Download DNA-protein interactions in T. annulata

2243
Journal of Cell Science 113, 2243-2252 (2000)
Printed in Great Britain © The Company of Biologists Limited 2000
JCS1188
An upstream element of the TamS1 gene is a site of DNA-protein interactions
during differentiation to the merozoite in Theileria annulata
Brian Shiels1,*, Mark Fox2, Sue McKellar1, Jane Kinnaird1 and David Swan1
1Department of Veterinary Parasitology, University of Glasgow, Glasgow,
2Seattle Biomedical Research Institute, Seattle, WA 98109-1651, USA
G61 1QH, UK
*Author for correspondence (e-mail: [email protected])
Accepted 24 March; published on WWW 25 May 2000
SUMMARY
Apicomplexan parasites are major pathogens of humans
and domesticated animals. A fundamental aspect of
apicomplexan biology, which may provide novel molecular
targets for parasite control, is the regulation of stage
differentiation. Studies carried out on Theileria annulata, a
bovine apicomplexan parasite, have provided evidence that
a stochastic process controls differentiation from the
macroschizont to the merozoite stage. It was postulated
that this process involves the presence of regulators of
merozoite gene expression in the preceding stage of the life
cycle, and that during differentiation a quantitative
increase of these factors occurs. This study was carried out
to test these postulations. Nuclear run-on analysis showed
that TamS1 expression is controlled, at least in part, at the
transcriptional level. The transcription start site showed
homology with the consensus eukaryotic initiator motif,
and study of the 5′ upstream region by the electrophoretic
mobility-shift assay demonstrated that a 23 bp motif
specifically bound factors from parasite-enriched nuclear
extracts. Three complexes were shown to bind to a 9 bp
core binding site (5′-TTTGTAGGG-3′). Two of these
complexes were present in macroschizont extracts but
were found at elevated levels during differentiation. Both
complexes contain a polypeptide of the same molecular
mass and may be related via the formation of homodimer
or heterodimer complexes. The third complex appears to
be distinct and was detected at time points associated with
the transition to high level merozoite gene expression.
INTRODUCTION
The generation of extracellular uninucleated (merozoite)
stages from an intracellular multinucleated (schizont) stage is
a differentiation step that is common to different apicomplexan
life cycles. We have studied this event in Theileria annulata,
an apicomplexan parasite of bovines. In vivo the
macroschizont stage of Theileria resides within the bovine
leukocyte and induces host cell proliferation (Hulliger, 1965).
Following a particular time period, host cell division slows
down and the macroschizont differentiates into multiple
merozoites (Jarret et al., 1969). The merozoites are released as
the host cell is destroyed, invade erythrocytes and differentiate
into piroplasms. Differentiation to the merozoite of T. annulata
in vitro has been analysed using a system consisting of two
parasite-infected cloned cell lines, one of which generates
merozoites with high efficiency when cultured at 41°C, while
the other is severely attenuated with respect to this process
(Shiels et al., 1992, 1994). Comparative study of these cell
lines provided evidence that the ability to differentiate
correlated with the build-up in expression of a major merozoite
surface antigen gene, TamS1, which was also expressed at a
lower level in the macroschizont stage (Shiels et al., 1994).
Low-level TamS1 expression was found to be elevated during
an early transitory phase and was reversible until a condition
was reached that committed the cell to high-level merozoite
Parasites classified within the subphylum apicomplexa are
major pathogens of vertebrates and include the genera Babesia,
Eimeria, Plasmodium, Theileria and Toxoplasma (Cox, 1993).
A fundamental aspect of apicomplexan biology is the
progressive differentiation through a series of cellular stages to
generate a life cycle. The molecular mechanisms that regulate
this process are not fully understood. This knowledge may be
important because experimental data suggests that the
transition phase from one stage to another is sensitive to
manipulations that can alter the outcome of parasitic infection
and control associated disease (Shiels et al., 1998).
Differentiation of a number of apicomplexans, in vitro, can be
defined as stochastic (Shiels, 1999). In these systems the
random probability of a differentiation step occurring can
be increased by altering culture conditions. In addition,
apicomplexan differentiation is often associated with a
reduction in parasite proliferation potential, and continued
culture frequently brings about a loss of differentiation
capability. These shared characteristics suggest that, for certain
apicomplexan differentiation events, a basic mechanism may
operate across a range of parasite species (Shiels et al., 1998;
Shiels, 1999 and references therein).
Key words: Apicomplexan parasite, Stage differentiation, DNA
binding factor, Upstream motif
2244 B. Shiels and others
gene expression and merozoite formation. The correlation
between upregulation of TamS1 gene expression and merozoite
formation was also observed in experiments where the time
taken to reach commitment was altered by the addition of
specific drugs (Shiels et al., 1997). It was concluded from these
studies that that the differentiation mechanism may operate on
the basis of attaining a particular predetermined condition over
time, and that an increase in the ratio of polypeptide factor(s)
relative to DNA levels influences the rate of progression of the
cell towards this condition.
It has been demonstrated, in many eukaryotic systems, that
changes to the profile of gene expression following cellular
differentiation can be mediated by interactions between
polypeptide factors and short nucleotide motifs, normally
located upstream of the transcription initiation point
(Latchman, 1991; Blau, 1992). Therefore, based on the results
outlined above, it was proposed in a Theileria model that
factors which positively control TamS1 gene expression are
present in the preceding stage of the life cycle (the
macroschizont), and that elevated expression involves an
increase in the level of factor(s) relative to their DNA templates
until an unknown commitment threshold is reached (Shiels et
al., 1994, 1997). Then, at commitment, a qualitative change in
factor regulation was postulated to account for the switch to
irreversible high-level TamS1 gene expression. The present
study was carried out to test the above model by identifying
factors that bind to nucleotide motifs of the TamS1 gene during
differentiation to the merozoite.
MATERIALS AND METHODS
Cell culture and preparation of nuclear extracts
The uninfected BL20 cell line and the cloned macroschizont-infected
cell line, D7, were maintained in culture as described (Shiels et al.,
1992). Induction to differentiate at 41°C was performed under
standard conditions (Shiels et al., 1994), except in differentiation
time-course experiments where the following modifications were
introduced. D7 cells were washed in serum-free RPMI (Gibco)
medium and seeded at 2×105 cells ml−1 in RPMI-20% cool calf serum
(Sigma) plus standard supplements (Shiels et al., 1992) and placed at
41°C. At day 2, the cultures were diluted to 2×105 cells ml−1 in fresh
RPMI-cool calf. Following a further 2 days at 41°C the cultures were
centrifuged (300 g) and resuspended in RPMI supplemented with 10%
foetal calf serum. The cultures were then either replaced at 41°C or
37°C and cells harvested on day 6. This protocol was adopted because
it generated a higher level of cells displaying differentiation
morphology than standard conditions (data not shown). Three day-6
time points are represented in this study; D7/day 6I and D7/day 6II
are duplicate cultures where the cells were returned to 37°C after 4
days at 41°C. This procedure was previously shown to generate
cultures that contained a relatively synchronous population of
cells committed to merozoite production and nondifferentiating
macroschizont-infected cells (Shiels et al., 1994). The D7/ day 6III
culture was a normal asynchronous culture incubated at 41°C
throughout.
Parasite- and host-enriched nuclear extracts were generated
essentially as described (Swan et al., 1999). To extract nuclear
proteins, host-enriched and parasite-enriched nuclear pellets were
taken up in 500 µl and 300 µl, respectively, of ice-cold extraction
buffer (5 mM Hepes, pH 7.9, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM
DTT, 0.5 mM PMSF) and 3 M NaCl added to a final concentration
of 300 mM. Extraction was carried out on ice for 30 minutes and the
chromatin pelleted by centrifugation (14000 g for 5 minutes). The
estimated protein concentration was in the range of 0.4-1.5 µg/µl for
parasite-enriched extracts while the host extracts, in general,
contained five- to tenfold more protein.
Isolation and sequence analysis of TamS1, TpmS1 and
TsmS1 genomic DNA clones
A genomic clone containing the TamS1 gene was isolated from a λ
DASH library of genomic DNA derived from merozoites of the D7infected cloned cell line. Screening by hybridisation with a TamS1
cDNA probe was performed using standard protocols (Shiels et al.,
1994; Church and Gilbert, 1984). The λ DASH insert (approx. 20 kb)
was restriction mapped by Southern blotting (Sambrook et al., 1989)
and hybridisation (Church and Gilbert, 1984) using probes
representing the 5′ and 3′ ends of the cDNA. A 3.2 kb HindIII×SalI
fragment and a 4.0 kb HindIII×SalI fragment were identified as
representing, respectively, the 5′ and 3′ flanking regions of the TamS1
gene. These fragments were cloned and completely sequenced on both
strands using a LiCor automated sequencer and a combination of
ExoIII deletions (Erase-a-Base®, Promega) plus subcloning of
restriction fragments. This generated an 8.0 kb sequence contig, with
3.0 kb of 5′ sequence and 4.1 kb of 3′ sequence flanking the TamS1
open reading frame (accession number: AJ276654 for EMBL,
GenBankTM and DDJB data bases).
To isolate a genomic clone of the TpmS1 gene, a minilibrary was
constructed with DNA isolated from piroplasms of T. parva
(Brocklesby et al., 1961). A 6.0 kb HindIII fragment was detected on
Southern blots with both the 5′ and 3′ TamS1 cDNA probes (Fox,
1997). HindIII-digested DNA was then separated by agarose
electrophoresis and DNA fragments of approximately 6.0 kb
electroeluted from a 1 cm gel slice. Elutip column purified DNA was
then ligated into the λ ZAP Express vector and packaged with
Gigapack II packaging extract as detailed by the supplier (Stratagene).
The T. parva minilibrary was screened by hybridisation with the
TamS1 cDNA probe at 59°C and positive phage isolated. The pBKCMV phagemid was excised following the manufacturer’s protocol
and contained a HindIII insert of approximately 5.5 kb. The TpmS1
flanking regions were then subcloned and sequenced (Fox, 1997).
Once completed a 5.6 kb contig containing the protein coding
sequence plus 2.08 kb upstream and 2.7 kb downstream sequence was
generated (accession number: AJ276655 for EMBL, GenBankTM and
DDJB data bases).
Attempts were made to PCR amplify the 5′ flanking region of the
TsmS1 gene (synonym TSI10) from T. sergenti genomic DNA using
standard protocols (Sambrook et al., 1989; Shiels et al., 1995) and
reaction conditions of 95°C for 4 minutes followed by 25 cycles of
1 minute at 95°C (denaturation), 1 minute at 45°C (annealing)
and 1 minute at 72°C (elongation). The Tams1DB primer 5′
cttgtctccgaccttaagggtctt 3′ located within the protein coding region of
the TamS1 gene (+343 to +320, relative to the transcription start site)
and a range of primers located to the 5′ upstream region of TamS1
were used. Of these only one, CAT4a (5′acaatttgtagggcga3′, −54 to
−49), in combination with Tams1DB, generated a PCR product. This
product was 388 bp in length, and generated an additional 66 bp of
sequence upstream of the 5′ end of the published TSI10 cDNA
sequence (Kawazu et al., 1992).
Mapping of transcription start site and nuclear run-on
analysis
To map the 5′ terminus of TamS1 mRNA, rapid amplification of cDNA
ends (Frohman et al., 1988) was employed using a commercial
system, following the supplier’s protocol (Gibco-BRL). The
piroplasm stage expresses TamS1 RNA at high levels (Swan et al.,
1999). Total RNA was isolated as described (Chomczynski and
Sacchi, 1987) and poly(A)+ RNA purified using a Poly ATtract mRNA
Isolation System (Promega). First-strand cDNA was synthesised
using a TamS1 gene-specific oligonucleotide primer (GSP1: 5′
DNA-protein interactions in T. annulata 2245
cgaacttggaagcatctagttccttggcgg 3′, +448 to +418, relative to
translation start site). Single-stranded cDNA was tailed with poly dC
and 30 cycles of PCR amplification carried out using the anchor
primer in combination with a second nested gene-specific primer
(GSP2: 5′gggtcttgaaacggtagccatccgcgacag3′, +211 to +182). A PCR
product which ran just below the 395 bp marker was detected by
Southern blotting using the TamS1 cDNA probe. A further round of
PCR amplification was followed by ligation of the product into pCR
II vector (Invitrogen) and determination of the sequence.
Nuclear run-on analysis was performed on parasite-enriched
nuclear fractions isolated from 108 parasite-infected cells, as
described above. The run-on reactions were performed essentially as
outlined (Kooter et al., 1987) except that SDS was omitted from the
proteinase K incubation step and RNA was separated from free
nucleotides by a NucTrap® probe purification column (Stratagene).
Radiolabelled RNA was then added to hybridisation solution (Church
and Gilbert, 1984) and incubated with slot blots of DNA probes for
48 hours at 60°C, followed by two washes in 2× SSC (1× SSC: 0.15
M NaCl, 0.015 M sodium citrate), 0.1% SDS for 30 minutes and one
wash in 0.2× SSC. DNA probes (1 µg in 50 µl of 25 mM phosphate
buffer, pH 5.5) were slot-blotted onto Hybond N membrane
(Amersham) using a Hybri-Slot Manifold (Gibco-BRL), after
denaturation at 90°C for 3 minutes. The probes were fixed by UV
crosslinking in a GS Gene Linker (Biorad). Probes specific for the
TamS1 gene represented either a TamS1 cDNA clone (Shiels et al.,
1995) or an upstream fragment, TamS1-P, spanning positions −116 to
−1. TamS1-P was PCR-amplified from a 1.2 kb 5′ TamS1 HincII
genomic subclone with the following primers: 5′gggtcta−116ggacttcaatggaggataagg−893′ and 5′gggagctc−1gaagtgagatggatatgcattcacc−25 3′.
Electrophoretic mobility-shift assays
The TaGATCAT probe was PCR-amplified from the 1.2 kb 5′ TamS1
HincII genomic subclone with the primers 5′cgcaagctt−109aatggaggataaggcatt−923′ and 5′cgcggatcc−16gcattcaccatagaaaac−333′. A
111 bp fragment was restriction digested with BamHI×HindIII and 10
ng radiolabelled by end-filling using Klenow (Dent and Latchman,
1993). Standard binding reactions contained 0.1 ng probe, 2-4 µg
nuclear extract, 10 mM Hepes (pH 7.9), 60 mM NaCl, 1 mM EDTA,
5% Ficoll, 200 ng poly(dI-dC). Reactions were incubated on ice for
40 minutes and analysed by electrophoresis on 4% polyacrylamide,
0.5× TBE (45 mM Tris-borate, 1 mM EDTA) gels (Dent and
Latchman, 1993).
Three double-stranded radiolabelled oligonucleotides were used as
probes. These were CAT1, 5′atgc−58gcacacaatttgtagggcgac−383′;
CAT2-4, 5′atgc−66ataaacatgcacacaatttgtagggcga−38 and CAT1-P,
5′atgc−58gcacacaatttgttgggcgac−383′. Complementary single-stranded
oligonucleotides were annealed and radiolabelled using T4
polynucleotide kinase as described (Dent and Latchman, 1993).
Standard binding reactions contained 40 fmol of probe and 2-4 µg of
extract. In competition experiments extract was incubated with 100fold cold double-stranded oligonucleotide probes for 20 minutes on
ice before addition of radiolabelled probe. Competition was
performed with cold CAT1, CAT1-P and GATA, 5′atgcta−82gagtgcatagatacagataaacat−593′. For the time-course experiments,
quantification of the shifted probe was carried out by excision of the
appropriate area of the dried-down acrylamide gel followed by
counting using a Packard 1600 TR liquid scintillation counter.
UV crosslinking and SDS-PAGE
Fixation of protein to oligonucleotide probes was carried out
essentially as described (Genersch et al., 1995). Preparative gel-shift
reactions were performed with 8 µl of D7/Day 6 nuclear extract and
800 fmol of a radiolabelled CAT1 probe, modified by the
incorporation of 5-bromodeoxyuridine during synthesis (MWGBIOTECH) at positions 9, 11 and 13 of the top strand. Nine reactions
were run on a polyacrylamide gel and the positions of the CAT1specific complexes determined by exposure of the wet gel to X-ray
film for 1 hour at −70°C. Slices of gel containing the complexes were
then excised and exposed to UV illumination (254 nm) for 15 minutes
on ice. The gel slices were then dissected into smaller pieces and
incubated in 10 mM Tris (pH 7.5), 0.1% SDS at room temperature
overnight. Eluted protein was then TCA-precipitated, washed once in
acetone, air-dried and redissolved in 1× SDS-PAGE sample buffer
plus 0.1 volume of 1 M Tris (pH 6.8). The samples were then analysed
by SDS-PAGE and autoradiography, using standard protocols
(Sambrook et al., 1989).
RESULTS
Structural analysis of the TamS1 gene locus
To commence studies aimed at identification of nucleotide
motifs and polypeptide factors involved in the control of TamS1
gene expression, genomic DNA fragments corresponding to
the 5′ and 3′ regions that flank the known open reading frame
were isolated and sequenced. This resulted in a contiguous
sequence of over 8 kb that contained, in addition to TamS1
(Shiels et al., 1995), two incomplete small polypeptide open
reading frames, at the 5′ and 3′ termini respectively, and a small
internal ORF of 907 bp, that was located between positions
4909-5816 of the contig. As expected the sequence was in
general AT-rich (64%). The region (981 bp) flanking the 3′
boundary of the Tams1 open reading frame was comparable
with respect to the overall AT content (63%), while the 5′
flanking region (2.89 kb) was more AT-rich (70%) and
contained 18 homopolymeric (dA:dT) tracts >9 bp.
A major transcription initiation site was mapped to an
adenosine residue 119 bp upstream of the translation start
codon (see Fig. 1A) within a motif (TCA(+1)CTTA) that
has a good match to the consensus sequence
(PyPyA(+1)N(T/A)PyPy) established for the eukaryotic
initiator (Inr) element (Smale and Baltimore, 1989; Javahery
et al., 1994).
As nucleotide motifs that regulate gene expression are often
conserved across related organisms, regions of DNA that flank
the TamS1 homologue from Theileria parva (TpmS1; Shiels et
al., 1995) were isolated and sequenced. Comparison of the
TamS1 and TpmS1 contigs revealed that the 5′ and 3′ flanking
regions showed the same level of identity (79% for 2.1 kb of
5′ sequence; 78% for 2.5 kb of 3′ sequence) as the protein
coding region (78%) across the two species. Identity was
higher across sequences proximal to the translation initiation
and the mapped transcription initiation site (85% over 207 bp
upstream of ATG) and the translation termination codon (91%
over 116 bp downstream of TAA).
Due to the unexpectedly high level of general sequence
conservation between the T. parva and T. annulata contigs,
identification of conserved putative regulatory motifs was not
possible. Therefore, attempts were made to PCR amplify
genomic DNA flanking the 5′ region of the TsmS1 gene of T.
sergenti, and a comparison of the untranslated 3′ region, using
available cDNA sequences, was undertaken. Only one PCR
product was obtained using a range of TamS1 5′ primers in
combination with the coding region primer. The alignment
shown in Fig. 1A revealed that the sequence proximal to the
translation start site of the T. sergenti gene was significantly
divergent from the TamS1 and Tpms1 sequences. However, two
short stretches of identity were obtained. The first of these is
2246 B. Shiels and others
A
TamS1) functions as the polyadenylation
signal.
-109__________________________________________________________
TamS1 TTCAATGGAGGATAAGGCATTAGGCGTGATGAGTGCATAGATACAGATAAACAT[GCACAC
TpmS1 -GA---T---CG-T---GG----------C-------AT---------G-----[------
Regulation of TamS1 occurs at the
transcriptional level
Analysis of nuclear preparations by
incorporation
of
4-6,
diamidino-2phenylidole (DAPI) and fluorescence
microscopy, demonstrated an enrichment of
either host or parasite nuclei (see Fig. 2).
Parasite-enriched nuclear fractions from
time points of a differentiation time course
were used in nuclear run-on analysis. The
resulting radiolabelled nascent RNA was
used to probe cDNA representing TamS1, a
rRNA gene previously found to be
constitutively expressed (Shiels et al., 1994;
Swan et al., 1999) and the plasmid pGEM.
The autoradiograph showed that between
days 2 and 4 of culture at 41°C a small
increase in the level of TamS1 transcript
occurred relative to the rRNA control gene
(Fig. 3A,B). This was then followed by a
more substantial increase between days 4
and 6 (Fig. 3B,C). Thus, control of TamS1
gene expression occurs, at least in part, at the
transcriptional level. Further nuclear run-on
analysis was carried out utilising the TamS1P fragment representing genomic DNA
positioned −116 to −1 upstream of the
mapped transcription start site. No signal
relative to the cDNA and pGEM control
probes was obtained (see Fig. 3D). This
result indicated that nucleotide motifs
involved in regulation of transcription are
likely to be located within the intergenic
DNA region upstream of the TamS1 gene.
______________________________________-17
>
TamS1 AATTTGTAGGGCGAC]ATTG.TTTTGTATGGTGAATGCATATCCATCTCACTTCACTTATA
TpmS1 -------T------G]-AC-.C--------------CTTCC--------------A----TsmS1 --------------G -ACATA-G-A-GGTAAATCA-TTGTTT-TAA-TG-A-TCGC--.*********
+8
GTTATTGGTCTTTTTTTCCATAACATCCACCCAATTAGTTAATTTTTAATATTTAAATCG
------..CCTG--------------TT-T--GG---T----------------GG---C---AGTTC--TGC----A-AC-GT-CT-......--AG-T-AG--------------TA
+68
CTCACTAGTCTGCCCTTTCTTATCTTTTTATAATATAATTATTTGAGATGTTGTCCAGGA
--AA----------T---G--CGG----------------------------------ATATTG--AA-CA-AC--.....GTA-AC-T---CTAG--A-----CT----------A--
B
TamS1
TpmS1
TsmS1
1
TAAAACCCATGTTCGTAACAACTTATCAACT[TTTAAAACAA.TTTTGATAATTTGTA]TAC
------------G-----------------G[----------.-A-------------]--TAGGCG-AC--AGTC-C---TA-----GACG[-------T--CAA-------------]C-A
61
AATTGCAGAAACTAAATAACTAGCTTAAGTCATTATATGCCACTTAATTTTATACTTT
----A---C-G----C-----TAAG-C-T-..----TGA-----------C----CCG-C--A
Fig. 1. Alignment, by the GCG PILEUP program, of nucleotide sequences obtained for
the 5′ (A) and 3′ (B) flanking sequences of the TamS1, TpmS1 and TsmS1 genes. Dashes
represent nucleotides identical to the TamS1 sequence while gaps, introduced to maximise
the alignment, are represented by a dot. (A) The distal region of sequence homology
across all three sequences is derived from the CAT4 primer used in the PCR reaction and
may be conserved. The overlined TamS1 sequence indicates the region represented by the
TaGATCAT PCR product; the underlined sequence designates the GATA oligonucleotide
and the bracketed sequence designates the CAT1 oligonucleotide. The ATG translation
initiation sequence is in bold, the mapped transcription start site is indicated by an
arrowhead and the core binding motif of the CAT1 probe is designated by the symbol ∗.
(B) The translation termination codons are in bold, the region of homology across all
three sequences is bracketed and the putative polyadenylation signal is underlined.
a 10 bp AT-rich stretch positioned between +52 and +61, while
the second is a 17 bp stretch (+108 to 124), with 88% identity,
that contains the methionine initiation codon. Comparison of
the TamS1 and TsmS1 3′ untranslated cDNA sequences also
showed a 25 bp region of homology that was AT-rich and
positioned 29 bp downstream of the translation stop codon (see
Fig. 1B). Nucleotide divergence has occurred within the middle
of this stretch where an insertion within the TsmS1 sequence
to generate an AATAA motif is followed by insertion of a C
residue to maintain a conserved CAA triplet. Motifs within this
25 bp region could be involved in mRNA stability or RNA
processing. However, as the position of the poly(A)+ tract
differs between the TamS1 and TsmS1 cDNA sequences it is
possible that, as described for Plasmodium genes (Lanzer et
al., 1993), the AATAA motif (34 bp downstream of the TAG
stop codon, TsmS1; 72 bp downstream of TAA stop codon,
Identification of a TamS1 upstream
nucleotide motif that binds Theileria
nuclear factors
To screen for motifs that bind parasite
nuclear factors an electrophoretic mobilityshift assay (EMSA) was developed. The
assay used parasite- and host-enriched
nuclear extracts and DNA probes of approximately 100 bp,
PCR-amplified from the TamS1 5′ flanking region. The primers
were designed to generate probes that covered the upstream
regions (from position −504 to position −1), which showed the
highest level of conservation between TamS1 and TpmS1.
Designation of a positive result was based on detection of
mobility shifts (after an overnight exposure of the
autoradiograph) that were more abundant with extracts derived
from parasite-enriched nuclear fractions. Probes covering
positions −504 to −120 failed to give a result that met these
criteria. A positive result was, however, obtained with the
fragments proximal to the transcription start site. Thus a probe,
TaGATCAT (covering bases −109 to −16), generated two
strong complexes (Fig. 4A). The faster complex of the two was
found to be associated with parasite-enriched nuclear extracts,
while the second complex predominated when the probe was
DNA-protein interactions in T. annulata 2247
incubated with host-enriched nuclear extracts. In addition to
the major complexes, both slower (a) and faster (c) less
abundant complexes were detected in extracts derived from
differentiating cultures. This profile was reproduced with the
TamS1-P fragment (−116 to −1), except resolution of complexc was not obtained (data not shown).
Analysis of the TaGATCAT probe sequence showed that it
contained blocks of high identity between TamS1 and TpmS1.
To determine if any of these sequence blocks were responsible
for the mobility shifts, competition experiments were carried
out using two cold double-stranded oligonucleotide probes.
The first probe (CAT1) spanned positions −58 to −38 and
included the primer sequence that resulted in successful PCR
amplification from the T. sergenti genomic DNA. CAT1
specifically competed with a subset of shifts that were
associated with parasite-enriched, but not host-enriched,
nuclear fractions (Fig. 4B); the second double-stranded
oligonucleotide (GATA) spanning nucleotides −84 to −59 did
not result in major competition of the probe/extract complexes.
EMSA using radiolabelled CAT1 probe confirmed that this
sequence could directly bind parasite-associated nuclear
factors (Fig. 4C). Three specific complexes were detected with
extracts of parasite-enriched nuclear fractions. The slower
complexes (a and b) were both present in extracts of
nondifferentiating cells but appeared to be more abundant in
extracts derived from differentiating parasite-infected cultures.
The fastest of the three complexes (c) was present at the lowest
levels and could not be detected in extracts derived from cells
cultured at 37°C. Formation of all three CAT1 complexes was
demonstrated to be specific by competition with cold doublestranded CAT1, in direct comparison to cold double-stranded
GATA. A complex that migrated slightly slower than complexa (Fig. 4C, lane 2) was also
observed in shifts performed with
parasite-enriched extracts from
37°C cultures. This band was not
detected consistently and was not
due to specific complex formation,
as it was not competed by cold
CAT1.
To delineate the binding site of
the CAT1 probe in more detail,
mutagenesis was carried out.
Initially, three mutant doublestranded oligonucleotides were
generated, each differing from the
CAT1 probe by substitution of a
distinct nucleotide triplet as
outlined in Fig. 5A. Substitution of
the triplet ACA (CAT1.M1) did not
have any effect on the formation of
complex-b or complex-c relative to
the wild-type probe, but did result
in a lower level of complex-a
formation. In contrast, substitution
of the second (TGT: CAT1.M2) and
third triplet (GCG: CAT1.M3)
abolished the ability to form all
three parasite-associated complexes
(Fig. 5B). It was concluded form
this analysis that the sequence 5′
ATTTGTAGGGCG 3′ was critical
for CAT1 complex formation. A
fourth mutant oligonucleotide was
generated where the 5′ adenosine or
3′ cytosine and guanine residues of
this sequence were also altered.
This probe (CAT1.M4) reduced the
quantitative level of all three
complexes relative to the wild-type
CAT1 probe but did not abolish their
formation (data not shown). This
Fig. 2. Analysis of host and parasite-enriched nuclear fractions by DAPI fluorescence.
result limited the core motif
(1) unfractionated macroschizont-infected cells (D7) cultured at 37°C (day 0). (2) Host-enriched
responsible for complex formation
nuclear fraction of D7/day 0 cells. (3) Parasite-enriched nuclear fraction of D7/day 0 cells.
to the residues 5′ TTTGTAGGG 3′.
(4) Unfractionated cells from differentiating culture of D7 cells (day 9 at 41°C). (5) Host-enriched
The core binding motif defined
nuclear fraction of D7/day 9 cells. (6) Parasite-enriched nuclear fraction D7/day 9 cells. Bar, 6.2
for TamS1 is also upstream in the
µm. h and p denote, respectively, host and parasite nuclei.
2248 B. Shiels and others
A
Fig. 3. Analysis of TamS1 transcription. Parasite-enriched nuclear
fractions were prepared from day 2 (A), day 4 (B) day 6 (C) and day
7 (D) D7 cells cultured at 41°C. In (A-C), nascent radiolabelled RNA
was generated and used to probe a range of Theileria DNA
fragments: slot 1, pGEM plasmid vector; slot 2, large subunit
ribosomal RNA gene; slot 3, a gene (1C7) encoding a macroschizont
polypeptide; slot 4, the merozoite rhoptry gene TamR1; slot 5, an
asparagine-rich gene; slot 6, TamS1 cDNA. (D) Nascent
radiolabelled RNA was used to probe DNA fragments representing:
slot 1, TamR1 cDNA; slot 2, upstream region of TamR1 genomic
DNA; slot 3, TamS1 cDNA; slot 4, the TamS1-P PCR fragment
representing the upstream region (−116 to −1) proximal to the
transcription start site.
TpmS1 sequence, except the single adenosine residue is
substituted by a thymidine. EMSA was performed with a
double-stranded oligonucleotide (CAT1-P) incorporating this
substitution (Fig. 5C). All three complexes were obtained with
radiolabelled CAT1-P probe, and cold CAT1-P competed the
three complexes formed by the CAT1 probe. While complexes
b and c were generated to comparable levels with both probes,
the relative level of complex-a appeared to be reduced for the
CAT1-P (T. parva) probe. Thus, while all three complexes are
likely to be generated by the Cat1-P probe and T. parva
extracts, complex-a may be formed with reduced efficiency.
Characterisation of nuclear factor-CAT motif
complex formation during differentiation to the
merozoite
Previous studies have shown that for the majority of parasites
commitment to merozoite formation occurs after incubation at
41°C for 4 days (Shiels et al., 1994). To compare the level of
complex formation that occurred during differentiation to the
merozoite, the CAT1 probe was incubated with parasiteenriched nuclear extracts derived from different points of a
differentiation time course. The level of individual complex
formation was then quantified by liquid scintillation counting.
As can be seen in Fig. 6 and Table 1, the levels of complex-a
and complex-b formation showed a respective increase of up
to 3.2-fold and 5.4-fold between the day 2 and day 6 time
points. To take into account differences in the load of parasite
nuclei between samples, DNA was isolated from the parasiteenriched chromatin pellet generated during preparation of the
day 2 and day 6 extracts. The DNA was then analysed by
Southern blotting, using a probe (1.2 kb 5′ TamS1 HincII
genomic subclone) representing the upstream region of TamS1
B
Fig. 4. EMSA of the 5′
C
flanking region of TamS1
gene with host- and parasiteenriched nuclear extracts.
Closed arrowheads denote
parasite-associated
complexes, open arrowhead
denotes host. (A) EMSA
using TaGATCAT probe.
Probe alone (lane 1); probe
plus: BL20 nuclear extract
(lane 2); host-enriched
nuclear extract of D7/day 0
cells (lane 3); parasiteenriched D7/day 0 nuclear
extract (lane 4); host-enriched
D7/day 6 nuclear extract (lane
5); parasite-enriched D7/day 6
extract (lane 6).
(B) Competition with cold
double-stranded oligonucleotides. Probe plus: cold CAT1
oligonucleotide preincubated with host-enriched D7/day 0 nuclear
extract (lane 1); parasite-enriched D7/day 0 nuclear extract (lane 2)
and parasite-enriched D7/day 6 nuclear extract (lane 3): cold GATA
oligonucleotide preincubated with host-enriched D7/day 0 nuclear
extract (lane 4); host-enriched nuclear D7/day 6 extract (lane 5); and
parasite D7/day 6-enriched nuclear extract (lane 6). Note that the
parasite-enriched day 6 extract used in this experiment was
contaminated with host nuclei. The open arrowhead designates the
major host-associated complex. (C) CAT1 oligonucleotide probe
with parasite-enriched nuclear extracts. Probe plus: BL20 nuclear
extract (lane 1); parasite-enriched D7/day 0 nuclear extract (lane 2);
parasite-enriched D7/day 6 extract (lane 3); parasite-enriched D7/day
0 extract and cold competitor CAT1 (lane 4); parasite-enriched
D7/day 6 extract and cold competitor CAT1 (lane 5); parasiteenriched D7/day 0 extract and cold competitor GATA (lane 6);
parasite-enriched D7/day 6 extract and cold competitor GATA
(lane 7).
that contains the CAT1 motif. The TamS1-specific restriction
fragment was detected by autoradiography, excised and
counted. This analysis showed an increase of up to 1.6-fold in
TamS1 DNA between the day 2 and day 6 time points,
indicating respective increases of 2.0- to 3.4-fold in the levels
of complex-a and complex-b formation relative to their TamS1
DNA template (Table 1). Complex-c was the least abundant of
DNA-protein interactions in T. annulata 2249
the three CAT1 complexes. It was undetectable in all extracts
derived from cells cultured at 37°C. Clear detection of this
complex was not achieved until day 4 of differentiation time
courses with a quantitative increase in the intensity of the gel
shift between days 4 and 6.
Mutagenesis of the CAT1 probe indicated that sequence
upstream to the core motif may be involved in stabilisation of
complex-a, but not complex-b or complex-c. EMSA was,
therefore, carried out with CAT2-4, which represented CAT1
plus 8 additional 5′ nucleotides. The results showed that,
compared to the CAT1 probe (Table 1), a change in the affinity
of complex-a relative to complex-b occurred when extracts of
differentiating cells (day 6) were incubated with CAT2-4
(Table 2). To test whether this change in the relative levels of
complex formation was influenced by either protein or probe
concentration, titration of both extract and probe was
performed (Fig. 7 and Table 2). These experiments showed that
the ratio between complex-a and complex-b was influenced
by both factors, complex-a being favoured by higher levels
of protein and lower levels of probe, although protein
concentration appeared to have a greater influence. One
possible explanation for these results is that the two complexes
Fig. 6. EMSA on CAT1 probe
with parasite-enriched nuclear
extracts of a differentiation
time course. Probe alone (lane
1); probe plus: D7/day 0 (lane
2); D7/day 2 (lane 3); D7/day
4 (lane 4); D7/day 6I (lane 5);
D7/day 6II (lane 6); D7/day
6III (lane 7).
A
CAT1
B
M1
M2
M3
TGG
ACG
C GT
GCACAA TTTGTAGGG CGAC
ATT
G
M4
A
B
C
Fig. 5. Definition of CAT1 core binding site by mutagenesis.
(A) Diagram of mutant oligonucleotides, open arrowheads denote
nucleotide substitution. (B) EMSA with CAT1 and CAT1Mutant
probes incubated with D7/day 6 parasite-enriched nuclear extract.
Lane 1, CAT1; lane 2, CAT1M1; lane 3, CAT1M2; lane 4, CAT1M3.
It is not known why doublets were resolved at the position of
complex-b and complex-c. (C) EMSA with CAT1 and CAT1-P
probes incubated with D7/day 6 parasite-enriched nuclear extract.
Lane 1, CAT1; Lane 2, CAT1-P; lane 3 CAT1 and cold competitor
CAT1-P. For details of CAT1M and CAT1-P probes, see text.
Fig. 7. Titration of CAT2-4 probe and D7/day 6 parasite-enriched
nuclear extract. (A) Titration of different amounts of nuclear extract
relative to a constant amount of probe (40 fmol): lane 1, 3.8 µg; lane
2, 1.9 µg; lane 3, 760 ng; lane 4 380 ng. (B) Titration of CAT2-4
probe relative to constant extract level (3.8 µg). Lane 1, ×10 probe;
lane 2, ×5 probe; lane 3, ×2 probe; lane 4, ×1 (40 fmol) probe. Note
that lanes 3 and 4 represent a longer exposure of the autoradiograph
in order to visualise the complexes formed under the different
conditions simultaneously. A fourth complex of slower mobility than
complex-a was also obtained. It was not shown to be specific to the
core CAT1 motif.
2250 B. Shiels and others
postulated that factors controlling expression of merozoite
genes were likely to be present in the preceding stage of the
life cycle, the macroschizont, and that these factors increased
relative to their DNA templates during the differentiation
process (Shiels et al., 1994, 1997). This postulation was tested
in the present study by screening for parasite nucleotide motifs
that bind nuclear polypeptides before and during merozoite
formation.
The region of the genome flanking the TamS1 gene was
cloned and sequenced and the general AT content between the
protein coding and intergenic regions was found to be very
similar. However, stretches of AT-rich sequence >9 bp in length
were frequently observed within the 5′ intergenic region (18
times), and six tracts were found to be conserved between T.
parva and T. annulata within 1.1 kb of sequence proximal to
the ATG translation initiation codon. Homopolymeric (dA:dT)
tracts have also been shown to be overrepresented within
Plasmodium intergenic regions (Horrocks et al., 1998). As
homopolymeric (dA:dT) tracts are involved the control of gene
expression in lower eukaryotes (Hori and Firtel, 1994; Struhl,
1985; Lue et al., 1989), it was proposed that they may modulate
transcriptional activity in this parasite. The (dA:dT) tracts
within the TamS1 upstream intergenic region could, therefore,
be involved in controlling transcription of this gene.
A major start site of transcription was mapped to 121 bp
upstream of the ATG translation initiation. Interestingly, the
sequence flanking the mapped site showed a good match to the
consensus (PyPyA(+1)N(T/A)PyPy) initiator (Inr) motif
defined for a number of eukaryotic promoters (Smale and
Baltimore, 1989; Javahery et al., 1994), whereas a consensus
TATAAA box sequence could not be identified within close
proximity upstream of the transcription initiation site. Inr has
been shown to constitute a simple functional promoter and an
Inr motif has been shown to be required for expression of the
NTP3 gene in T. gondii (Nakaar et al., 1998).
The Inr sequence was found to be perfectly conserved
between the T. parva and T. annulata upstream regions,
although the start site for TpmS1 has yet to be defined.
Additional short conserved motifs could not be identified as
the level of sequence identity between TamS1 and TpmS1 was
too great. However, within the upstream PCR product obtained
for the more distantly related species, T. sergenti, three possible
conserved motifs were found (see Fig. 1). The first of these
motifs, derived from the primer sequence, needs to be
Fig. 8. SDS-PAGE analysis of UVfixed EMSA complexes. Lane 1,
complex-a; lane 2, complex-b; lane
3, complex-c. Note that lane 2
represents a shorter exposure of the
autoradiograph relative to lanes 1
and 3 to equalise intensity and
resolution of the bands. The
mobilities of kDa molecular mass
markers are indicated by
arrowheads.
share a common polypeptide and that complex-a is formed by
association of this polypeptide with another factor, or with
itself. This possibility was tested by UV-crosslinking
experiments. Following separation by preparative EMSA, gel
slices representing each of the three complexes associated with
CAT1 were excised and subjected to UV irradiation. The DNAprotein complexes were then eluted and analysed by SDSPAGE. For both complex-a and complex-b the predominant
UV-fixed polypeptide DNA complex had an estimated
molecular mass of 69 kDa, while for complex-c the mass of
the fixed polypeptide plus probe was estimated as 57 kDa
(Fig. 8). In addition to the major UV-fixed band at 69 kDa, a
second minor band was detected at approximately 80 kDa in
the tracks representing complex-a and complex-b of the
EMSA. However, proof of specificity by removal of the UVfixed polypeptides through competition with cold CAT1
oligonucleotide was not achieved. This was due to a failure to
UV-fix and resolve these polypeptides without prior separation
of the complexes by gel-shift electrophoresis (data not shown).
DISCUSSION
Previous work carried out on T. annulata stage differentiation
Table 1. Quantification of CAT1 EMSA complex formation during differentiation to the merozoite
(A) Incorporation of radiolabelled CAT1 probe (c.p.m.) into complex-a and complex-b
Complex-a
Fold increase day 2:day 6
Complex-b
Fold increase day 2:day 6
Complex-a/b
Day 0
Day 2
Day 4
Day 6 I
Day 6 II
Day 6 III
200
367
412
584
1107
1124
0.36
0.33
0.36
1181
3.2
6003
5.4
0.20
980
2.7
5217
4.7
0.19
1138
3.1
4886
4.4
0.23
(B) Analysis of TamS1 DNA levels (c.p.m.) between day 2 and day 6 time points
Hybridised probe
Day 2
Day 6 I
Fold increase
Day 6 II
Fold increase
Day 6 III
Fold increase
1827
2911
1.6
2473
1.4
2763
1.5
Note: Computation of fold increase between day 0 and other time points was not feasible due to the low protein concentration in the day 0 extra.
DNA-protein interactions in T. annulata 2251
Table 2. Modulation of CAT2-4 complex formation
(c.p.m.) by titration of nuclear extract and DNA template
(A) Titration of D7/day 6I nuclear extract against ×1 (40 fmol) probe*
Extract
3.8 µg
Complex-a
Complex-b
Complex-a/b
1007
1061
0.95
1.9 µg
760 ng
380ng
423
972
0.44
151
696
0.22
30
87
0.34
(B) Titration of DNA template against D7/day 6I (3.8 µg) extract
Probe
×10
Complex-a
Complex-b
Complex-a/b
23454
26949
0.87
×5
×2
×1
5432
6609
0.82
1991
1561
1.28
1070
806
1.33
*Standard binding reactions contained 40 fmol of probe and 2-4 µg of
extract. See Materials and Methods for details.
confirmed. The second motif was located 50 bp downstream
of the mapped transcription start site of TamS1 and is a 10 bp
homopolymeric (dA:dT) motif with 100% identify. The third
motif was located at either side of the translational start site
and showed 88% identity over a 17 bp stretch. Given the
sequence diversity between T. annulata/parva and T. sergenti
(Shiels et al., 1995), it is possible that these three motifs have a
functional role. As the second and third motifs are downstream
of the mapped transcriptional start site, they could be involved
in regulating gene expression at the transcriptional, posttranscriptional or translational level.
Nuclear run-on analysis indicated that TamS1 expression is
regulated during differentiation at the transcriptional level,
although additional post-transcriptional control may operate. A
motif that can be predicted to be involved in regulating
transcription was identified by the ability of the CAT1 doublestranded oligonucleotide to display specific mobility shifts
when incubated with parasite-enriched nuclear fractions.
Under the conditions tested, this motif was the only region in
over 500 bp of sequence analysed which demonstrated
significant shifts that could be attributed to specific binding of
factors associated with parasite-enriched nuclear extracts.
Extracts derived from uninfected BL20 failed to generate
them (Fig. 4), whereas extracts from infected TaBL20 cells
reproduced the D7 shifts (data not shown), which is further
evidence that these shifts were associated with parasite
fractions.
Selected mutagenesis of the CAT1 probe revealed that a core
sequence of TTTGTAGGG is essential for specific binding,
while the nucleotides flanking this region probably function to
stabilise factor-motif association. We postulate that control of
TamS1 transcription during differentiation is mediated, at least
in part, by an Inr motif in combination with the upstream
(TTTGTAGGG) motif positioned at −42. Our data also
suggests that the related gene in T. parva has a similar promoter
structure. The core motif was not found in known eukaryotic
promoter motifs, indicating it could be Theileria-specific.
Homology was found between the 5′ region of CAT1 with the
MREe motif (Labbe et al., 1991) and included the sequence
CACACA that was shown to be involved in stabilising
complex-a formation. Sequence stretches similar to the reverse
complement (GTGTGT) are also present in the SV40 core
enhancer region (Weiher et al., 1983), and related motifs have
been found in upstream regions of Plasmodium (Lanzer et al.,
1993) and Toxoplasma genes (Gross et al., 1996). Whether
these motifs play a significant role in regulating apicomplexan
transcription is not clear: deletion analysis demonstrated that
the TGCTGTGTC motif had no apparent influence on
expression of the BAG1 gene in T. gondii (Bohne et al., 1997).
Three complexes were found to bind specifically to the
CAT1 probe. All showed elevated levels of formation in
extracts derived from differentiating cultures, and the two
main complexes were clearly detected in extracts of
nondifferentiating cultures. The level of increase in complex-a
and complex-b formation was greater than that observed
between TamS1 DNA template at days 2 and 6 of
differentiation time courses. Thus, it appears, as postulated
previously, that factors with the potential to regulate merozoite
TamS1 gene expression are observed in the preceding phase of
the life cycle and show a quantitative increase relative to their
DNA template(s) during the differentiation process.
Compared to the original CAT1 probe, experiments
performed with the longer CAT2-4 probe and day 6 extracts
generated a higher level of complex-a relative to complex-b
formation. Titration experiments showed that the relationship
between these two complexes was influenced by the
concentration of nuclear extract relative to that of DNA probe,
the upper complex being favoured by higher levels of protein
relative to DNA template. These results bear similarity to data
from other systems, where the ability of transcription factors
to form protein-protein interactions results in the formation of
monomer, homodimer and heterodimer DNA binding
complexes in a concentration-dependent manner (Demczuk et
al., 1993; Gabrielsen et al., 1991). The results from the UVfixation experiments indicated that the major polypeptide
associated with complex-a and complex-b has the same
estimated molecular mass (Fig. 8). Therefore, the quantitative
increase in the level of the DNA binding factor(s) relative to
DNA template observed during differentiation could result in
formation of a dimer (or higher order complex). It is well
known that homodimer and heterodimer formation of DNA
binding factors can modulate (Latchman, 1991; Jones, 1990)
and elevate (Polly et al., 1996; Feuerstein, 1996) target gene
expression. However, as complex-a was also observed in
extracts of nondifferentiating cells it cannot be concluded that
this complex is associated with the commitment step of
differentiation.
The formation of multiple complexes with the core CAT1
DNA binding motif could also be due to independent
recognition of the same (or closely related) binding site by
different factors. This may be the case for complex-c, as the
UV fixation experiment showed a distinct profile for this
complex. Complex-c was detected in extracts of cells close to
(day 4) or during (day 6) merozoite production, and it is
possible that formation of this complex is the result of a
qualitative changeover of factors in a subpopulation of cells
that are committed to differentiation. Alternatively, as this
complex was the least abundant, it may be that a low level of
its associated factor(s) in nondifferentiating cells was beyond
the limit of detection by EMSA. It has yet to be demonstrated
conclusively, therefore, that a qualitative changeover in factors
which bind to the CAT1/CAT2-4 motifs occurs at the switch
to irreversible merozoite production.
2252 B. Shiels and others
In addition to the CAT1 motif of the TamS1 gene, formation
of multiple complexes on a 20 bp DNA motif has been
described for the KAHRP gene of P. falciparum (Lanzer et al.,
1992). Two of these complexes were associated with
expression of KAHRP in a stage-specific manner, while the
third showed a quantitative difference in levels between stages.
Recognition of core nucleotide upstream motifs by multiple
factors may not be unique to Theileria, and could be a
component of a basic mechanism that regulates apicomplexan
gene expression during stage differentiation.
Thanks to Afshan Fairley and Alan May for help in Table
construction and photographic printing. This work was supported by
a grant from The Wellcome Trust.
REFERENCES
Blau, H. M. (1992). Differentiation requires continuous active control. Annu.
Rev. Biochem. 61, 1213-1230.
Bohne, W., Wirsing, A. and Gross, U. (1997). Bradyzoite-specific gene
expression in Toxoplasma gondii requires minimal genomic elements. Mol.
Biochem. Parasitol. 85, 89-98.
Brocklesby, D. W., Barnett, S. F. and Scott, G. R. (1961). Morbidity and
mortality rates in East Coast fever (Theileria parva infection) and their
application to drug screening procedures. Br. Vet. J. 117, 529-531.
Church, G. M. and Gilbert, W. (1984). Genomic sequencing. Proc. Natl.
Acad. Sci. USA 81, 1991-1995.
Chomczynski, P. and Sacchi, N. (1987). Single step method of RNA isolation
by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal.
Biochem. 162, 156-159.
Cox, F. E. G. (1993). Parasitic protozoa. In Modern Parasitology (ed. F. E. G.
Cox), pp. 1-23. Oxford: Blackwell Scientific Publications.
Demczuk, S., Harbers, M. and Vennstrom, B. (1993). Identification and
analysis of all components of a gel retardation assay by combination with
immunoblotting. Proc. Natl. Acad. Sci. USA 90, 2574-2578.
Dent, C. L. and Latchman, D. S. (1993). The DNA mobility shift assay. In
Transcription factors: A Practical Approach (ed. D. S. Latchman), pp. 4979. Oxford. Oxford University Press.
Feuerstein N., Firestein R., Aiyar, N., He, X., Murasko, D. and Cristofalo,
V. (1996). Late induction of CREB/ATF binding and a concomitant increase
in cAMP levels in T and B lymphocytes stimulated via the antigen receptor.
J. Immunol. 156, 4582-4593.
Fox, M. (1997). Regulation of TamS1 gene expression during differentiation
to the merozoite in Theileria annulata. PhD thesis, University of
Glasgow.
Frohman, M. A., Dush, M. K. and Martin, G. R. (1988). Rapid production
of full length cDNAs from rare transcripts: amplification using a single
gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85, 89989002.
Gabrielsen, O. S., Sentenac, A. and Fromageot, P. (1991). Specific DNA
binding by c-Myb: evidence for a double helix-turn-helix related motif.
Science 253, 1140-1143.
Genersch, E., Eckerskorn, C., Lottspeich, F., Herzog, C., Kuhn, K and
Poschl, E. (1995). Purification of the sequence-specific transcription factor
CTCBF, involved in the control of human collagen IV genes: subunits with
homology to Ku antigen. EMBO. J. 14, 791-800.
Gross, U., Bohne, W., Soete, M. and Dubremetz, J. F. (1996). Developmental
differentiation between tachyzoites and bradyzoites of Toxoplasma gondii.
Parasitol. Today 12, 30-33.
Hori, R. and Firtel R. A. (1994). Identification and characterization of
multiple A/T rich cis-acting elements that control expression from
Dictyostelium actin promoters: the Dictyostelium actin upsteam activating
sequence confers growth phase expression and has enhancer like properties.
Nucleic Acids Res. 22, 5099-5111.
Horrocks, P., Dechering, K. and Lanzer, M. (1998). Control of gene
expression in Plasmodium falciparum. Mol. Biochem. Parasitol. 95, 171181.
Hulliger, L. (1965). Cultivation of three species of Theileria in lymphoid cells
in vitro. J. Protozool. 12, 649-655.
Jarrett, W. F. H., Crighton, G. W. and Pirie, H. M. (1969). Theileria parva:
kinetics of replication. Exp. Parasitol. 24, 9-25.
Javahery R., Khachi, A., Lo, K., Zenzie-Gregory, B., Smale, S. T. (1994).
DNA sequence requirements for transcriptional initiator activity in
mammalian cells. Mol. Cell. Biol. 14, 116-127.
Jones, N. (1990). Transcriptional regulation by dimerization: two sides to an
incestuous relationship. Cell 61, 9-11.
Kawazu, S., Sugimoto, C., Kamio, T. and Fujisaki, K. (1992). Analysis of
genes encoding immunodominant piroplasm surface proteins of Theileria
sergenti and Theileria buffeli by nucleotide sequencing and polymerase
chain reaction. Mol. Biochem. Parasitol. 56, 169-176.
Kooter, J. M. van der Spek, H. J., Wagter, R., d’Oliveira, C. E., van der
Hoeven, F. Johnson, P. J. and Borst, P. (1987). The anatomy and
transcription of a telomeric expression site for variant-specific surface
antigens in T. brucei. Cell 51, 261-272.
Labbe, S., Prevost, J., Remondelli, P., Leone, A., Seguin, C. (1991). A
nuclear factor binds to the metal regulatory elements of the mouse gene
encoding metallothionein-I. Nuc. Acids Res. 19, 4225-4231.
Lanzer, M., de Bruin, D. and Ravetch, J. V. (1992). A sequence element
associated with the Plasmodium falciparum KAHRP gene is the site of
developmentally regulated protein-DNA interactions. Nuc. Acids. Res. 20,
3051-3056.
Lanzer, M., Wertheimer, S. P. de Bruin., D. and Ravetch, J. V. (1993).
Plasmodium: control of gene expression in malaria parasites. Exp. Parasitol.
77, 121-128.
Latchman, D. S. (1991). Eukaryotic Transcription Factors. London:
Academic Press.
Lue, N. F. Buchman, A. R. and Kornberg, R. D. (1989). Activation of yeast
RNA polymerase II transcription by a thymidine rich upstream element in
vitro. Proc. Natl. Acad. Sci. USA 86, 486-490.
Nakaar, V., Bermudes, D., Peck, K. R. and Joiner, K. A. (1998). Upstream
elements required for expression of nucleoside triphosphate hydrolase genes
of Toxoplasma gondii. Mol. Biochem. Parasitol. 92, 229-239.
Polly, P., Carlberg, C., Eisman, J. A. and Morrison, N. A. (1996).
Identification of a vitamin D3 response element in the fibronectin gene that
is bound by a vitamin D3 receptor homodimer. J. Cell Biol. 60, 322-333.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A
Laboratory Manual (2nd edition). New York: Cold Spring Harbour
Laboratory.
Shiels, B. R. (1999). Should I stay or should I go now? A stochastic model of
stage differentiation in Theileria annulata. Parasitol. Today 15, 241-245.
Shiels, B., Aslam, N., McKellar, S., Smyth, A. and Kinnaird, J. (1997).
Modulation of protein synthesis relative to DNA synthesis alters the timing
of differentiation in the protozoan parasite Theileria annulata. J. Cell Sci.
110, 1441-1451.
Shiels, B. R., d’Oliveira, C., McKellar, S., Ben-Miled, L., Kawazu, S. and
Hide, G. (1995). Selection of diversity at putative glycosylation sites in the
immunodominant merozoite/piroplasm surface antigen of Theileria
parasites. Mol. Biochem. Parasitol. 72, 149-162.
Shiels, B. R., Kinnaird, J., McKellar, S., Dickson, T., Ben-Miled, L.,
Melrose, R., Brown, D. and Tait, A. (1992). Disruption of synchrony
between parasite growth and host cell division is a determinant of
differentiation to the merozoite in Theileria annulata. J. Cell Sci. 101, 99107.
Shiels, B. R., Smyth, A., Dickson, J., McKellar, S., Tetley, L., Fujisaki, K.,
Hutchinson, B. and Kinnaird, J. H. (1994). A stoichiometric model of
stage differentiation in the protozoan parasite Theileria annulata. Mol. Cell
Diff. 2, 101-125.
Shiels, B. R., Swan, D., McKellar, S., Aslam, N., Dando, C., Fox, M., BenMiled, L. and Kinnaird, J. (1998). Directing differentiation in Theileria
annulata: old methods and new possibilities for control of apicomplexan
parasites. Int. J. Parasitol. 28, 1659-1670.
Smale, S. T. and Baltimore, D. (1989). The ‘initiator’ as a transcription
control element. Cell 57, 103-113.
Struhl, K. (1985). Naturally occurring poly (dA-dT) sequences are upstream
promoter elements for constitutive transcription in yeast. Proc. Natl. Acad.
Sci. USA 82, 8419-8423.
Swan, D. G., Phillips, K., Tait, A. and Shiels, B. R. (1999). Evidence for
localisation of a Theileria parasite AT hook DNA-binding protein to the
nucleus of immortalised bovine host cells. Mol. Biochem. Parasitol. 101,
117-129.
Weiher, H., Konig, M. and Gruss, P. (1983). Multiple point mutations
affecting the Simian Virus 40 enhancer. Science 219, 626-631.