Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Zinc finger nuclease wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA profiling wikipedia , lookup
Eukaryotic DNA replication wikipedia , lookup
DNA nanotechnology wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA polymerase wikipedia , lookup
Microsatellite wikipedia , lookup
DNA replication wikipedia , lookup
UNIT 5 TEST REVIEW DNA STRUCTURE 1) The structure of DNA is often called a: 2) The backbones of DNA are composed of: 3) Correctly pair the nucleotide bases: 4) Look at the warm-ups on the structure of DNA 5) What holds the bases together and how many do you have between each pair? 6) The backbones of DNA are said to be antiparallel because: 7) Which of the base pairs would be more difficult to separate during replication or transcription? 8) How does DNA store information? 9) How is DNA related to a gene? To a chromosome? DNA REPLICATION 1) The purpose of replication is: 2) Why is replication important? 3) Replication occurs in what part of the cell: 4) In what part of the cell cycle does replication occur? Use the following DNA strand to answer the next two questions: 5’ ATTGCG TTATTCAGCTAT Replication AATAAGTCGATA Starts here TAACGC 3’ 5) What would be the first base added to the leading side? Lagging? 6) List the main three enzymes involved in replication and describe their role. DNA TRANSCRIPTION AND TRANSLATION 1) The purpose of transcription is: 2) Why don’t we use the DNA directly to make proteins? 3) List 5 differences between DNA and RNA: 4) In what part of the cell does transcription occur? 5) What is read in transcription? Created? 6) The purpose of translation is: 7) In what part of the cell does translation occur? 8) What is read in translation? Created? 9) What is a codon? Anticodon? 10) How does the dna strand determine the type of proteins that are made? 11) Answer the following questions based upon the following strand of DNA: 3’ 5’ TTCAATGGCGTATGCTTTGTCCCCAGGGTA start DNA other side mRNA tRNA amino acids MUTATION 1) What is a mutation? 2) Can mutations be bad? Explain. 3) Can mutations be good? Explain. 4) What is the difference between a frameshift or point mutation? Which is potentially worse? Why? 5) What is cystic fibrosis? What causes cystic fibrosis? What are the symptoms of cystic fibrosis?