Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Alzheimer's disease wikipedia , lookup
Development of the nervous system wikipedia , lookup
Neuropsychopharmacology wikipedia , lookup
Subventricular zone wikipedia , lookup
Optogenetics wikipedia , lookup
Clinical neurochemistry wikipedia , lookup
Feature detection (nervous system) wikipedia , lookup
Stanford Journal of Neuroscience RNA Interference Against BACE1 Suppresses BACE1 and Aβ Expression in PC12 Cells and DRG Neurons Jina Hyun Cerebral deposition of Aβ in neuritic plaques is one of the pathological hallmarks of Alzheimer’s Disease (AD). The activity of β-amyloid-cleaving-enzyme 1 (BACE1), an aspartyl protease that cleaves the amyloid precursor protein (APP) at the β-site, plays a key role in the formation of A-beta (Aβ) fragments. These fragments aggregate to form Aβ oligomers. It is hypothesized that 1) siRNA constructs can effectively reduce endogenous BACE1 expression in the rat pheochromocytoma (PC12) cell line and primary neuronal cultures such as rat dorsal root ganglions (DRGs); and 2) a decrease in BACE1 will also alter endocytic trafficking and processing of APP and lower Aβ formation in PC12 cells. BACE1 was suppressed by RNA interference (RNAi) in PC12 cells and dorsal root ganglion (DRG) neurons, and BACE1 and Aβ expression were observed. Of four short interfering RNA (siRNA) constructs that were designed and transfected, siRNA3 most effectively reduced BACE1 (p<0.02) and Aβ expression (p<0.02). Using the anti-BACE antibody, a reduced level of endogenous BACE1 expression was detected. The 6E10 antibody, which stains for the 1-17 residue of Aβ and full-length APP, detected a reduction in Aβ in PC12 and DRG neurons. APP was endocytosed by a 20-minute heat treatment in PC12 cells to observe the effects of BACE1 suppression on intracellular APP trafficking. APP endocytosis produced internal punctate structures, which is speculated to have diffused by the suppression of BACE1. It is suggested that RNAi against BACE1 is a potentially effective approach to study APP processing and Aβ production in human neurons. Introduction Alzheimer’s Disease Alzheimer’s Disease (AD) affects more than 12 million people worldwide and accounts for most cases of senile dementia in patients over the age of 60.1 The hallmark of AD pathology is the presence of extracellular neuritic plaques consisting of Aβ oligomers and intracellular aggregations of hyperphosphorylated tau protein in limbic and association cortices.4 Interestingly, the prevalence of AD-like symptoms is higher and occurs at a mean age of 50 years for patients with Down Syndrome (DS).5 DS results from trisomy for chromosome 21.6 The triplication of chromosome 21 leads to overexpression of the Amyloid Precursor Protein (APP), an important locus on chromosome 21 that predicts determines the onset of dementia and AD-like symptoms in people with DS.5 Thus, APP is proposed to play an important role in AD pathology and has been the topic of considerable interest. Amyloid Hypothesis 2 One of the leading theories for explaining the plaque formation of AD is the Amyloid Hypothesis. This hypothesis suggests that when APP is cleaved at the β and γ sites by secretases, the resulting peptide called Aβ aggregates to cause toxicity (Figure 1). The accumulation of Aβ in neuritic plaques may cause axons and dendrites to degenerate. Research has shown that Aβ deposition is essential to AD neuropathology because overexpression of APP leads to oxidative stress, inflammation, dystrophic neurites, synapse loss, and cognitive deficits that all occur in the AD brain.7 In humans, it has been demonstrated that memory impairment correlates strongly with cortical levels of Aβ.8 The key enzymes involved in APP processing are α-secretase (ADAM), β-secretase (BACE), and γ-secretase (Figure 1). These enzymes cleave at the α, β, and γ sites, respectively. There are two possible pathways in APP processing – the amyloidogenic and the antiamyloidogenic pathways. β-secretase is a key enzyme in the amyloidogenic pathway. β-secretase cleaves APP at the Nterminus of APP to release soluble APP β cleavage product (sAPPβ) and C99, a membrane fragment. C99 is further cleaved by γ-secretase to release Aβ. β-secretase is expressed in all tissues, but the highest expression is in neurons.16 Studies have shown that Aβ load is correlated with increased β-secretase activity.17, 18 Antisense inhibition of BACE mRNA decreases the amount of β-secretase cleavage products.18 There are two forms of β-secretase that have been identified: BACE1 and BACE2. BACE1 is considered the major β-secretase in the generation of Aβ peptides because its reactivity with the β cleaving site is higher than BACE2.20 Studies have shown that secretion of Aβ peptides is abolished in BACE1-deficient embryonic cortical neurons.20 Furthermore, in a study where BACE1 activity was suppressed in APP transgenic mice, neurodegen- Stanford Journal of Neuroscience Undergraduate Research erative and behavioral deficits were reduced.21 Treatment options for AD Currently, there is no cure for AD. The current standard of care for mild to moderate AD is limited to treatment with acetylcholine-esterase inhibitors to improve cognitive function and other drugs to manage mood disorders and psychosis.1 Research for AD treatment options has focused on prevention of plaque formation and clearance of existing Aβ. Aβ-clearing therapeutic modalities have focused on the use of insulin-degrading enzyme (IDE) and active or passive immunization. One prevention method is γ-secretase inhibition. Several options have undergone human trials, but most have been rejected due to adverse interactions. The objective of this research is to safely and effectively prevent Aβ formation. Specifically, BACE1 was targeted for inhibition. BACE1 acts alone to produce the β-site cleavage product. Previous BACE1 experiments have shown that BACE1 inhibition is both safe and effective. Mice deficient in BACE1 are healthy and fertile based on gross anatomy, tissue histology, hematology, and clinical chemistry, and their phenotype and behavior appear to be normal. 31, 32 BACE1 deficiency also rescues memory deficits and cholinergic dysfunction in the Tg2576 mouse model of AD based on observation of lower Aβ levels and improved social recognition and spontaneous alternation Y maze tasks.33 Previous studies have tried to prevent Aβ formation by altering the fate of APP, by either suppressing γ-secretase or overexpressing α-secretase.13, 15 However, the exact identities of these proteases are either unknown or may be part of a larger protein complex.1, 14 Thus, targeting α or γ-secretases is not Volume I, Issue 1 - Fall 2007 Figure 1. Amyloidogenic and antiamyloidogenic pathways of amyloid precursor protein (APP). APP is a transmembrane protein with three primary cleavage sites: α, β, and γ. The pathway initiated by α-secretase (ADAM) results in the formation of soluble APPα (sAPPα) and C83. C83 is cleaved by γ-secretase to produce p3 and amyloid precursor protein intracellular domain (AICD). The β-secretase mediated pathway begins with the cleavage of APP at the β cleavage site, producing soluble APPβ (sAPPβ) and C99 fragments. C99 is cleaved by γ-secretase to produce AICD and Aβ fragments. The Aβ fragments oligomerize extracellularly to produce the plaque that is the hallmark of AD pathology. Diagram adapted from Lichtenthaler et. al 2004. safe because it may lead to adverse effects, such as the disturbance of Notch signaling when γ-secretase activity is inhibited.1 In order to inhibit BACE1 activity, a highly specific and potent method called RNA interference (RNAi) was used. RNAi is the silencing of gene expression by double-stranded RNA molecules. It is hypothesized that 1) siRNA constructs can effectively reduce endogenous BACE1 expression in the rat pheochromocytoma (PC12) cell line and primary neuronal cultures such as rat dorsal root ganglions (DRGs); and 2) a decrease in BACE1 will also alter endocytic trafficking and processing of APP and lower Aβ formation in PC12 cells. The PC12 cell line is a useful model for neurons because it resembles pluripotent neural crest cells. Materials and Methods Short hairpin RNA (shRNA) design Four different siRNA target sequences against BACE1 were chosen from the specified region of 4281933 of rat BACE1 by performing a BLAST search with a 30-60% GC range. The gene ID is 9506420. The following shRNA constructs were designed and ordered from GenScript according to the template: Template: (5’-GGATCCCG antisense (loop) sense termination CCAAAAGCTT-3’) siRNA1: (5’-GGATCCCG TATTGCTGAGAGATG GTG (TTCAAGAGA) CACCATCCTTCCT CAGCAATA TTTTTTCCAAAAGCTT-3’) siRNA2: (5’-GGATCCCG TACCACCAATGATCAT GCTCC (TTCAAGAGA) GGAGCATGATCATTGGTGGTA TTTTTCCAAAAGCTT3’) siRNA3: (5’-GGATCCCG TCTACACGTACAATGA TCAGT (TTCAAGAGA) ACTGATCATTG TACGTGTAGA TTTTTTCCAAAAGCTT3’) siRNA4: (5’-GGATCCCG TGTTGGCACGCACAGT GACGT (TTCAAGAGA) ACGTCACTGT GCGTGCCAACA TTTTTTCCAAAAGCT T-3’) 3 Undergraduate Research coli cells. In addition to the plasmids containing the siRNA constructs, 5’UTR BACE1 (a gift from Sven Lammich at Dept of Biochemistry, Adolf Butenandt Institute, Germany), which contains an untranslated region in the 5’ end, BACE1, and pSUPER-EGFP were also transformed. 5’UTR BACE1 and BACE1 served as positive controls to observe the effects of overexpression of BACE1 on endogenous BACE1 expression and cell morphology. The pSUPER-EGFP plasmid served as a negative control. Transfection of PC12 cells and dorsal root ganglion (DRG) Rat pheochromocytoma (PC12) cells and DRG neurons, isolated aseptically from a E15-16 Sprague Dawley rat, were prepared for the transfection. For each of the four siRNA plasmids, 5’UTR BACE1, BACE1, and pSUPER-EGFP, 1 μg plasmid was used for each well, with a total of two sample wells for each plasmid transfection. Endocytosis of APP in PC12 cells PC12 cells were serum-starved for 2 to 4 hours prior to washing with Dulbecco’s Phosphate Buffered Saline (PBS), 10x with Ca2+ and Mg2+ (Sigma-Aldrich) three times. The cells were incubated in 500 μl PBS at 37°C for 20 minutes. Immunohistochemistry BACE1 staining in PC12 cells and DRG: 400 μl of the rabbit antiBACE polyclonal antibody (1:200; ProSci), which recognizes BACE1, was added to each sample. The cells were incubated with 400 μl of Alexa 568 goat anti-rabbit IgG (1:800; Invitrogen). Aβ staining of PC12 cells and DRG: PC12 cells and DRG were washed and stained in the same manner as BACE1 staining with the exception of the primary antibody that was used. 400 μl of 6E10 antibody (1:200; Signet), which reacts with the 1-17 residue of Aβ, Aβ plaque, and full length ** 100 4 70 60 50 40 30 20 10 pSU P EREGFP siR NA -1 siR NA -2 siR NA -3 Transfected Untransfected Transfected Untransfected Transfected Untransfected Transfected 0 Untransfected following siRNA transfection. PC12 cells were transfected with 1 μg siRNA plasmid and incubated overnight at 37°C. Cells were stained using the Anti-BACE antibody (1:200; ProSci) and visualized under confocal microscopy. (a,b) pSUPER-EGFP (control) displayed no change in BACE1 expression as demonstrated by the lack of change in red fluorescent expression (c,d) siRNA1 did not effectively reduce BACE1 expression. (e,f) siRNA2 did not effectively reduce BACE1 expression. (g,h) siRNA3 effectively reduced BACE1 expression. The transfected cell (green; Figure 6h) displayed nearly complete BACE1 suppression as indicated by the arrow (Figure 6g). (i,j) siRNA4 effectively reduced BACE1 expression as indicated by reduced red fluorescent expression of arrowed cells (Figure 6i). Scale bar is 10 μm. N = 2x105 * 80 Transfected Figure 2. BACE1 expression in PC12 cells BACE1 Expression 90 Untransfected Production of vectors The shRNA sequences were amplified by polymerase chain reaction (PCR). The product was cut with HindIII and ligated to a SmaI/ HindIII-digested pZ-OFF EGFP vector. The pZ-OFF EGFP plasmids expressing the siRNA constructs were transformed in DH5αEscherichia siR NA -4 P lasm id Figure 3. BACE1 expression of PC12 cells following suppression of BACE1 with siRNA constructs. PC12 cells were transfected with siRNA constructs and stained for endogenous BACE1 with the Anti-BACE antibody (ProSci). There was significant decrease in BACE1 expression between transfected and untransfected siRNA3 cells *(p<0.02), transfected siRNA3 cells and transfected control cells (p<0.01), transfected and untransfected siRNA4 cells **(p<0.001), and transfected siRNA4 cells and transfected control cells (p<0.05). There was a statistically significant difference between cells transfected with siRNA3 and siRNA4 (p<0.05). Error bars are s.e. N = 2x105 Stanford Journal of Neuroscience Undergraduate Research APP, was added to each sample. Confocal microscopy analyses The images were captured on a Nikon Eclipse E800 using a BioRad Laser-Scanning System Radiance2000 (Hercules, CA). Successful transfection of the plasmids was observed under the FITC channel, as the vector contained EGFP. Endogenous BACE1 and Aβ expression was viewed under the Alexa 568 (red) filter. reducing endogenous BACE1 expression. For siRNA3 and siRNA4, endogenous BACE1 expression was significantly reduced following inhibition of BACE1 as displayed by decreased red fluorescent expres- Statistical analysis Expression levels of BACE1 and Aβ were quantified using LaserPix 4.0 (Bio-Rad). Student’s t-tests were performed to determine if there exists a significant difference between transfected and untransfected cells of the same plasmid, heat-treated and non-heat treated cells of the same plasmid, and between the siRNA constructs and the control plasmid. The null hypothesis was rejected at the 0.05 level. Results Of the four siRNA constructs transfected into PC12 cells, two constructs were most effective in Figure 4. Decreased BACE1 expression in DRG following siRNA3 transfection. DRG neurons were transfected with 1 μg siRNA3 plasmid and incubated for 48 hours in 37°C. DRG neurons were stained for BACE1 using the Anti-BACE antibody (ProSci). (a,b) Neurons transfected with the control plasmid pSUPER-EGFP (green) did not display any changes in BACE1 expression (red). (c,d) DRG neurons transfected with siRNA3 displayed reduced BACE1 expression in the axon. Scale bar is 10 μm. Volume I, Issue 1 - Fall 2007 Figure 5. Aβ expression in PC12 cells transfected with siRNA constructs and warmed. Half of the samples were incubated in PBS at 37°C in order to allow for endocytosis of APP after the PC12 cells were serum starved for 2-4 hours. The other half of samples were not treated with heat to serve as controls. (a-l) Transfected and untransfected cells of both heat-treated and non heat-treated cells for pSUPER-EGFP, siRNA1, and siRNA2 did not result in reduced Aβ expression. (m-p) PC12 transfected with siRNA3 resulted in almost complete suppression of Aβ expression in non heat-treated cells and heat-treated cells as indicated by the arrows. The difference in Aβ expression between transfected and untransfected cells of heat-treated siRNA3 cells was statistically significant (p<0.02). (q-t) Cells transfected with siRNA4 resulted in reduced Aβ. 5 Undergraduate Research Figure 6. Average Aβ density in PC12 cells after siRNA transfection. Transfected with siRNA3 resulted in the greatest reduction in Aβ expression for both heat and non heattreated conditions. The difference was significant between non heat-treated PC12 cells of siRNA3 and pSUPER-EGFP *(p<0.01) and heat-treated transfected and untransfected siRNA3 PC12 cells **(p<0.02). Error bars are s.e. ** 70 60 50 40 Figure 7. Reduced Aβ expression in DRG transfected with siRNA3. DRG neurons were transfected with 1 μg siRNA3 and incubated in 37°C for 48 hours. (a,b) Transfection with pSUPER-EGFP displayed no reduction in Aβ expression in the cell bodies of DRG. (c,d) Upon transfection with siRNA3, Aβ expression in the cell body was almost completely reduced as indicated by the arrow cell. Transfected Untransfected 30 20 * 10 0 No Heat No Heat No Heat No Heat No Heat Heat Heat Heat Heat Heat pSUPEREGFP siRNA1 siRNA2 siRNA3 siRNA4 Plasmid sion (Figure 2). There was a significant difference between transfected and untransfected cells with the siRNA3 plasmid (p<0.02), and between cells transfected with siRNA3 and pSUPER-EGFP control plasmid (p<0.01). PC12 cells transfected with siRNA4 also resulted in a significant decrease in BACE1 expression between transfected and untransfected cells with siRNA4 (p<0.001) and as compared with the pSUPER-EGFP control (p<0.05) (Figure 3). In order to observe the effect of the most effective siRNA plasmid (siRNA3) on reducing BACE1 expression in DRG, siRNA3 was transfected into DRG, using pSUPER-EGFP as a control. DRG transfected with siRNA3 displays reduced endogenous BACE1 expression in the axon (Figure 4). siRNA3 decreases Aβ formation in PC12 cells and DRG PC12 cells were transfected with the siRNA plasmids and stained with the 6E10 antibody (Signet), 6 which detects Aβ1-17 and fulllength APP. In order to observe the relationship between APP internalization and BACE1 expression, endogenous APP of PC12 cells was internalized by treating the cells with heat. Of the four siRNA constructs transfected into PC12 cells, siRNA3 was the most effective in reducing Aβ level (Figure 5). Suppression of BACE1 with siRNA3 and siRNA4 resulted in the greatest reduction of Aβ expression in PC12 cells. Heat-treated PC12 cells transfected with siRNA3 resulted in the greatest Aβ reduction compared to untransfected cells (Figure 6). DRG neurons were transfected with siRNA constructs and stained for Aβ and full-length APP in order to observe expression upon BACE1 suppression. The siRNA3 plasmid effectively lowered Aβ expression in the cell bodies of DRG neurons (Figure 7). Discussion The mechanism of AD pathology remains controversial, but the widely accepted amyloid hy- pothesis suggests that when APP is cleaved at the β and γ sites by BACE1 and γ-secretase, respectively, the Aβ fragments oligomerize to produce the Aβ plaque. Previous studies have tried to prevent Aβ formation by altering the fate of APP, by either suppressing γ-secretase or overexpressing α-secretase.13, 15 However, the exact identities of these proteases are either unknown or may be part of a larger protein complex.1, 14 Thus, targeting α or γ-secretases is not safe because it may lead to adverse effects. On the other hand, BACE1 inhibition has demonstrated effectiveness and has no known adverse side effects. BACE1 knockout mice develop normal phenotype and show memory rescue, indicating BACE1 is an effective target.32, 33 In this experiment, selective suppression of BACE1 was performed by using RNAi against rat BACE1 in PC12 cell cultures and DRG neurons. RNAi against BACE1 proves to be effective for reducing endogenous BACE1 expression in PC12 cells and DRG. Consequently, the reduction of Aβ1-17 upon the intro- Stanford Journal of Neuroscience Undergraduate Research duction of siRNA plasmids demonstrates that there is a strong correlation between BACE1 activity and Aβ formation. The siRNA3 and siRNA4 plasmids most effectively reduced BACE1 expression in PC12 cells and siRNA3 effectively decreased BACE1 expression in DRG (Figure 2, 4). The siRNA3 construct also effectively reduced Aβ production in both PC12 cells and DRG (Figure 5, 7). The ability to reduce BACE1 and Aβ expression in the DRG cultures demonstrates the potency and specificity of RNAi in neuronal cultures. Previous research has found that warming of human embryonic kidney cells caused the formation of Aβ punctate structures, and transfection with a dominant negative mutant of dynamin I, a mediator of protein endocytosis, resulted in the elimination of the punctates, increased shedding of the sAPPα, increased transmembrane expression of full-length APP, and decreased Aβ1-40 formation.38 This study suggests APP is processed predominantly at the plasma membrane and warming indeed promotes intracellular endocytosis. Under this notion, because the 6E10 antibody stains for Aβ1-17, which detects Aβ and full-length APP, PC12 cells with internal punctate structures are either expressing full-length APP or Aβ fragments. Therefore, the reduced punctates and an overall decrease in expression level due to BACE1 suppression suggests that there are multiple roles BACE1 may have played. First, if APP is considered to have been endocytosed from the cell surface and punctates are full-length APP, then BACE1 plays a role in mediation of intracellular APP trafficking. Second, if the punctates are taken to be Aβ fragments, then the diffusion of the fragments sug- Volume I, Issue 1 - Fall 2007 gests that APP proteolysis occurs intracellularly, and suppressing BACE1 activity may have increased the APP substrate for α-secretase. And third, suppression of BACE1 may allow for the disaggregation of Aβ plaque, suggesting cells can be rescued. An alternate hypothesis is that heat-treatment of PC12 cells did not result in endocytosis of APP, but rather, endosomal compartments held APP intracellularly, resulting in the presence of punctate structures. However, studies have shown that full-length APP is present predominantly at the cell membrane, and the lack of APP at the membrane upon heat treatment indicates that the protein is indeed endocytosed.38 And because total full-length APP density should not change as a result of endocytosis, the presence of a decreased signal after 6E10 staining demonstrates that mostly Aβ is stained and not full-length APP. The results of this experiment strengthen the claim that BACE1 is strongly correlated with Aβ production, and inhibition of BACE1 activity with RNAi is a safe and highly effective method for preventing Aβ formation. In order to expand on the findings of this research, more experiments on neuronal cultures and Aβ density analysis would be necessary to solidly claim the positive effects of RNAi on BACE1 suppression. Replication of the experiments and expansion to testing on primary cortical neurons and cerebellar neurons would verify the effectiveness of the siRNA3 and siRNA4 constructs. Furthermore, in vivo experiments on transgenic APP-overexpressing mouse pups or pups with the FAD-linked APPswe mutation would validate the efficacy and non-detrimental effects of the most potent RNAi construct in preventing or clearing Aβ plaque. These in vivo experiments can be performed by inserting the siRNA construct into a viral vectors and delivering into mouse models. Synthesis of shRNA with viral vectors have shown successful inhibition of endogenous genes in cultured cells and in vivo.39 Viral infections have been effectively mitigated through siRNA treatment.40 Previous studies have demonstrated that lentiviral vectors are effective mediums for stable gene silencing in tumor suppressor genes in human fibroblasts.41 However, the drawback to using a lentiviral delivery system in humans at this point is that the normal function of BACE1, if one exists, is unknown. The use of a viral delivery system would have longterm consequences that may not be easily reversible. This research demonstrates the specificity, effectiveness, and potency of RNAi against BACE1. The results suggest that such a specific siRNA design for human BACE1 would also potentially have many benefits. References 1. Citron, M. Alzheimer’s disease: treatments in discovery and development. Nat Neurosci 5 Suppl, 1055-7 (2002). 2. Salehi, A., Delcroix, J. D. & Swaab, D. F. Alzheimer’s disease and NGF signaling. J Neural Transm 111, 323-45 (2004). 3. Kawas, C. H. & Brookmeyer, R. Aging and the public health effects of dementia. N Engl J Med 344, 1160-1 (2001). 4. Selkoe, D. J. Translating cell biology into therapeutic advances in Alzheimer’s disease. Nature 399, A23-31 (1999). 5. Margallo-Lana, M. et al. Influence of the amyloid precursor protein locus on dementia in Down syndrome. Neurology 62, 1996-8 (2004). 6. Chou, K. C. Insights from modeling the tertiary structure of human BACE2. J Proteome Res 3, 1069-72 (2004). 7. Estus, S., Borchelt, D., Kindy, M. S. & Vassar, R. Abeta deposition is essential to AD neuropathology. J Alzheimers Dis 4, 133-8 (2002). 8. Walsh, D. M. & Selkoe, D. J. Deciphering the molecular basis of memory failure 7 Undergraduate Research in Alzheimer’s disease. Neuron 44, 181-93 (2004). 9. Selkoe, D. J. Toward a comprehensive theory for Alzheimer’s disease. Hypothesis: Alzheimer’s disease is caused by the cerebral accumulation and cytotoxicity of amyloid beta-protein. Ann N Y Acad Sci 924, 17-25 (2000). 10. Scheuner, D. et al. Secreted amyloid beta-protein similar to that in the senile plaques of Alzheimer’s disease is increased in vivo by the presenilin 1 and 2 and APP mutations linked to familial Alzheimer’s disease. Nat Med 2, 864-70 (1996). 11. Hardy, J. & Selkoe, D. J. The amyloid hypothesis of Alzheimer’s disease: progress and problems on the road to therapeutics. Science 297, 353-6 (2002). 12. Luo, J. J., Wallace, M. S., Hawver, D. B., Kusiak, J. W. & Wallace, W. C. Characterization of the neurotrophic interaction between nerve growth factor and secreted alpha-amyloid precursor protein. J Neurosci Res 63, 410-20 (2001). 13. Lichtenthaler, S. F. & Haass, C. Amyloid at the cutting edge: activation of alpha-secretase prevents amyloidogenesis in an Alzheimer disease mouse model. J Clin Invest 113, 1384-7 (2004). 14. Asai, M. et al. Putative function of ADAM9, ADAM10, and ADAM17 as APP alpha-secretase. Biochem Biophys Res Commun 301, 231-5 (2003). 15. Grimwood, S. et al. Determination of guinea-pig cortical gamma-secretase activity ex vivo following the systemic administration of a gamma-secretase inhibitor. Neuro-pharmacology 48, 1002-11 (2005). 16. Citron, M. Emerging Alzheimer’s disease therapies: inhibition of beta-secretase. Neurobiol Aging 23, 1017-22 (2002). 17. Li, R. et al. Amyloid beta peptide load is correlated with increased beta-secretase activity in sporadic Alzheimer’s disease patients. Proc Natl Acad Sci U S A 101, 3632-7 (2004). 18. Vassar, R. et al. Beta-secretase cleavage of Alzheimer’s amyloid precursor protein by the transmembrane aspartic protease BACE. Science 286, 735-41 (1999). 19. Mohajeri, M. H., Saini, K. D. & Nitsch, R. M. Transgenic BACE expression in mouse neurons accelerates amyloid plaque pathology. J Neural Transm 111, 413-25 (2004). 20. Cai, H. et al. BACE1 is the major betasecretase for generation of Abeta peptides by neurons. Nat Neurosci 4, 233-4 (2001). 21. Singer, O. et al. Targeting BACE1 with siRNAs ameliorates Alzheimer disease neuropathology in a transgenic model. Nat Neurosci 8, 1343-9 (2005). 8 22. Yan, R., Munzner, J. B., Shuck, M. E. & Bienkowski, M. J. BACE2 functions as an alternative alpha-secretase in cells. J Biol Chem 276, 34019-27 (2001). 23. Farris, W. et al. Insulin-degrading enzyme regulates the levels of insulin, amyloid beta-protein, and the beta-amyloid precursor protein intracellular domain in vivo. Proc Natl Acad Sci U S A 100, 4162-7 (2003). 24. Leissring, M. A. et al. Enhanced proteolysis of beta-amyloid in APP transgenic mice prevents plaque formation, secondary pathology, and premature death. Neuron 40, 1087-93 (2003). 25. Tuszynski, M. H. et al. A phase 1 clinical trial of nerve growth factor gene therapy for Alzheimer disease. Nat Med 11, 551-5 (2005). 26. Klyubin, I. et al. Amyloid beta protein immunotherapy neutralizes Abeta oligomers that disrupt synaptic plasticity in vivo. Nat Med 11, 556-61 (2005). 27. Mohajeri, M. H. et al. Passive immunization against beta-amyloid peptide protects central nervous system (CNS) neurons from increased vulnerability associated with an Alzheimer’s disease-causing mutation. J Biol Chem 277, 33012-7 (2002). 28. Schiltz, J. G. et al. Antibodies from a DNA peptide vaccination decrease the brain amyloid burden in a mouse model of Alzheimer’s disease. J Mol Med 82, 706-14 (2004). 29. Walsh, D. M., Klyubin, I., Fadeeva, J. V., Rowan, M. J. & Selkoe, D. J. Amyloidbeta oligomers: their production, toxicity and therapeutic inhibition. Biochem Soc Trans 30, 552-7 (2002). 30. Espeseth, A. S. et al. Compounds that bind APP and inhibit Abeta processing in vitro suggest a novel approach to Alzheimer disease therapeutics. J Biol Chem 280, 17792-7 (2005). 31. Luo, Y. et al. Mice deficient in BACE1, the Alzheimer’s beta-secretase, have normal phenotype and abolished betaamyloid generation. Nat Neurosci 4, 231-2 (2001). 32. Roberds, S. L. et al. BACE knockout mice are healthy despite lacking the primary beta-secretase activity in brain: implications for Alzheimer’s disease therapeutics. Hum Mol Genet 10, 1317-24 (2001). 33. Ohno, M. et al. BACE1 deficiency rescues memory deficits and cholinergic dysfunction in a mouse model of Alzheimer’s disease. Neuron 41, 27-33 (2004). 34. Novina, C. D. & Sharp, P. A. The RNAi revolution. Nature 430, 161-4 (2004). 35. Dykxhoorn, D. M., Novina, C. D. & Sharp, P. A. Killing the messenger: short RNAs that silence gene expression. Nat Rev Mol Cell Biol 4, 457-67 (2003). 36. Kao, S. C., Krichevsky, A. M., Kosik, K. S. & Tsai, L. H. BACE1 suppression by RNA interference in primary cortical neurons. J Biol Chem 279, 1942-9 (2004). 37. Lee, E. B. et al. BACE overexpression alters the subcellular processing of APP and inhibits Abeta deposition in vivo. J Cell Biol 168, 291-302 (2005). 38. Carey, R. M., Balcz, B. A., Lopez-Coviella, I. & Slack, B. E. Inhibition of dynamindependent endocytosis increases shedding of the amyloid precursor protein ectodomain and reduces generation of amyloid beta protein. BMC Cell Biol 6, 30 (2005). 39. Hasuwa, H., Kaseda, K., Einarsdottir, T. & Okabe, M. Small interfering RNA and gene silencing in transgenic mice and rats. FEBS Lett 532, 227-30 (2002). 40. Gitlin, L., Karelsky, S. & Andino, R. Short interfering RNA confers intracellular antiviral immunity in human cells. Nature 418, 430-4 (2002). 41. Stewart, S. A. et al. Lentivirus-delivered stable gene silencing by RNAi in primary cells. Rna 9, 493-501 (2003). Stanford Journal of Neuroscience