Download RNA Interference Against BACE1 Suppresses BACE1 and Aβ

Stanford Journal of Neuroscience
RNA Interference Against BACE1 Suppresses BACE1 and
Aβ Expression in PC12 Cells and DRG Neurons
Jina Hyun
Cerebral deposition of Aβ in neuritic plaques is one of the pathological hallmarks of Alzheimer’s Disease (AD). The activity of β-amyloid-cleaving-enzyme 1 (BACE1), an aspartyl protease that cleaves the amyloid precursor protein (APP) at the
β-site, plays a key role in the formation of A-beta (Aβ) fragments. These fragments aggregate to form Aβ oligomers. It is
hypothesized that 1) siRNA constructs can effectively reduce endogenous BACE1 expression in the rat pheochromocytoma
(PC12) cell line and primary neuronal cultures such as rat dorsal root ganglions (DRGs); and 2) a decrease in BACE1 will
also alter endocytic trafficking and processing of APP and lower Aβ formation in PC12 cells. BACE1 was suppressed by
RNA interference (RNAi) in PC12 cells and dorsal root ganglion (DRG) neurons, and BACE1 and Aβ expression were
observed. Of four short interfering RNA (siRNA) constructs that were designed and transfected, siRNA3 most effectively
reduced BACE1 (p<0.02) and Aβ expression (p<0.02). Using the anti-BACE antibody, a reduced level of endogenous
BACE1 expression was detected. The 6E10 antibody, which stains for the 1-17 residue of Aβ and full-length APP, detected
a reduction in Aβ in PC12 and DRG neurons. APP was endocytosed by a 20-minute heat treatment in PC12 cells to observe
the effects of BACE1 suppression on intracellular APP trafficking. APP endocytosis produced internal punctate structures,
which is speculated to have diffused by the suppression of BACE1. It is suggested that RNAi against BACE1 is a potentially effective approach to study APP processing and Aβ production in human neurons.
Introduction
Alzheimer’s Disease
Alzheimer’s Disease (AD) affects more than 12 million people
worldwide and accounts for most
cases of senile dementia in patients
over the age of 60.1 The hallmark
of AD pathology is the presence of
extracellular neuritic plaques consisting of Aβ oligomers and intracellular aggregations of hyperphosphorylated tau protein in limbic and
association cortices.4 Interestingly,
the prevalence of AD-like symptoms is higher and occurs at a mean
age of 50 years for patients with
Down Syndrome (DS).5 DS results
from trisomy for chromosome 21.6
The triplication of chromosome 21
leads to overexpression of the Amyloid Precursor Protein (APP), an
important locus on chromosome 21
that predicts determines the onset
of dementia and AD-like symptoms
in people with DS.5 Thus, APP is
proposed to play an important role
in AD pathology and has been the
topic of considerable interest.
Amyloid Hypothesis
2
One of the leading theories for
explaining the plaque formation
of AD is the Amyloid Hypothesis.
This hypothesis suggests that when
APP is cleaved at the β and γ sites
by secretases, the resulting peptide
called Aβ aggregates to cause toxicity (Figure 1). The accumulation of
Aβ in neuritic plaques may cause
axons and dendrites to degenerate. Research has shown that Aβ
deposition is essential to AD neuropathology because overexpression
of APP leads to oxidative stress,
inflammation, dystrophic neurites,
synapse loss, and cognitive deficits
that all occur in the AD brain.7 In
humans, it has been demonstrated
that memory impairment correlates
strongly with cortical levels of Aβ.8
The key enzymes involved in
APP processing are α-secretase
(ADAM), β-secretase (BACE), and
γ-secretase (Figure 1). These enzymes cleave at the α, β, and γ sites,
respectively. There are two possible pathways in APP processing
– the amyloidogenic and the antiamyloidogenic pathways.
β-secretase is a key enzyme
in the amyloidogenic pathway.
β-secretase cleaves APP at the Nterminus of APP to release soluble
APP β cleavage product (sAPPβ)
and C99, a membrane fragment.
C99 is further cleaved by γ-secretase to release Aβ. β-secretase is
expressed in all tissues, but the
highest expression is in neurons.16
Studies have shown that Aβ load is
correlated with increased β-secretase activity.17, 18 Antisense inhibition of BACE mRNA decreases
the amount of β-secretase cleavage
products.18
There are two forms of β-secretase that have been identified:
BACE1 and BACE2. BACE1 is considered the major β-secretase in the
generation of Aβ peptides because
its reactivity with the β cleaving
site is higher than BACE2.20 Studies have shown that secretion of Aβ
peptides is abolished in BACE1-deficient embryonic cortical neurons.20
Furthermore, in a study where
BACE1 activity was suppressed in
APP transgenic mice, neurodegen-
Stanford Journal of Neuroscience
Undergraduate Research
erative and behavioral deficits were
reduced.21
Treatment options for AD
Currently, there is no cure for
AD. The current standard of care
for mild to moderate AD is limited
to treatment with acetylcholine-esterase inhibitors to improve cognitive function and other drugs to
manage mood disorders and psychosis.1 Research for AD treatment
options has focused on prevention
of plaque formation and clearance of
existing Aβ. Aβ-clearing therapeutic modalities have focused on the
use of insulin-degrading enzyme
(IDE) and active or passive immunization. One prevention method
is γ-secretase inhibition. Several
options have undergone human
trials, but most have been rejected
due to adverse interactions.
The objective of this research is
to safely and effectively prevent Aβ
formation. Specifically, BACE1 was
targeted for inhibition. BACE1 acts
alone to produce the β-site cleavage product. Previous BACE1 experiments have shown that BACE1
inhibition is both safe and effective.
Mice deficient in BACE1 are healthy
and fertile based on gross anatomy,
tissue histology, hematology, and
clinical chemistry, and their phenotype and behavior appear to be
normal. 31, 32 BACE1 deficiency also
rescues memory deficits and cholinergic dysfunction in the Tg2576
mouse model of AD based on observation of lower Aβ levels and
improved social recognition and
spontaneous alternation Y maze
tasks.33 Previous studies have tried
to prevent Aβ formation by altering
the fate of APP, by either suppressing γ-secretase or overexpressing
α-secretase.13, 15 However, the exact identities of these proteases are
either unknown or may be part of
a larger protein complex.1, 14 Thus,
targeting α or γ-secretases is not
Volume I, Issue 1 - Fall 2007
Figure 1. Amyloidogenic and antiamyloidogenic pathways of amyloid precursor protein (APP). APP is a transmembrane protein with three primary cleavage sites: α, β,
and γ. The pathway initiated by α-secretase (ADAM) results in the formation of soluble
APPα (sAPPα) and C83. C83 is cleaved by γ-secretase to produce p3 and amyloid precursor protein intracellular domain (AICD). The β-secretase mediated pathway begins
with the cleavage of APP at the β cleavage site, producing soluble APPβ (sAPPβ) and C99
fragments. C99 is cleaved by γ-secretase to produce AICD and Aβ fragments. The Aβ
fragments oligomerize extracellularly to produce the plaque that is the hallmark of AD
pathology. Diagram adapted from Lichtenthaler et. al 2004.
safe because it may lead to adverse
effects, such as the disturbance of
Notch signaling when γ-secretase
activity is inhibited.1
In order to inhibit BACE1 activity, a highly specific and potent
method called RNA interference
(RNAi) was used. RNAi is the silencing of gene expression by double-stranded RNA molecules. It is
hypothesized that 1) siRNA constructs can effectively reduce endogenous BACE1 expression in the
rat pheochromocytoma (PC12) cell
line and primary neuronal cultures
such as rat dorsal root ganglions
(DRGs); and 2) a decrease in BACE1
will also alter endocytic trafficking
and processing of APP and lower
Aβ formation in PC12 cells. The
PC12 cell line is a useful model for
neurons because it resembles pluripotent neural crest cells.
Materials and Methods
Short hairpin RNA (shRNA) design
Four different siRNA target sequences against BACE1 were chosen from the specified region of 4281933 of rat BACE1 by performing a
BLAST search with a 30-60% GC
range. The gene ID is 9506420. The
following shRNA constructs were
designed and ordered from GenScript according to the template:
Template:
(5’-GGATCCCG antisense (loop) sense termination CCAAAAGCTT-3’)
siRNA1:
(5’-GGATCCCG TATTGCTGAGAGATG
GTG (TTCAAGAGA) CACCATCCTTCCT
CAGCAATA TTTTTTCCAAAAGCTT-3’)
siRNA2:
(5’-GGATCCCG TACCACCAATGATCAT
GCTCC (TTCAAGAGA) GGAGCATGATCATTGGTGGTA TTTTTCCAAAAGCTT3’)
siRNA3:
(5’-GGATCCCG TCTACACGTACAATGA
TCAGT (TTCAAGAGA) ACTGATCATTG
TACGTGTAGA TTTTTTCCAAAAGCTT3’)
siRNA4:
(5’-GGATCCCG TGTTGGCACGCACAGT
GACGT (TTCAAGAGA) ACGTCACTGT
GCGTGCCAACA TTTTTTCCAAAAGCT
T-3’)
3
Undergraduate Research
coli cells. In addition to the plasmids
containing the siRNA constructs,
5’UTR BACE1 (a gift from Sven
Lammich at Dept of Biochemistry,
Adolf Butenandt Institute, Germany), which contains an untranslated region in the 5’ end, BACE1, and
pSUPER-EGFP were also transformed. 5’UTR BACE1 and BACE1
served as positive controls to observe the effects of overexpression
of BACE1 on endogenous BACE1
expression and cell morphology.
The pSUPER-EGFP plasmid served
as a negative control.
Transfection of PC12 cells and dorsal
root ganglion (DRG)
Rat pheochromocytoma (PC12)
cells and DRG neurons, isolated
aseptically from a E15-16 Sprague
Dawley rat, were prepared for the
transfection. For each of the four
siRNA plasmids, 5’UTR BACE1,
BACE1, and pSUPER-EGFP, 1 μg
plasmid was used for each well,
with a total of two sample wells for
each plasmid transfection.
Endocytosis of APP in PC12 cells
PC12 cells were serum-starved
for 2 to 4 hours prior to washing
with Dulbecco’s Phosphate Buffered Saline (PBS), 10x with Ca2+ and
Mg2+ (Sigma-Aldrich) three times.
The cells were incubated in 500 μl
PBS at 37­­°C for 20 minutes.
Immunohistochemistry
BACE1 staining in PC12 cells
and DRG: 400 μl of the rabbit antiBACE polyclonal antibody (1:200;
ProSci), which recognizes BACE1,
was added to each sample. The
cells were incubated with 400 μl
of Alexa 568 goat anti-rabbit IgG
(1:800; Invitrogen). Aβ staining of
PC12 cells and DRG: PC12 cells and
DRG were washed and stained in
the same manner as BACE1 staining with the exception of the primary antibody that was used. 400
μl of 6E10 antibody (1:200; Signet),
which reacts with the 1-17 residue
of Aβ, Aβ plaque, and full length
**
100
4
70
60
50
40
30
20
10
pSU P EREGFP
siR NA -1
siR NA -2
siR NA -3
Transfected
Untransfected
Transfected
Untransfected
Transfected
Untransfected
Transfected
0
Untransfected
following siRNA transfection. PC12 cells
were transfected with 1 μg siRNA plasmid
and incubated overnight at 37°C. Cells
were stained using the Anti-BACE antibody (1:200; ProSci) and visualized under
confocal microscopy. (a,b) pSUPER-EGFP
(control) displayed no change in BACE1
expression as demonstrated by the lack of
change in red fluorescent expression (c,d)
siRNA1 did not effectively reduce BACE1
expression. (e,f) siRNA2 did not effectively
reduce BACE1 expression. (g,h) siRNA3 effectively reduced BACE1 expression. The
transfected cell (green; Figure 6h) displayed
nearly complete BACE1 suppression as indicated by the arrow (Figure 6g). (i,j) siRNA4 effectively reduced BACE1 expression
as indicated by reduced red fluorescent expression of arrowed cells (Figure 6i). Scale
bar is 10 μm. N = 2x105
*
80
Transfected
Figure 2. BACE1 expression in PC12 cells
BACE1 Expression
90
Untransfected
Production of vectors
The shRNA sequences were
amplified by polymerase chain reaction (PCR). The product was cut
with HindIII and ligated to a SmaI/
HindIII-digested pZ-OFF EGFP
vector.
The pZ-OFF EGFP plasmids expressing the siRNA constructs were
transformed in DH5αEscherichia
siR NA -4
P lasm id
Figure 3. BACE1 expression of PC12 cells following suppression of BACE1 with siRNA
constructs. PC12 cells were transfected with siRNA constructs and stained for endogenous BACE1 with the Anti-BACE antibody (ProSci). There was significant decrease in
BACE1 expression between transfected and untransfected siRNA3 cells *(p<0.02), transfected siRNA3 cells and transfected control cells (p<0.01), transfected and untransfected siRNA4 cells **(p<0.001), and transfected siRNA4 cells and transfected control cells
(p<0.05). There was a statistically significant difference between cells transfected with
siRNA3 and siRNA4 (p<0.05). Error bars are s.e. N = 2x105
Stanford Journal of Neuroscience
Undergraduate Research
APP, was added to each sample.
Confocal microscopy analyses
The images were captured on
a Nikon Eclipse E800 using a BioRad Laser-Scanning System Radiance2000 (Hercules, CA). Successful transfection of the plasmids was
observed under the FITC channel,
as the vector contained EGFP. Endogenous BACE1 and Aβ expression was viewed under the Alexa
568 (red) filter.
reducing endogenous BACE1 expression. For siRNA3 and siRNA4,
endogenous BACE1 expression was
significantly reduced following inhibition of BACE1 as displayed by
decreased red fluorescent expres-
Statistical analysis
Expression levels of BACE1 and
Aβ were quantified using LaserPix
4.0 (Bio-Rad). Student’s t-tests were
performed to determine if there exists a significant difference between
transfected and untransfected cells
of the same plasmid, heat-treated
and non-heat treated cells of the
same plasmid, and between the
siRNA constructs and the control
plasmid. The null hypothesis was
rejected at the 0.05 level.
Results
Of the four siRNA constructs
transfected into PC12 cells, two
constructs were most effective in
Figure 4. Decreased BACE1 expression in
DRG following siRNA3 transfection. DRG
neurons were transfected with 1 μg siRNA3
plasmid and incubated for 48 hours in 37°C.
DRG neurons were stained for BACE1 using the Anti-BACE antibody (ProSci). (a,b)
Neurons transfected with the control plasmid pSUPER-EGFP (green) did not display
any changes in BACE1 expression (red).
(c,d) DRG neurons transfected with siRNA3 displayed reduced BACE1 expression
in the axon. Scale bar is 10 μm.
Volume I, Issue 1 - Fall 2007
Figure 5. Aβ expression in PC12 cells transfected with siRNA constructs and warmed.
Half of the samples were incubated in PBS at 37°C in order to allow for endocytosis of
APP after the PC12 cells were serum starved for 2-4 hours. The other half of samples were
not treated with heat to serve as controls. (a-l) Transfected and untransfected cells of both
heat-treated and non heat-treated cells for pSUPER-EGFP, siRNA1, and siRNA2 did not
result in reduced Aβ expression. (m-p) PC12 transfected with siRNA3 resulted in almost
complete suppression of Aβ expression in non heat-treated cells and heat-treated cells as
indicated by the arrows. The difference in Aβ expression between transfected and untransfected cells of heat-treated siRNA3 cells was statistically significant (p<0.02). (q-t) Cells
transfected with siRNA4 resulted in reduced Aβ.
5
Undergraduate Research
Figure 6. Average Aβ density in PC12 cells after siRNA transfection. Transfected with
siRNA3 resulted in the greatest reduction in Aβ expression for both heat and non heattreated conditions. The difference was significant between non heat-treated PC12 cells
of siRNA3 and pSUPER-EGFP *(p<0.01) and heat-treated transfected and untransfected
siRNA3 PC12 cells **(p<0.02). Error bars are s.e.
**
70
60
50
40
Figure 7. Reduced Aβ expression in DRG
transfected with siRNA3. DRG neurons
were transfected with 1 μg siRNA3 and incubated in 37°C for 48 hours. (a,b) Transfection with pSUPER-EGFP displayed no
reduction in Aβ expression in the cell bodies of DRG. (c,d) Upon transfection with
siRNA3, Aβ expression in the cell body was
almost completely reduced as indicated by
the arrow cell.
Transfected
Untransfected
30
20
*
10
0
No Heat No Heat No Heat No Heat No Heat
Heat
Heat
Heat
Heat
Heat
pSUPEREGFP
siRNA1
siRNA2
siRNA3
siRNA4
Plasmid
sion (Figure 2).
There was a significant difference between transfected and untransfected cells with the siRNA3
plasmid (p<0.02), and between
cells transfected with siRNA3 and
pSUPER-EGFP control plasmid
(p<0.01). PC12 cells transfected
with siRNA4 also resulted in a
significant decrease in BACE1 expression between transfected and
untransfected cells with siRNA4
(p<0.001) and as compared with
the pSUPER-EGFP control (p<0.05)
(Figure 3).
In order to observe the effect
of the most effective siRNA plasmid (siRNA3) on reducing BACE1
expression in DRG, siRNA3 was
transfected into DRG, using pSUPER-EGFP as a control.
DRG
transfected with siRNA3 displays
reduced endogenous BACE1 expression in the axon (Figure 4).
siRNA3 decreases Aβ formation in
PC12 cells and DRG
PC12 cells were transfected with
the siRNA plasmids and stained
with the 6E10 antibody (Signet),
6
which detects Aβ1-17 and fulllength APP. In order to observe the
relationship between APP internalization and BACE1 expression,
endogenous APP of PC12 cells was
internalized by treating the cells
with heat. Of the four siRNA constructs transfected into PC12 cells,
siRNA3 was the most effective in
reducing Aβ level (Figure 5). Suppression of BACE1 with siRNA3
and siRNA4 resulted in the greatest reduction of Aβ expression in
PC12 cells. Heat-treated PC12 cells
transfected with siRNA3 resulted
in the greatest Aβ reduction compared to untransfected cells (Figure
6). DRG neurons were transfected
with siRNA constructs and stained
for Aβ and full-length APP in order
to observe expression upon BACE1
suppression. The siRNA3 plasmid
effectively lowered Aβ expression
in the cell bodies of DRG neurons
(Figure 7).
Discussion
The mechanism of AD pathology remains controversial, but
the widely accepted amyloid hy-
pothesis suggests that when APP
is cleaved at the β and γ sites by
BACE1 and γ-secretase, respectively, the Aβ fragments oligomerize
to produce the Aβ plaque. Previous studies have tried to prevent
Aβ formation by altering the fate of
APP, by either suppressing γ-secretase or overexpressing α-secretase.13, 15 However, the exact identities of these proteases are either
unknown or may be part of a larger
protein complex.1, 14 Thus, targeting
α or γ-secretases is not safe because
it may lead to adverse effects. On
the other hand, BACE1 inhibition
has demonstrated effectiveness and
has no known adverse side effects.
BACE1 knockout mice develop normal phenotype and show memory
rescue, indicating BACE1 is an effective target.32, 33
In this experiment, selective suppression of BACE1 was performed
by using RNAi against rat BACE1
in PC12 cell cultures and DRG neurons. RNAi against BACE1 proves
to be effective for reducing endogenous BACE1 expression in PC12
cells and DRG. Consequently, the
reduction of Aβ1-17 upon the intro-
Stanford Journal of Neuroscience
Undergraduate Research
duction of siRNA plasmids demonstrates that there is a strong correlation between BACE1 activity and
Aβ formation. The siRNA3 and
siRNA4 plasmids most effectively
reduced BACE1 expression in PC12
cells and siRNA3 effectively decreased BACE1 expression in DRG
(Figure 2, 4). The siRNA3 construct also effectively reduced Aβ
production in both PC12 cells and
DRG (Figure 5, 7). The ability to reduce BACE1 and Aβ expression in
the DRG cultures demonstrates the
potency and specificity of RNAi in
neuronal cultures.
Previous research has found
that warming of human embryonic kidney cells caused the formation of Aβ punctate structures, and
transfection with a dominant negative mutant of dynamin I, a mediator of protein endocytosis, resulted
in the elimination of the punctates,
increased shedding of the sAPPα,
increased transmembrane expression of full-length APP, and decreased Aβ1-40 formation.38 This
study suggests APP is processed
predominantly at the plasma membrane and warming indeed promotes intracellular endocytosis.
Under this notion, because the 6E10
antibody stains for Aβ1-17, which
detects Aβ and full-length APP,
PC12 cells with internal punctate
structures are either expressing
full-length APP or Aβ fragments.
Therefore, the reduced punctates
and an overall decrease in expression level due to BACE1 suppression suggests that there are multiple roles BACE1 may have played.
First, if APP is considered to have
been endocytosed from the cell surface and punctates are full-length
APP, then BACE1 plays a role in
mediation of intracellular APP trafficking. Second, if the punctates
are taken to be Aβ fragments, then
the diffusion of the fragments sug-
Volume I, Issue 1 - Fall 2007
gests that APP proteolysis occurs
intracellularly, and suppressing
BACE1 activity may have increased
the APP substrate for α-secretase.
And third, suppression of BACE1
may allow for the disaggregation
of Aβ plaque, suggesting cells can
be rescued. An alternate hypothesis is that heat-treatment of PC12
cells did not result in endocytosis
of APP, but rather, endosomal compartments held APP intracellularly,
resulting in the presence of punctate structures. However, studies
have shown that full-length APP is
present predominantly at the cell
membrane, and the lack of APP at
the membrane upon heat treatment
indicates that the protein is indeed
endocytosed.38 And because total
full-length APP density should not
change as a result of endocytosis,
the presence of a decreased signal
after 6E10 staining demonstrates
that mostly Aβ is stained and not
full-length APP.
The results of this experiment
strengthen the claim that BACE1 is
strongly correlated with Aβ production, and inhibition of BACE1 activity with RNAi is a safe and highly
effective method for preventing Aβ
formation. In order to expand on
the findings of this research, more
experiments on neuronal cultures
and Aβ density analysis would be
necessary to solidly claim the positive effects of RNAi on BACE1 suppression. Replication of the experiments and expansion to testing on
primary cortical neurons and cerebellar neurons would verify the
effectiveness of the siRNA3 and
siRNA4 constructs. Furthermore,
in vivo experiments on transgenic
APP-overexpressing mouse pups or
pups with the FAD-linked APPswe
mutation would validate the efficacy and non-detrimental effects of
the most potent RNAi construct in
preventing or clearing Aβ plaque.
These in vivo experiments can be
performed by inserting the siRNA
construct into a viral vectors and
delivering into mouse models. Synthesis of shRNA with viral vectors
have shown successful inhibition of
endogenous genes in cultured cells
and in vivo.39 Viral infections have
been effectively mitigated through
siRNA treatment.40 Previous studies have demonstrated that lentiviral vectors are effective mediums
for stable gene silencing in tumor
suppressor genes in human fibroblasts.41 However, the drawback to
using a lentiviral delivery system in
humans at this point is that the normal function of BACE1, if one exists, is unknown. The use of a viral
delivery system would have longterm consequences that may not be
easily reversible.
This research demonstrates the
specificity, effectiveness, and potency of RNAi against BACE1. The
results suggest that such a specific
siRNA design for human BACE1
would also potentially have many
benefits.
References
1. Citron, M. Alzheimer’s disease: treatments in discovery and development. Nat
Neurosci 5 Suppl, 1055-7 (2002).
2. Salehi, A., Delcroix, J. D. & Swaab, D. F.
Alzheimer’s disease and NGF signaling. J
Neural Transm 111, 323-45 (2004).
3. Kawas, C. H. & Brookmeyer, R. Aging
and the public health effects of dementia.
N Engl J Med 344, 1160-1 (2001).
4. Selkoe, D. J. Translating cell biology
into therapeutic advances in Alzheimer’s
disease. Nature 399, A23-31 (1999).
5. Margallo-Lana, M. et al. Influence of
the amyloid precursor protein locus on
dementia in Down syndrome. Neurology
62, 1996-8 (2004).
6. Chou, K. C. Insights from modeling
the tertiary structure of human BACE2. J
Proteome Res 3, 1069-72 (2004).
7. Estus, S., Borchelt, D., Kindy, M. S. &
Vassar, R. Abeta deposition is essential to
AD neuropathology. J Alzheimers Dis 4,
133-8 (2002).
8. Walsh, D. M. & Selkoe, D. J. Deciphering the molecular basis of memory failure
7
Undergraduate Research
in Alzheimer’s disease. Neuron 44, 181-93
(2004).
9. Selkoe, D. J. Toward a comprehensive
theory for Alzheimer’s disease. Hypothesis: Alzheimer’s disease is caused by the
cerebral accumulation and cytotoxicity of
amyloid beta-protein. Ann N Y Acad Sci
924, 17-25 (2000).
10. Scheuner, D. et al. Secreted amyloid
beta-protein similar to that in the senile
plaques of Alzheimer’s disease is increased
in vivo by the presenilin 1 and 2 and APP
mutations linked to familial Alzheimer’s
disease. Nat Med 2, 864-70 (1996).
11. Hardy, J. & Selkoe, D. J. The amyloid
hypothesis of Alzheimer’s disease: progress and problems on the road to therapeutics. Science 297, 353-6 (2002).
12. Luo, J. J., Wallace, M. S., Hawver, D.
B., Kusiak, J. W. & Wallace, W. C. Characterization of the neurotrophic interaction
between nerve growth factor and secreted
alpha-amyloid precursor protein. J Neurosci Res 63, 410-20 (2001).
13. Lichtenthaler, S. F. & Haass, C.
Amyloid at the cutting edge: activation of
alpha-secretase prevents amyloidogenesis
in an Alzheimer disease mouse model. J
Clin Invest 113, 1384-7 (2004).
14. Asai, M. et al. Putative function of
ADAM9, ADAM10, and ADAM17 as APP
alpha-secretase. Biochem Biophys Res
Commun 301, 231-5 (2003).
15. Grimwood, S. et al. Determination of
guinea-pig cortical gamma-secretase activity ex vivo following the systemic administration of a gamma-secretase inhibitor.
Neuro-pharmacology 48, 1002-11 (2005).
16. Citron, M. Emerging Alzheimer’s disease therapies: inhibition of beta-secretase.
Neurobiol Aging 23, 1017-22 (2002).
17. Li, R. et al. Amyloid beta peptide load
is correlated with increased beta-secretase
activity in sporadic Alzheimer’s disease
patients. Proc Natl Acad Sci U S A 101,
3632-7 (2004).
18. Vassar, R. et al. Beta-secretase cleavage
of Alzheimer’s amyloid precursor protein
by the transmembrane aspartic protease
BACE. Science 286, 735-41 (1999).
19. Mohajeri, M. H., Saini, K. D. & Nitsch,
R. M. Transgenic BACE expression in
mouse neurons accelerates amyloid plaque
pathology. J Neural Transm 111, 413-25
(2004).
20. Cai, H. et al. BACE1 is the major betasecretase for generation of Abeta peptides
by neurons. Nat Neurosci 4, 233-4 (2001).
21. Singer, O. et al. Targeting BACE1 with
siRNAs ameliorates Alzheimer disease
neuropathology in a transgenic model. Nat
Neurosci 8, 1343-9 (2005).
8
22. Yan, R., Munzner, J. B., Shuck, M. E. &
Bienkowski, M. J. BACE2 functions as an
alternative alpha-secretase in cells. J Biol
Chem 276, 34019-27 (2001).
23. Farris, W. et al. Insulin-degrading
enzyme regulates the levels of insulin,
amyloid beta-protein, and the beta-amyloid precursor protein intracellular domain
in vivo. Proc Natl Acad Sci U S A 100,
4162-7 (2003).
24. Leissring, M. A. et al. Enhanced proteolysis of beta-amyloid in APP transgenic
mice prevents plaque formation, secondary pathology, and premature death.
Neuron 40, 1087-93 (2003).
25. Tuszynski, M. H. et al. A phase 1
clinical trial of nerve growth factor gene
therapy for Alzheimer disease. Nat Med
11, 551-5 (2005).
26. Klyubin, I. et al. Amyloid beta protein
immunotherapy neutralizes Abeta oligomers that disrupt synaptic plasticity in
vivo. Nat Med 11, 556-61 (2005).
27. Mohajeri, M. H. et al. Passive immunization against beta-amyloid peptide
protects central nervous system (CNS)
neurons from increased vulnerability associated with an Alzheimer’s disease-causing
mutation. J Biol Chem 277, 33012-7 (2002).
28. Schiltz, J. G. et al. Antibodies from a
DNA peptide vaccination decrease the
brain amyloid burden in a mouse model of
Alzheimer’s disease. J Mol Med 82, 706-14
(2004).
29. Walsh, D. M., Klyubin, I., Fadeeva, J.
V., Rowan, M. J. & Selkoe, D. J. Amyloidbeta oligomers: their production, toxicity
and therapeutic inhibition. Biochem Soc
Trans 30, 552-7 (2002).
30. Espeseth, A. S. et al. Compounds that
bind APP and inhibit Abeta processing in
vitro suggest a novel approach to Alzheimer disease therapeutics. J Biol Chem
280, 17792-7 (2005).
31. Luo, Y. et al. Mice deficient in BACE1,
the Alzheimer’s beta-secretase, have
normal phenotype and abolished betaamyloid generation. Nat Neurosci 4, 231-2
(2001).
32. Roberds, S. L. et al. BACE knockout
mice are healthy despite lacking the primary beta-secretase activity in brain: implications for Alzheimer’s disease therapeutics.
Hum Mol Genet 10, 1317-24 (2001).
33. Ohno, M. et al. BACE1 deficiency rescues memory deficits and cholinergic dysfunction in a mouse model of Alzheimer’s
disease. Neuron 41, 27-33 (2004).
34. Novina, C. D. & Sharp, P. A. The RNAi
revolution. Nature 430, 161-4 (2004).
35. Dykxhoorn, D. M., Novina, C. D. &
Sharp, P. A. Killing the messenger: short
RNAs that silence gene expression. Nat
Rev Mol Cell Biol 4, 457-67 (2003).
36. Kao, S. C., Krichevsky, A. M., Kosik,
K. S. & Tsai, L. H. BACE1 suppression by
RNA interference in primary cortical neurons. J Biol Chem 279, 1942-9 (2004).
37. Lee, E. B. et al. BACE overexpression
alters the subcellular processing of APP
and inhibits Abeta deposition in vivo. J
Cell Biol 168, 291-302 (2005).
38. Carey, R. M., Balcz, B. A., Lopez-Coviella, I. & Slack, B. E. Inhibition of dynamindependent endocytosis increases shedding
of the amyloid precursor protein ectodomain and reduces generation of amyloid
beta protein. BMC Cell Biol 6, 30 (2005).
39. Hasuwa, H., Kaseda, K., Einarsdottir,
T. & Okabe, M. Small interfering RNA and
gene silencing in transgenic mice and rats.
FEBS Lett 532, 227-30 (2002).
40. Gitlin, L., Karelsky, S. & Andino, R.
Short interfering RNA confers intracellular
antiviral immunity in human cells. Nature
418, 430-4 (2002).
41. Stewart, S. A. et al. Lentivirus-delivered
stable gene silencing by RNAi in primary
cells. Rna 9, 493-501 (2003).
Stanford Journal of Neuroscience