green house. Most of the transgenic plants developed normally and bore seeds. It was previously suggested that expression of the full-length toxin gene
in tobacco plants exhibited toxicity to the plant cells,
and no fully grown healthy transgenic plants could
be obtained (Barton et aI., 1987; Fischhoff et aI., 1987).
The results of our experiment were different from
theirs in that tobacco plants introduced with the fulllength cryJA(b) and cryJA(c) genes developed normally,
and no difference was noted in morphology vigor of
growth from other tobacco plants. In northern blot
analysis, we were not able to reliably detect toxin gene
transcripts, i.e. the signals were barely identifiable only
from some cases with the truncated toxin genes (data
not shown), although northern bands for the NPTII
gene were readily identified (Fig. 6). Our transgenic
tobacco plants with full-length toxin genes might have
lower expression levels of the toxin genes which would
be below the threshold level to inhibit normal growth
of plants. The extremely low level expression of toxin
gene transcripts in transgenic plants was also reported
previously (Murray et aI., 1991 ; Adang et al., 1993).
Table 1. Bioassay for the insect-resistance of the transgenic
tobacco plants. Ten neonate tobacco budworm larvae fed
on the leaves from the transgenic and non transgenic tobacco
plants for 7 days. Assays were performed three times. + + +,
more than 40"10 of the insect-$T0wth was inhibited; + +, 1040% of the insect-growth was inhibited; +, less than 10%
of the insect-growth was inhibited. Data were represented
in the number of plants showing the degree of growth-inhibition/total number of plants tested.
Toxin genes
Degree . introduced BThI' BTb2' BTh3' BTcl' BTc2' BTc3'
of the Insect
growth inhibited
++ +
++
+
4/103/103 / 10 2/103 / 82 / 10
1/10 3/10 2 / 10 4 /10 1/ 8 3 /10
5 /1 0 4/10 5 /10 4 /1 0 4 /8 5 /10
Western blot analyses for the insecticidal toxins in
the transgenic tobacco plants were again not successful, probably due to the very low concentration of
toxin proteins in the plant cells. The level-up expressions of the cryJA(b) or cryJA(c) gene in tobacco or
Mol. Cells
Insect Resistant Transgenic Tobacco Plants
218
Table 2. Bioassay for the insect-resistance of the T2 transgenic tobacco plants. Ten third-instar larvae fed on the leaf from
the T2 transgenic and nontransgenic plants for ' 3 days. Assays were performed three times.
Tested plants
Nontransgenic plants
BTbl' a
BTb2' a
BTb3' a
BTc1' a
BTc2' a
BTc3' a
Number of tested
larvae
Total larval
weight± S.D. (mg)
Average larval
weight± S.D. (mg)
60
60
60
60
60
60
60
2819± 23
1363± 32
1962± 16
l701± 28
1551± 22
1846± 18
1549± 30
47± OJ8
23± 0.53
33± 0.27
28± 0.47
26± OJ7
31± OJO
26± 0.50
% of weight
reduction
51
30
40
45
34
45
aTransgenic plants transformed with the indicated toxin genes. S.D., standard deviation.
tomato plants were achieved by modifYing genetic codons of the toxin genes based on their presumptive
roles as potential regulatory sequences, predicted
rnRNA secondary structure and frequency of codon
usage in plants. Immunological analysis and bioassay
data of these studies with the modified genes indicated
at least a lOO-fold increase in the expression level of
the genes in plants (perlak et al., 1990; Perlak et al.,
1991; Fujimoto et al., 1993). Although the molecular
mechanism to explain this low level expression of the
toxin gene still needs to be worked out, the model
suggesting instability and poor translation of the toxin
gene transcripts in plants seems to be persuasive.
The bioassay results of transgenic tobacco plants
showed the efficiency of insecticidal proteins against
neonate or third instar tobacco budworm larvae. Although western blot analyses did not detect the toxin
proteins, the transgenic plant clearly demonstrated its
protection ability by discouraging insect feeding. On
the average, the weight increase of larvae on the transgenic plants was reduced by more than 30% (Tables
1 and 2). The level of protection was more apparent
when the leaf area consumed by the insects was compared. The leaf areas consumed were at least 4 times
less in transgenic plants (Fig. 7).
Transgenic plants with the 3' portion-deleted toxin
genes showed as strong a resistance as the transgenic
plants with the full length toxin genes (Tables 1 and
2). These results indicate the potent domain in the
5' half of the gene. Another possibility still needs to
be pointed out. Transcript levels for each type of toxin
genes could not be compared due to the minimal levels of expression in transgenic plants. Still the borderline results (data not shown) suggested an even lower
expression for the full length toxin gene. In that case,
lower expressions of the full length toxin genes would
mask the higher potencies of the longer genes (Suh
et al., 1992).
When transgenic plants expressing B. thuringiensis
toxin genes were tested for various lepidopteran insects, different levels of sensitivities were identified
among the insects. Manduca sexta (tobacco hornworm)
and Trichopulsia ni (cabbage looper) are more sensitive,
and Heliothis virescense (tobacco budworm), Spodoptera
exigua (beet armyworm), Heliothis zea (cotton bollworm), Helicoverpa zea and Ostrinia nubilalis (European
com borer) are more resistant to Cry toxins (perlak
et al., 1990; Koziel et al., 1993; Warren et aI., 1992;
Jenkins et al., 1993; Benedict et al., 1993). The mechanism to explain the relative activities of B. thuringiensis
toxins to various insects is very fragmental at present.
All of the insecticidal proteins are toxic only after
being ingested by the susceptible insect. After ingestion, the toxins are solubilized and, in some cases,
proteolytic ally digested to the active toxin form. CryI
type toxins bind to the specific receptors localized on
the brush border midgut epithelium (Hofmann et al.,
1988) and induce leakage of K+ and water into the
midgut cells, destroying the basal-side to apical-side
transepithelial current (Harvey and Wolfersberger, 19
79; Crawford and Harvey, 1988). Also, the difference
of pH in insect midgut was suggested to induce conformational changes of the protoxins, thus resulting
in discrepancies in the activities of the toxin proteins
(Venugopal et al., 1992).
In this report, tobacco plants transformed with cryJA
(b) and cryJA(c) toxin genes were shown to be resistant
to the tobacco budworm, an insect which is known
to be less sensitive to these toxins than other Koreanborn insects, such as Plutella xylostella (Suh et al.,
1992). Thus we expect stronger protection when the
cryJA(b) and cryJA(c) genes are introduced and expressed in major vegetables, such as cabbage, chinese cabbage, rape seed, and radish, which are heavily attacked
by P xylostella (diamond back moth). While the question regarding the absolute safety of B. thuringiensis
toxins against humans still remains, transgenic tobacco plants which reveal show resistance to tobacc-o
budworms reveal a strong feasibility for using B. tliuringiensis toxin genes as a new and environmentally safer method of controlling destructive insect pests.
Acknowledgments
The authors wish to express their appreclatlOn to
Eun-Young Lee for help in the bioassays.
Vol. 4 (1994)
Mi Chung Suh et al.
This work was supported by a Korean Ministry of
Science and Technology grant to C. B. Hong.
References
Adang, M . 1., Brody, M. S., Cardineau, G ., Eagan, N .,
Roush, R T , Shewmaker, C. K , Jones, A , Oakes,
1. V , and McBride, K E. (1993) Plant Mo!. Bioi. 21,
1131-1145
Adang, M. 1., Staver, M . J., Rocheleau, T A , Leighton,
1., Barker, R F , and Thompson D. V (1985) Gene
36, 289-300
An, G. (1987) Methods in Enzyrnol. 153, 292-305
Aronson, A I., Beckman, W., and Dunn, P. (1986)
Microbio!. R ev. 50, 1-24
Barton, K A , Whiteley, H . R , and Yang, N. S. (1987)
Plant Physiol. 85, 1103-1109
Benedict, 1. H., Sachs, E. S., Altman, D. W. Ring, D .
R , Stone, T. B., and Sims, S. R (1993) Environ. Entornol. 22, 1-9
Cho, H. J., Kim, S. 1., Rhim, S. L., and Kim, B. D.
(1992) Mol. Cells 2, 329-334
Crawford, 0. N., and Harvey, W. (1988) J Exp. Bio!.
137, 277-286
Dellaporta, S. L., Wood, J., and Hicks, 1. B. (1984)
in Molecular Biology of Plants: Cold Spring Harbor
Laboratory, New York
Dulmage, H. T (1981) in Microbial Control of Pest and
Plant Diseases 1970-1980 (Bruges, H. D., ed) Academic Press, London, 193-222
English, L. H., Readdy, T R , and Bastian, A L. (1991)
Insect Bio!. Chern. 21, 177-184
English, L., and Slatin, S. L. (1992) Insect Biochern.
Molec. Bioi 22, 1-7
Fischhoff, D. A , Bowdish, K S., Perlak, F 1., Marrone, P. G., McCormick, S. M., Niedenneyer, 1. G.,
Dean, D. A , Kusano-Kretzmer, K , Mayer, E. J., Rochester, D. E., RogelS, S. G ., and Fraley, R T (1987)
BiolTechnology 5, 807-813
Fujimoto, H., Itoh, K , Yamamoto, M., Kyozuka, 1.,
and Shimamoto, K (1993) BiolTechnology 11, 11511155
Geiser, M., Schweitzer, S., and Grimm, C. (1986) Gene
48, 109-118
Goldberg, L. 1., and Margalit, J. (1977) Mosq. News
37, 355-358
Harvey, W. R , and Wolfersberger, M. G. (1979) J Exp.
Bioi. 83, 293-304
Hofmann, c., Vanderbruggen, H., Hofte, H., Rie, J.
V , Jansens, S., and Mellaert, H . V (1988) Proc. Nat!.
Acad. Sci. USA 85, 7844-7848
Hofte, H ., and Whiteley, H. R (1989) Microbio!. Rev.
53, 242-255
Hong, C. B., and Jeon, J. H. (1987) Korean J Bot. 30,
201-203
Horsch, R B., Fry, 1. E., Hoffmann, N. L., Eichholtz,
D., and Rogers, S. G. (1985) Science 227, 1229-1231
Jenkins, 1. N., Parrott, W. L., McCarty, Jr. 1. c., Callahan, F E., Berberich, S. A , and Deaton, W. R
(1993) J Econ. Entornol. 86, 181-185
219
Koziel, M. G., Beland, G. L., Bowman, c., Carozzi,
N. B., Crenshaw, R, Crossland, L., Dawson, J., Desai, N., Hill, M., Kadwell, S., Launis, K, Lewis, ~,
Maddox, D., McPherson, K , Meghji, M. R , Merlm,
E., Rhodes, R , Warren, G . W., Wright, M., and
Evola, S. V. (1993) BiolTechnology 11, 194-200
Krieg, A , Huger, AM., Langenbrook, G. A, and Schnetter, W. (1983) Z. Angew. Entornol. 96, 500-508
Kronstad, 1. W., and Whiteley, H. R (1986) Gene 43,
29-40
Laemm1~ U. K (1970) Nature 227, 680-685
Lilley, M., Ruffel, R N., Somerville, H. 1. (1980) J
Gen. Microbio!. 118, 1-11
Murashige, T , and Skoog, F (1962) Plant Physiol. 15,
473-497
Murray, E. E., Rocheleau, T, Eberle, M., Stock, c.,
Sekar, v., and Adang, M. (1991) Plant Mol. Bio!. 16,
1035-1050
Oeda, K , Os hie, K, Shimizu, M., Nakamura, K, Yamamoto, H., Nakayama, I., and Ohkawa, H. (1987)
Gene 53, 113-119
Perlak, F 1., Deaton, R W., Armstrong, T A, Fuchs,
R L., Sims, S. R , Greenplate, J. T., and Fischhoff,
D. A (1990) BiolTechnology 8, 939-943
Perlak, F J., Fuchs, R L., Dean, 0. A, McPherson,
S. L., and Fischhoff, D. A (1991) Proc. Nat!. Acad.
Sci. USA 88, 3324-3328
Sambrook, 1., Maniatis, T , and Fritsch, E. F, (1989)
Cold Spring Harbor, New York, USA
Schnepf, H. E., Tomczak, K, Ortega, 1. P., and Whiteley, H. R (1990) J Bio!. Chern. 265, 20923-20930
Schnepf, H. E., and Whiteley, H. R (1985) J Bioi.
Chern. 260, 6273-6280
Schnepf, H. E., Wong, H. c., and Whiteley, H. R
(1985) J Bioi. Chern. 260, 6264-6272
Shibano, Y , Yamagata, A , Nakamura, N., Iizuka, T,
Sugisaki, H., and Takanami, M. (1985) Gene 34, 243251
Slatin, S. L., Abrams, C. M., and English, L. (1990)
Biochern. Biophys. Res. Cornrnun. 169, 765-772
Song, H. W., and Hong, C. B. (1991) Korean J Plant
Tissue Culture 18, 195-200
Suh, M. c., Hong, C. B., Kim, M., Kim, S. S., Cho,
K Y, Kim, J. I., and Sim, W. S. (1992) Mol. Cells
2, 87-95
Thome, L., Garduno, F , Thompson, T , Decker, D.,
Zounes, M., Wild, M., Walfield, A M., and Pollock,
T (1986) J Bacteriol. 166, 801-811
Towbin, H., Staehelin, T., and Gordon, 1. (1979) Proc.
Natl. Acad. Sci. USA 76, 4350-4354
Vaeck, M., Reynaerts, A , Hofte, H., Jansens, S., Beuckeleer, M. D., Dean, c., Zabeau, M., Montagu, M.
V, and Leemans, 1. (1987) Nature 328, 33-37
Venugopal, M. G ., Wolfersberger, M. G., and Wallace,
B. A (1992) Biochirn. Biophy. Acta 1159, 185-192
Warren, G . W., Carozzi, N. B., Desai, N ., and Koziel,
M. G. (1992) J Econ. Entorno!. (in press)
Whiteley, H. R, and Schnepf, H. E. (1986) Annu. Rev.
Microbio!. 40, 549-57